Generazione di modelli cellulari del carcinoma della prostata di resistenza per il Docetaxel agente anti-mitotico

Cancer Research
 

Summary

Resistenza alle terapie del cancro contribuisce alla progressione di malattia e morte. Determinazione delle basi meccanicistiche di resistenza è cruciale per il miglioramento della risposta terapeutica. Dettagli di questo manoscritto, il protocollo di generare modelli di taxano-resistenti delle cellule di carcinoma della prostata (PC) per aiutare le vie di dissezione coinvolti nella progressione alla resistenza di Docetaxel in pazienti del PC.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Agenti di targeting dei microtubuli (MTA) sono un sostegno nel trattamento di una vasta gamma di tumori. Tuttavia, la resistenza acquisita ai farmaci chemioterapici è un meccanismo comune di progressione di malattia e una caratteristica determinante prognostici dei tumori maligni. Nel carcinoma della prostata (PC), resistenza a MTA come taxani Docetaxel dettami guasto del trattamento così come progressiva e letale fasi di malattia che sono definite da una prognosi sfavorevole e alti tassi di mortalità. Anche se studiato per decenni, la matrice di meccanismi che contribuiscono alla resistenza acquisita completamente non sono capiti e quindi rappresentano una limitazione significativa per lo sviluppo di nuove strategie terapeutiche che potrebbero beneficiare i pazienti in queste fasi avanzate di malattia. In questo protocollo, descriviamo la generazione di Docetaxel-resistente linee cellulari di carcinoma della prostata che imitano le caratteristiche letali di carcinoma della prostata di stadio avanzato e pertanto può essere utilizzato per studiare i meccanismi da cui chemioresistenza acquisita si pone. Nonostante i potenziali limiti intrinseci ad un modello di cella in base, ad esempio la perdita di proprietà di resistenza nel tempo, le linee cellulari resistenti a Docetaxel prodotte da questo metodo sono state utilizzate con successo in studi recenti e offrono l'opportunità di avanzare la nostra comprensione dei meccanismi molecolari della chemioresistenza acquisita nel carcinoma della prostata letale.

Introduction

Un aumento del tasso di proliferazione causata dalla perdita di controllo del ciclo cellulare è un marchio di garanzia di cancro1. Questa struttura funzionale rende le cellule tumorali unicamente dipendente dalla fedeltà dei processi chiave del ciclo cellulare durante S-M-fasi e, che ha portato allo sviluppo di vari ciclo cellulare perturbante farmaci che inducono il danno del DNA o difetti mitotici. Anche se numerosi agenti anti-mitotici, come inibitori di chinasi mitotiche o proteine motrici, sono attualmente in fase di sviluppo e testati in studi clinici, agenti mirati ai microtubuli legacy (MTA) continuano ad essere l'unico approccio clinicamente approvato per targeting per mitosi in cancro2,3,4. MTA o destabilizzano (vinblastina, vincristina, vinorelbina) o stabilizzano i microtubuli (agenti di derivazione taxano Paclitaxel, Docetaxel o Cabazitaxel) e quindi evitare la formazione di un funzionamento del fuso mitotico5,6. Questi agenti innescano il mandrino Assemblea checkpoint7,8, che si traduce in un prolungato arresto mitotico e la morte finale delle cellule in cellule coltivate9,10 e alterazioni mitotiche nei tumori11 ,12 e sono pertanto utili per trattare una grande varietà di tumori, tra cui13di carcinoma della prostata.

Carcinoma della prostata è il più frequentemente diagnosticato cancro e delle cause principali del cancro decessi in uomini14. Agenti antimitotici come Docetaxel migliorare la sopravvivenza del malato di cancro alla prostata e sono un sostegno nel trattamento di questa malattia15,16,17. Purtroppo, nonostante il restringimento del tumore iniziale, le cellule del tumore spesso sviluppano resistenza ai farmaci durante il trattamento. Diversi meccanismi cellulari sono stati implicati nel causare lo sviluppo di chemioresistenza, tra cui deregolamentazione di apoptotic e vie infiammatorie, o attivazione/sovraespressione di pompe di efflusso del farmaco come il trasportatore di ATP-binding cassette P-glicoproteina (P-gp/ABCB1), l'ultima delle quali comporta l'esportazione degli agenti chemioterapeutici fuori le cellule18,19. Resistenza ai taxani è stato collegato anche con altre cause, quali i cambiamenti nell'espressione di isotipi di tubulina o mutazioni di tubulina, che impediscono l'interazione tra il farmaco e la sua destinazione 20,21. Inoltre, la resistenza è stato collegato con accumulo di instabilità del genoma e tumore eterogeneità22,23. Tuttavia, i meccanismi che contribuiscono alla resistenza di taxano completamente non sono capiti, che risulta evidente dall'assenza di strategie terapeutiche che impediscono il suo aspetto. Di conseguenza, c'è un urgente bisogno di generare modelli sperimentali che assistono nella dissezione di questi meccanismi e di identificare approcci terapeutici che impediscono lo sviluppo della resistenza a questi farmaci.

In questo articolo descriviamo un metodo che consente la generazione di Docetaxel-resistente (DR) cellule di carcinoma della prostata. Inoltre descriviamo come convalidare lo stato di resistenza di queste cellule utilizzando dosaggi di formazione di Colonia e RT-PCR quantitativa. Cellule prodotte da questo metodo hanno il vantaggio di ricapitolare molte delle caratteristiche molecolari trovati nei database di esempio pubblicamente disponibili e umane del tumore con l'ulteriore vantaggio di fornire la versatilità per eseguire un'ampia varietà di analisi sperimentale su lunghi periodi di tempo rispetto a quanto consentito dai campioni del tumore. Questi modelli di cancro di resistenza di terapia possono essere espansi per molte settimane nella coltura del tessuto e tra altri approcci, possono essere geneticamente manipolati, visualizzati tramite metodi di microscopia e analizzati per l'espressione genica. Inoltre, possono essere xenotrasplanted nei topi per analizzare ulteriormente gli effetti di formazione e la crescita del tumore in vivo. Attualmente, il principale metodo alternativo per studiare la resistenza ai farmaci nel contesto di carcinoma della prostata è l'analisi diretta di campioni di tumore. Mentre questi campioni presentano un sistema molto potente per raccogliere informazioni sull'espressione genica e stato mutazionale dei tumori dato, accesso a loro può essere molto limitata e sono difficili da mantenere per ulteriori manipolazioni e analisi sperimentale, che può essere fatto facilmente con le linee cellulari generate con questo protocollo24,25. Importante, in futuro, i metodi alternativi come la generazione dei organoids umana derivata direttamente dai pazienti sarebbe uno strumento molto potente e alternativa per il presente metodo26,27. Poiché essi saranno ricapitolare in un contesto 3D, quale un tumore era nel suo ambiente originale, organoids sarà il modello perfetto tra linee cellulari e tumori umani. Ancora, i modelli di cellulare sperimentale descritti in questo protocollo sono ancora più adatto per analisi più veloce e conveniente per mantenere. I risultati ottenuti studiando queste linee cellulari possono essere estrapolati per e confermati in campioni umani e culture 3D. Di conseguenza, questo protocollo può essere di interesse per i ricercatori che cercano modelli cellulari per lo studio dei meccanismi di chemioresistenza in qualsiasi linea cellulare, poiché il nostro protocollo può essere adattato allo studio di altri tipi di cancro e di droghe. I metodi descritti qui sono facili da applicare in qualsiasi laboratorio, a prezzi accessibili e permettono studi preliminari dei meccanismi cellulari e molecolari della resistenza ai farmaci.

Protocol

1. determinazione della concentrazione di Docetaxel causando 50% diminuzione nella capacità di formazione di Colonia (IC50)

Nota: nel presente protocollo, Docetaxel IC50 concentrazione è stata valutata utilizzando la formazione della Colonia capacità. Possono essere usati metodi alternativi utilizzati per valutare la vitalità cellulare (vale a dire, i saggi di MTS) basato su investigatori ' preferenze.

  1. DU145 crescere o 22Rv1 cellule in un pallone da 2 di 75 cm e preparare scorte sufficienti di 10mm Docetaxel diluito in DMSO per essere utilizzato negli esperimenti futuri.
  2. Piastra di cellule per la determinazione di IC50 di Docetaxel, rimuovere il supporto dal pallone, lavare accuratamente le cellule con 5 mL di PBS e incubare con 2 mL 0,05% tripsina-EDTA per 3-5 min a 37 ° C per staccare le cellule dalla superficie del pallone.
  3. Sciacquare le cellule tripsinizzate dal pallone con 5 mL di terreno fresco e raccogliere la sospensione cellulare in una provetta da 15 mL. Pellet di cellule mediante centrifugazione (300 x g, 3 min, temperatura ambiente (TA)).
  4. Rimuovere il supernatante, risospendere il pellet cellulare in 5 mL di terreno fresco e contare le celle. Diluire la sospensione cellulare a 2-2,5 x 10 5 cellule/mL per DU145 e 4-4.5 x 10 5 cellule/mL per 22Rv1, miscelare bene pipettando su e giù e 2 mL di sospensione in ciascun pozzetto di due piastre da 6 pozzetti di semi.
  5. Aggiungi
  6. dopo 24 h, quando le cellule sono al 70-80% confluenza, concentrazioni di Docetaxel dose-escalation di 1 nM, 2.5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM e 1000 nM in ciascun pozzetto. Trattare il controllo bene con DMSO al volume più alto utilizzato per Docetaxel ( Figura 2A).
  7. Dopo 72 h, aspirare il farmaco contenente media e aggiungere 2 mL di terreno fresco. Entro circa 4-5 giorni, le piastre sarà pronte per la macchiatura.
  8. Per macchiare le colonie, lavarli delicatamente con 2-3 mL di PBS e incubare a loro con 2-3 mL di cristalvioletto soluzione (0,1% p/v in formalina al 10%) per 20 min all'interno della cappa di coltura del tessuto o una cappa aspirante.
  9. Rimuovere colorazione piastre soluzione e lavare con 2-3 mL di H 2 O, rimuovere H 2 O e asciugare piatti.
  10. Analizzare i risultati visualizzando i pozzetti per determinare quale è la concentrazione di Docetaxel che diminuisce la vitalità cellulare del 50% (IC50). Contare le colonie con l'aiuto di un pennarello (per evitare di contare due volte le stesse colonie) e rappresentano la percentuale di attuabilità delle cellule in un grafico ( Figura 2A) manualmente. Infine, prendere immagini digitali delle piastre per la rappresentazione della figura (come mostrato in Figura 3A).

2. Generazione di cellule di cancro di prostata Docetaxel-resistenti

Nota: eseguire trattamenti con le cellule usando la stessa riserva di soluzione di Docetaxel utilizzata per la determinazione della concentrazione di farmaco IC50 (preparare abbastanza stock in anticipo sperimentale utilizzare). Tenere sempre una piccola boccetta di cellule dal passaggio precedente, nel caso in cui qualcosa non funziona bene. Cellule parentali dovrebbero essere cresciute in parallelo in una piccola boccetta in tutta l'intera procedura ed esposti al veicolo (DMSO) in volumi corrispondenti che imita gli importi utilizzati in beute Docetaxel trattati.

  1. Cellule DU145 piastra o 22Rv1 in boccette di 2 150 cm contenente 20 mL di media (3,5 x 10 6 celle per fiaschetta per DU145 e 6.5 * 10 6 cellule per Boccetta per 22Rv1). 10 a 20 boccette delle cellule si consiglia di avere abbastanza cellule alla fine del protocollo.
  2. Dopo 24 h, quando le cellule sono a circa 70-80% confluenza ( Figura 2B, prima di Docetaxel), aggiungere il Docetaxel alla concentrazione IC50 determinata nel passaggio 1 del protocollo (5 nM per le celle descritto in questo protocollo).
  3. Dopo 72 h, aspirare il farmaco contenente media e aggiungere contenuti multimediali fresco, privo di Docetaxel ( Figura 2B, 72 h dopo Docetaxel). Modificare i media ogni 3-4 giorni. Entro circa 1-2 settimane, cloni resistenti apparirà evidenti sotto il microscopio ( fig. 2B, 7 e 14 giorni dopo Docetaxel).
  4. Media di aspirare, lavare accuratamente le cellule con 15 mL di PBS e incubare con 4 mL 0,05% tripsina-EDTA per 3-5 min a 37 ° C per staccare le cellule dalla superficie del pallone.
  5. Risospendere le cellule tripsinizzate dalla beuta utilizzando 8 mL di terreno fresco. Cellule di piscina da tutte le beute trattate. Pellet di cellule mediante centrifugazione (min 3, RT a 300 x g).
  6. Rimuovere il supernatante, risospendere il pellet cellulare in 20 mL di terreno fresco e piastra le cellule in boccette 2 150 cm (3.5 x 10 6 celle per fiaschetta per DU145 e 6.5 * 10 6 cellule per Boccetta per 22Rv1).
  7. Dopo 24 h, quando le cellule sono a circa 70-80% confluenza, aggiungere 5 nM Docetaxel (IC50 concentrazione iniziale) ancora.
  8. Ripetere i passaggi da 2.3 a 2.6 il giorno 3.
  9. Dopo 24 h, quando le cellule sono a circa 70-80% confluenza, trattare le cellule con 2 X IC50 Docetaxel concentrazione (10 nM per le celle descritto in questo protocollo).
  10. Ripetere i passaggi 2,3 a 2,8, seguendo un incremento della dose di Docetaxel concentrazioni (25 nM, 50 nM, 100 nM e 250 nM), per generare una popolazione stabile di cellule che crescono nella vostra boccette sotto la più alta concentrazione finale. Per concentrazioni più elevate, il protocollo di dose-escalation può essere implementato per fino a 6 mesi fino a raggiungere la concentrazione 1.000 nM ( Figura 1A).

3. Caratterizzazione funzionale di acquisito Docetaxel resistenza da analisi di formazione della Colonia

Nota: nel presente protocollo, chemioresistenza è stata valutata utilizzando dosaggi di formazione di Colonia. Possono essere usati metodi alternativi utilizzati per valutare la vitalità cellulare (vale a dire, i saggi di MTS) basato su investigatori ' preferenze.

  1. Piastra 2.000 cellule (DU145 o 22Rv1 sia dei genitori che Docetaxel-resistente) per pozzetto in piastre da 6 pozzetti, utilizzando 2 mL di media per pozzetto.
  2. Dopo 24 h, aggiungere le concentrazioni aumentanti di Docetaxel (cellule parentali: 0.25, 0.5, 1, 2,5 e 5 nM; DR cellule: 50, 125, 250, 500 e 1.000 nM). Per linee cellulari 22Rv1 e di DU145. Aggiungere DMSO solo a un pozzetto come controllo con lo stesso volume usato per la più alta dose di Docetaxel.
  3. Dopo 72 h, aspirare il farmaco contenente media e aggiungere media senza Docetaxel freschi.
  4. Incubare le piastre per 1-2 settimane fino a quando le colonie sono visibili al microscopio.
  5. Per macchiare le colonie, lavarli delicatamente con 2-3 mL di PBS e incubare a loro con 2-3 mL di cristalvioletto soluzione (0,1% p/v in formalina al 10%) per 20 min all'interno della cappa di coltura del tessuto o una cappa aspirante.
  6. Rimuovere colorazione piastre soluzione e lavare con 2-3 mL di H 2 O, rimuovere H 2 O e asciugare piatti.
  7. Analizzare il risultato attraverso la visualizzazione i pozzi e manualmente conteggio colonie con l'aiuto di un pennarello (per evitare di contare due volte le stesse colonie) e rappresentano la percentuale di attuabilità delle cellule in un grafico. Prendere immagini digitali delle piastre per la rappresentazione della figura ( Figura 3A).

4. Fenotipica caratterizzazione di Docetaxel resistenza acquisita fenotipo tramite qRT-PCR analisi

Nota: cellule Docetaxel-resistenti (DR) presentano un profilo di espressione diversa rispetto alle loro linee cellulare parentale 28 , 29. Pertanto, il successo della selezione può essere verificato mediante qRT-PCR utilizzando primers per gli indicatori specifici (per sequenze dell'iniettore, fare riferimento alla sezione materiali; per dettagli, consultare la sezione risultati). Questo dovrebbe essere fatto dopo ogni turno di selezione a partire dopo il terzo turno. In alternativa, è anche possibile la valutazione del fenotipo resistente al Docetaxel mediante Western blotting.

  1. Estrarre RNA da cellule sia parentali e Docetaxel-resistente utilizzando un kit di estrazione di RNA e seguendo il produttore ' s istruzioni (vedere la Tabella dei materiali e reagenti per dettagli). Si consiglia di utilizzare un minimo di 1-2 x 10 6 cellule.
  2. Assorbanza di
  3. quantificare RNA a 260 nm, utilizzando uno spettrofotometro. Per la migliore purezza, i rapporti di assorbanza di 260 nm/280 nm dovrebbero essere vicino 2.0.
  4. PerfoRM retrotrascrizione di ottenere DNA complementare (cDNA) utilizzando il kit di trascrizione inversa e seguendo il produttore ' s istruzioni (vedere la Tabella dei materiali e reagenti per i dettagli), utilizzando 1 µ g di RNA in un 20 µ l miscela di reazione (se è necessaria una maggiore quantità di cDNA, conseguenza scala fino il mix di reazione).
  5. Preparare la reazione di qPCR in triplice copia per ogni gene di interesse come segue:
    - 2 µ l di primer in avanti di 10 µM
    - 2 µ l di primer inverso di 10 µM
    - 10 mix master di SYBR Green PCR µ l
    - 5 µ l di H 2 O
    -1 µ l di il cDNA appena preparato dal passaggio 4.3.
    Nota: Vedi Tabella materiali per le sequenze dei primer utilizzati in questo protocollo.
  6. Impostare il programma PCR come segue:
    - 95 ° C per 15 min
    - 94 ° C per 30 s |
    -56 ° C per 40 s | 40 volte
    - 72 ° C per 30 s |
  7. Per analizzare risultati qPCR e determinare cambiamenti nell'espressione genica tra genitori e DR campioni, i valori di soglia (Ct) del ciclo per ogni gene di interesse sono determinati in triplice copia e la media normalizzata per il controllo del carico (media triplo di actina ) per DR (Ct DR) e cellule parentali (Ct parentale). Per cellule parentali sono normalizzati a 1. ΔCt (Ct DR - Ct parentale) è determinato a ottenere mRNA finale piega modifiche e rappresentato in un grafico. Un aumento di > 2 o una diminuzione di < 0,5 sono considerati significativi e una buona convalida dell'istituzione del Docetaxel ha acquisito fenotipo resistente ( Figura 3B).

Representative Results

Questo protocollo comporterà la generazione di cellule di carcinoma della prostata Docetaxel-resistenti (DR). La linea temporale per il completamento può variare da 4 a 7 mesi come sintetizzato nella rappresentazione schematica dei passaggi del protocollo in Figura 1A e 1B di figura. L'investimento di tempo poteva differire a seconda della linea cellulare di scelta e la gamma di concentrazioni di farmaco utilizzato come descritto nel protocollo. D'importanza, la determinazione della concentrazione di Docetaxel IC50 per ogni linea cellulare consente la progettazione del farmaco crescente gamma di concentrazione da utilizzare nel protocollo per le cellule di scelta (Figura 2A). Una volta che viene avviato il protocollo, iniziale Docetaxel effetti sulle cellule DU145 e 22Rv1 possono essere osservati in diversi momenti sotto il microscopio per controllare se il protocollo funziona correttamente. Suggerito a intervalli di tempo per monitorare il processo di trattamento di Docetaxel sono: prima esposizione di Docetaxel (basale), dopo l'esposizione di Docetaxel per 72 h, 7 giorni e 14 giorni. Notare che solo una minoranza delle cellule del tumore sopravvivere all'esposizione di Docetaxel e generare cloni, che possono essere osservati al microscopio (Figura 2B).

Rappresentante Colonia formazione saggi e grafici di quantificazione del congedo parentale e le cellule appena generate Docetaxel-resistenti (DR) sono mostrate in Figura 3A. Si noti che le cellule resistenti a Docetaxel generate possono sopravvivere concentrazioni nella droga fino a 1.000 superiore a cellule parentali.

Infine, il fenotipo resistente al Docetaxel può essere convalidato mediante qRT-PCR (Figura 3B). Si noti che le cellule resistenti a Docetaxel, rispetto alle cellule parentali, visualizzano caratteristico up-regolazione di ABCB1 e GATA2 e giù-regolamento della CK19 e CDH1. Questi geni sono stati selezionati per la convalida perché abbiamo già sperimentalmente dimostrato nel nostro lavoro precedentemente pubblicato GATA2 upregulation e downregulation della CK19 insieme CDH1 in entrambi DR cella modelli28,29. Il gene ABCB1 è stata anche selezionato come un graffetta gene che è stato indicato da altri per essere costantemente aumentata in cellule resistenti alla droga18,19. Tuttavia, è importante notare che altri geni possono essere scelti secondo la letteratura e a seconda di modelli cellulari e i farmaci di scelta per la generazione di cellule resistenti dal ricercatore.

Figure 1
Figura 1: sequenza temporale per la generazione di modelli di cellulari di carcinoma della prostata resistente al Docetaxel. (A) diagramma rappresentativo della timeline protocollo per la generazione di modelli cellulari Docetaxel-resistente. Questa illustrazione descrive il trattamento Docetaxel, fasi di validazione e tempo necessario per ogni parte. (B) rappresentazione schematica dei passaggi validazione del protocollo tra cui saggi di formazione funzionale Colonia di cellule parentali e Docetaxel-resistente trattate con le concentrazioni di Docetaxel indicate per 72 h (in rosso), rappresentante grafico della percentuale di Colonia e qRT-PCR per la convalida fenotipica. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: generazione di Docetaxel-resistente sistemi di modello delle cellule di carcinoma della prostata. (A) Diagramma raffigurante la determinazione del Docetaxel IC50 nelle linee cellulari parentale del carcinoma della prostata DU145 e 22Rv1 (passaggio 1 del protocollo). Previste percentuali di attuabilità delle cellule e il Docetaxel concentrazioni di dose-escalation necessari sono incluse. Cella di rappresentante DU145 e 22Rv1 grafici di redditività che indica 5 nM come il IC50 dopo 72 h di esposizione di Docetaxel sono inclusi. Gli esperimenti sono triplici copie e dati rappresentano la media ± SD. (B) rappresentativo del campo luminoso microscopia immagini di DU145 e indicato 22Rv1 cellule a volte durante la generazione di resistenza di Docetaxel (passaggio 2 del protocollo). Frecce rosse indicano un clone resistente Docetaxel dopo aver completato il protocollo. Scala bar = 50 nm. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: caratterizzazione fenotipica e funzionale di modelli cellulari resistenti a Docetaxel. (A) saggi di formazione rappresentante Colonia di cellule parentali e Docetaxel-resistente trattate con le concentrazioni di Docetaxel indicate per 72 h. percentuale di colonie per ogni concentrazione di trattamento è rappresentato nel grafico incluso. Gli esperimenti sono triplici copie e dati rappresentano la media ± SD. scala bar = 5 mm. (B) DR/parentale mRNA fold aumento relativo quantificato mediante qRT-PCR di ABCB1, GATA2, CK19 e CDH1 sono mostrati. Tutti i dati grezzi di qPCR è normalizzato all'actina (Vedi protocollo per dettagli). Gli esperimenti sono triplici copie e dati rappresentano la media ± SD. * p < 0.05. Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

In questo manoscritto, descriviamo un metodo per generare il Docetaxel-resistente sistemi di modello delle cellule di carcinoma della prostata che consente lo studio dei meccanismi che contribuiscono all'acquisizione del fenotipo chemioresistenza. Mentre questo approccio è altamente affidabile e riproducibile, alcune limitazioni potenziali dovrebbero essere considerate. Poiché solo una piccola frazione della popolazione alla rinfusa delle cellule esporrà chemioresistenza28, si raccomanda di iniziare con una grande popolazione di cellule (abbiamo solitamente piastra 20 boccette di 150 cm2, che rappresentano circa 1.2 x 108 cellule). Passaggi chiave del protocollo dovrebbero essere considerati per garantire il successo della procedura. In primo luogo, è molto importante utilizzare il Docetaxel stesso preparata stock per utilizzo a lungo termine (stock di 10 mM le aliquote possono essere utilizzate per anni se conservato correttamente a-80 ° C). Lievi modifiche nel Docetaxel aliquota possono influire i risultati di IC50, generazione della tempistica linea cellulare e i risultati di formazione della Colonia. In secondo luogo, è fondamentale avviare il protocollo di determinazione il IC50 in ogni linea cellulare individuale, poiché variazioni possono verificarsi quando si utilizza un nuovo lotto di cellule. In terzo luogo, è essenziale monitorare che il trattamento farmacologico è efficace controllando frequentemente le cellule al microscopio, così eventuali errori possono essere rilevati rapidamente e rettificati. Infine, si consiglia di tenere sempre una scorta di tappe intermedie in caso di contaminazione o problemi imprevisti che potrebbero influenzare la vitalità delle cellule nel mezzo il protocollo. D'importanza, il nostro protocollo mira a generare modelli di farmacoresistenza esponendo le cellule di carcinoma della prostata ad alte dosi di Docetaxel per 72 h seguita da periodi di recupero lunghi, piuttosto che una concentrazione costante del farmaco nel tentativo di imitare la migliore clinica scenario segnalati per il trattamento di carcinoma della prostata con questo taxano agente15,16.

Inoltre, si deve osservare che le cellule farmaco-resistenti presentano un'elevata plasticità, che può portare a una progressiva perdita delle proprietà di resistenza acquisita nel tempo. Pertanto, l'estensione dell'uso di queste cellule per più di 2-3 mesi nella cultura non è raccomandato. Se è necessaria una fornitura permanente si consiglia di generare continuamente nuovi lotti di cellule resistenti. Tuttavia, se lotti delle cellule sono state coltivate per un tempo prolungato, Colonia formazione saggi e qPCR può essere utilizzati per rivalutare la loro resistenza. Un'altra alternativa è di Spinta Waxing resistenza trattando le cellule con un'alta dose di Docetaxel per 72 h (500-1.000 nM). Dopo un periodo di recupero di una o due settimane, il fenotipo può essere ri-testato da formazione qPCR e Colonia saggi. È anche possibile, sebbene non sia consigliato, per conservare le aliquote delle cellule trattate in azoto liquido (in FBS, 10% DMSO). Siete pregati di notare che dopo un ciclo di gelo-disgelo, il fenotipo di chemioresistenza dovrebbe sempre essere ri-valutato con i metodi di cui sopra.

Nonostante queste riserve, abbiamo28,29 e gli altri30,31,32,33 sono stati in grado di impiegare con successo questi sistemi modello per identificare romanzo chiave cellulare e meccanismi molecolari che portano ad elevata capacità d'inizio, la sopravvivenza delle cellule e aggressività in cellule resistenti a Docetaxel. Utilizzando questi sistemi di modello delle cellule di cancro, abbiamo scoperto che le cellule che esibiscono un fenotipo indifferenziato, caratterizzato da assenza di marcatori di differenziazione epiteliale e prostata-relativi e la sovraespressione di indirizzabile inerente allo sviluppo (tacca e Vie di segnalazione di Hedgehog), sopravvivere chemioterapeutici esposizione28. In un secondo studio, utilizzando questi modelli insieme a gene paziente pubblicamente disponibili set di dati24,25, abbiamo scoperto che il fattore di trascrizione pioneer GATA2 altamente è overexpressed in metastatico resistente alla castrazione cellule di carcinoma della prostata chemioterapia-resistente. GATA2 aumenta la sopravvivenza delle cellule attivando direttamente una IGF2-dipendente chinasi a valle segnalazione rete29. In particolare, questi studi ha contribuiti ad identificare nuovi ruoli chiave di GATA2 nel carcinoma della prostata metastatico avanzato aggressività34.

Lo sviluppo della resistenza ai farmaci è un problema che non è limitato a Docetaxel e carcinoma della prostata, come è diffusa tra molti altri tipi di tumori trattati con una vasta gamma di farmaci chemioterapici. Infatti, si applicano restrizioni simili sulla disponibilità di modelli sperimentali, ed è concepibile che il nostro protocollo può essere adattato per studiare altri tipi di cancro e dei loro meccanismi di chemioresistenza rispettivi.

La generazione di cellule resistenti a Docetaxel come descritto in questo protocollo utilizzabile come uno strumento funzionale per identificare nuovi meccanismi molecolari e cellulari rilevanti di chemioresistenza. Questo apre la porta a trovare nuovi obiettivi, su cui lo sviluppo di nuovi trattamenti per il cancro della prostata altamente maligno potrebbe articolare, ancora una volta i confini di ciò che sappiamo su questa malattia e come trattiamo i suoi pazienti.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgments

V.R.-B. riceve finanziamenti dal U.S. Department of Health & Human Services, NIH, National Cancer Institute concedere numero 1 K22 CA207458-01 e J.D.-D. riceve finanziamenti dal U.S. Department of Health & Human Services, NIH, National Cancer Institute concedere numero 1 CA207311 R01-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics