Génération de modèles de cellules de Cancer de la Prostate de la résistance à l’Agent anti-mitotique docétaxel

Cancer Research
JoVE Journal
Cancer Research
AccessviaTrial
 

Summary

Résistance aux traitements anticancéreux contribue à la mort et de la progression de la maladie. Déterminer les bases mécanistiques de résistance est cruciale pour améliorer la réponse thérapeutique. Détails de ce manuscrit le protocole pour produire des modèles de taxane résistant aux cellules de cancer de la prostate (PC) pour aider à disséquer les voies impliqué dans la progression vers la résistance de docétaxel chez les patients de PC.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Agents de ciblage de microtubules (MTA) sont un pilier dans le traitement d’un large éventail de tumeurs. Cependant, la résistance acquise aux médicaments chimiothérapeutiques est un mécanisme commun de progression de la maladie et un élément déterminant pronostique des tumeurs malignes. Cancer de la prostate (PC), résistance aux MTA comme le taxane Docetaxel dicte un échec thérapeutique mais aussi de progression vers les stades létales de maladie qui sont définis par un mauvais pronostic et taux de mortalité élevés. Bien qu’étudié pendant des décennies, l’éventail des mécanismes qui contribuent à l’acquisition de la résistance ne sont pas complètement comprises et pose ainsi une limitation importante à l’élaboration de nouvelles stratégies thérapeutiques qui pourraient bénéficier des patients dans ces avancées des stades de maladie. Dans ce protocole, nous décrivons la génération de Docetaxel résistant aux lignées cellulaires de cancer de la prostate qui simulent les caractéristiques mortelles de cancer de la prostate de stade avancé et peut donc servir à étudier les mécanismes par lequel chimiorésistance acquis se pose. Malgré les limites potentielles inhérentes à un modèle de cellule en fonction, comme la perte des propriétés de résistance au fil du temps, les lignées de cellules résistant au docétaxel produites par cette méthode ont été utilisées avec succès dans des études récentes et offrent la possibilité de faire progresser notre compréhension moléculaire de chimiorésistance acquise en cancer de la prostate létal.

Introduction

Une augmentation du taux de prolifération causé par la perte de contrôle du cycle cellulaire est une caractéristique de cancer1. Cette propriété fonctionnelle rend les cellules cancéreuses unique dépend de la fidélité des principaux processus du cycle cellulaire pendant S-M-phases et, qui a conduit à l’élaboration de divers cycle cellulaire perturbant les drogues qui induisent des lésions de l’ADN ou des anomalies mitotiques. Bien que de nombreux agents anti mitotiques, comme inhibiteurs de kinases mitotiques ou protéines motrices, sont actuellement développés et testés dans des essais cliniques, les agents de ciblage microtubule hérités (MTA) continuent d’être la seule approche cliniquement approuvée pour ciblage de mitose dans cancer2,3,4. MTA soit déstabilisent (Vinblastine, Vincristine, Vinorelbine) ou stabilisent les microtubules (dérivé de taxane agents Paclitaxel, le docétaxel ou Cabazitaxel) et éviter ainsi la formation d’un fuseau mitotique fonctionnement5,6. Ces agents déclenchent l’axe Assemblée checkpoint7,8, qui se traduit par un arrêt mitotique prolongée et l’éventuelle apoptose dans des cellules cultivées9,10 et anomalies mitotiques dans les tumeurs11 ,12 et sont donc utile pour traiter une grande variété de cancers, notamment cancer de la prostate,13.

Cancer de la prostate est le plus fréquemment diagnostiqué le cancer et des principales causes de cancer associés décès chez les hommes,14. Les agents antimitotiques Docetaxel améliorer la survie du patient de cancer de la prostate et sont un pilier dans le traitement de cette maladie15,16,17. Malheureusement, malgré le rétrécissement de la tumeur primitive, les cellules tumorales développent souvent la résistance aux médicaments au cours du traitement. Plusieurs mécanismes cellulaires ont été impliqués dans l’apparition de l’élaboration de chimiorésistance, y compris la déréglementation de l’apoptose et de la cascade inflammatoire ou activation/surexpression de pompes d’efflux drogues comme transporteur ATP-binding cassette P-glycoprotéine (P-gp/ABCB1), laquelle se traduit par l’exportation des chimiothérapies sur les cellules18,19. Résistance aux taxanes a également été associée avec d’autres causes, tels que les changements dans l’expression de la tubuline isotypes ou mutations de tubuline, empêchant l’interaction entre le médicament et sa cible 20,21. En outre, la résistance est liée à l’accumulation d’instabilité du génome et tumeur hétérogénéité22,23. Cependant, les mécanismes qui contribuent à la résistance de taxanes ne sont pas complètement élucidés, qui est évident par l’absence de stratégies thérapeutiques qui empêchent son apparence. Par conséquent, il y a un besoin urgent pour générer des modèles expérimentaux qui aident dans la dissection de ces mécanismes et d’identifier de nouvelles approches thérapeutiques qui empêchent le développement de la résistance à ces médicaments.

Dans cet article, nous décrivons une méthode qui permet la génération de Docetaxel-résistant (DR) des cellules de cancer de la prostate. Nous décrirons plus loin comment valider l’état de résistance de ces cellules à l’aide de tests de formation de colonie et RT-PCR quantitative. Les cellules produites par cette méthode ont l’avantage de reprenant de nombreuses caractéristiques moléculaires dans les bases de données accessibles au public tumorales humaines avec l’avantage de fournir la polyvalence pour effectuer une grande variété d’essais expérimentaux sur plus longues périodes de temps que permise par des échantillons de tumeur. Ces modèles de cancer de la résistance de la thérapie peuvent être étendues pendant plusieurs semaines en culture de tissus et parmi les approches, peuvent être génétiquement manipulés, visualisées par des méthodes de microscopie et analysés pour l’expression des gènes. En outre, ils peuvent être xenotrasplanted chez les souris pour poursuivre l’analyse des effets de de formation et la croissance tumorale in vivo. Actuellement, la principale méthode alternative pour étudier la résistance aux médicaments dans le cadre du cancer de la prostate est l’analyse directe des échantillons de tumeur. Tandis que ces échantillons présentent un système très puissant pour recueillir des informations sur l’expression génique et statut mutationnel des tumeurs donnés, leur accès peut être très limité, et ils sont difficiles à maintenir pour des manipulations supplémentaires et analyse expérimentale, qui peut facilement être fait avec les lignées de cellules générées avec ce protocole24,25. Ce qui est important, à l’avenir, d’autres approches telles que la génération d’humains organoïdes dérivées directement des patients serait un outil très puissant et une alternative à l’actuelle méthode26,27. Ils récapitulera dans un contexte 3D ce qu’une tumeur était dans son milieu d’origine, organoïdes sera le modèle parfait entre les lignées de cellules et de tumeurs humaines. Pourtant, les modèles de cellule expérimentale décrites dans le présent protocole sont encore plus abordables pour les maintenir et d’analyse plus rapide. Les résultats obtenus par l’étude de ces lignées cellulaires peuvent être extrapolés à et corroborés dans des échantillons humains et cultures 3D. Par conséquent, le présent protocole peut-être être d’intérêt pour les chercheurs qui cherchent des modèles cellulaires afin d’étudier les mécanismes de la chimiorésistance dans n’importe quelle ligne de la cellule, car notre protocole peut être adapté à l’étude d’autres médicaments et les types de cancer. Les méthodes décrites ici sont faciles à appliquer dans n’importe quel laboratoire, abordable et permettent des études préliminaires des mécanismes moléculaires et cellulaires de la pharmacorésistance.

Protocol

1. détermination de la Concentration de Docetaxel causant 50 % diminution de la capacité de Formation de colonie (CI50)

Remarque : dans ce protocole, concentration de Docetaxel IC50 a été évaluée à l’aide de la formation de colonies capacité. Autres méthodes utilisées pour évaluer la viabilité des cellules (c.-à-d., des tests de MTS) peuvent être utilisés à l’issu des enquêteurs ' préférences.

  1. DU145 croître ou 22Rv1 des cellules dans une fiole de 2 75 cm et préparation assez stock de 10 mM Docetaxel dilué dans le DMSO à être utilisés dans des expériences futures.
  2. Plaque de cellules pour la détermination de la CI50 de Docetaxel, retirez le support du flacon, se laver soigneusement les cellules avec 5 mL de PBS et incuber 2 mL 0,05 % trypsine-EDTA pendant 3 à 5 min à 37 ° C pour détacher des cellules de la surface de la fiole.
  3. Rincer les cellules trypsinisés du flacon à l’aide de 5 mL de supports neufs et recueillir la suspension de cellules dans un tube de 15 mL. Cellules de granule par centrifugation (300 x g, 3 min, température ambiante (RT)).
  4. Enlever le surnageant, resuspendre le culot dans 5 mL de supports neufs et compter les cellules non vides. Diluer la suspension de cellules à 2-2. 5 x 10 5 cellules/mL pour DU145 et 4-4. 5 x 10 5 cellules/mL de 22Rv1, bien mélanger en pipetage de haut en bas et 2 mL de la suspension dans chaque puits de deux plaques 6 puits de graines.
  5. Après 24 h, lorsque les cellules sont au confluent de 70 à 80 %, ajoute des concentrations de Docetaxel-escalade de dose de 1 nM, 2,5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM et 1000 nM dans chaque puits. Traiter le contrôle bien avec le DMSO à très haut le volume utilisé pour Docetaxel ( Figure 2 a).
  6. Après 72 h, aspirer le médicament contenant des médias et ajouter 2 mL de supports neufs. Environ 4 à 5 jours, les plaques seront prêts pour la coloration.
  7. Pour souiller les colonies, laver doucement avec 2-3 mL de PBS et les incuber avec 2-3 mL de solution de violet de gentiane (0,1 % p/v dans 10 % de formol) pendant 20 min à l’intérieur de la hotte de la culture de tissus ou une hotte aspirante.
  8. Enlever les plaques coloration de solution et de lavage avec 2-3 mL de H 2 O, supprimer H 2 O et sécher à l’air plaques.
  9. Analyser les résultats en visualisant les puits afin de déterminer qui a la concentration de Docetaxel qui diminue la viabilité cellulaire de 50 % (CI50). Dénombrer les colonies à l’aide d’un marqueur (pour éviter de compter deux fois les mêmes colonies) et représentent le pourcentage de viabilité des cellules dans un graphique ( Figure 2 a) manuellement. Enfin, prendre des images numériques des plaques pour la représentation de la figure (comme illustré à la Figure 3 a).

2. Génération de Docetaxel résistant aux cellules cancéreuses de la Prostate

Remarque : effectuer des traitements de cellule à l’aide de la même souche de solution de Docetaxel utilisée pour la détermination de la concentration du médicament IC50 (préparer suffisamment de stock d’avance pour expérimental utilisation). Gardez toujours une petite fiole des cellules de l’étape précédente, juste au cas où quelque chose ne fonctionne pas bien. Cellules parentales devraient être cultivés en parallèle dans un petit ballon tout au long de la procédure dans son ensemble et exposés au véhicule (DMSO) dans les volumes correspondants imitant les quantités utilisées dans les fioles de Docetaxel traité.

  1. Plaque DU145 ou 22Rv1 des cellules dans des flacons de 2 150 cm contenant 20 mL de médias (3,5 x 10 6 cellules par flacon pour DU145 et 6,5 * 10 6 cellules par flacon pour 22Rv1). De 10 à 20 doses de cellules il est recommandé d’avoir suffisamment de cellules à la fin du protocole.
  2. Après 24 h, lorsque les cellules sont à environ 70-80 % confluence ( Figure 2 b, avant le docétaxel), ajouter le docétaxel à la concentration de CI50 déterminée à l’étape 1 du protocole (5 nM pour les cellules décrites dans le présent protocole).
  3. Après 72 h, aspirer médicament contenant des médias et ajouter des éléments multimédias frais, exempt de Docetaxel ( Figure 2 b, 72 h après le Docetaxel). Modifier les médias tous les 3-4 jours. Dans environ 1-2 semaines, clones résistants apparaîtra évidents sous le microscope ( Figure 2 b, 7 et 14 jours après le docétaxel).
  4. Aspirer des médias, se laver soigneusement les cellules avec 15 mL de PBS et incuber avec 4 mL 0,05 % trypsine-EDTA pendant 3 à 5 min à 37 ° C pour détacher des cellules de la surface de la fiole.
  5. Remettre en suspension les cellules trypsinisés du flacon à l’aide de 8 mL de supports neufs. Les cellules de tous les flacons traitées en commun. Cellules de granule par centrifugation (300 x g, 3 min, RT).
  6. Enlever le surnageant, resuspendre le culot dans 20 mL de supports neufs et plaque les cellules dans des flacons de 2 150 cm (3.5 x 10 6 cellules par flacon pour DU145 et 6,5 * 10 6 cellules par flacon pour 22Rv1).
  7. Après 24 h, lorsque les cellules sont à environ 70-80 % confluence, ajouter 5 nM Docetaxel (concentration initiale de CI50) nouveau.
  8. Répéter les étapes le jour 3 de 2.3 à 2.6.
  9. Après 24 h, lorsque les cellules sont à environ 70-80 % confluence, cellules de régal avec 2 X IC50 Docetaxel concentration (10 nM pour les cellules décrites dans le présent protocole).
  10. Répéter les étapes 2,3 à 2,8, suite à une augmentation de la dose de docétaxel concentrations (25 nM, 50 nM, 100 nM et 250 nM), de générer une population stable de cellules qui croissent dans vos flacons sous la plus forte concentration finale. Pour des concentrations plus élevées, le protocole de l’augmentation de la dose peut être implémenté pour jusqu'à 6 mois, jusqu'à ce que la concentration de 1 000 nM est atteint ( Figure 1 a).

3. Fonctionnelles caractérisation des acquis Docetaxel résistance par colonie Formation dosage

Remarque : dans ce protocole, chimiorésistance a été évaluée à l’aide de tests de formation de colonie. Autres méthodes utilisées pour évaluer la viabilité des cellules (c.-à-d., des tests de MTS) peuvent être utilisés à l’issu des enquêteurs ' préférences.

  1. Plaque 2 000 cellules (DU145 ou 22Rv1, parentales et résistant au docétaxel) / puits dans les plaques 6 puits, 2 mL de médias chaque puits avec.
  2. Après 24 h, ajouter des concentrations croissantes de Docetaxel (cellules parentales : 0.25, 0.5, 1, 2,5 et 5 nM ; Cellules de DR : 50, 125, 250, 500 et 1 000 nM). Pour les lignées cellulaires fois DU145 et 22Rv1. Ajouter DMSO uniquement à un puits comme un contrôle au même volume utilisé pour la plus forte dose de docétaxel.
  3. Après 72 h, aspirer médicament contenant des médias et ajouter des milieux de docétaxel sans frais.
  4. Incuber les boîtes pendant 1 à 2 semaines jusqu'à ce que les colonies sont visibles au microscope.
  5. Pour souiller les colonies, laver doucement avec 2-3 mL de PBS et les incuber avec 2-3 mL de solution de violet de gentiane (0,1 % p/v dans 10 % de formol) pendant 20 min à l’intérieur de la hotte de la culture de tissus ou une hotte aspirante.
  6. Enlever les plaques coloration de solution et de lavage avec 2-3 mL de H 2 O, supprimer H 2 O et sécher à l’air plaques.
  7. Analyser les résultat en visualisant les puits et manuellement comptage des colonies à l’aide d’un marqueur (pour éviter de compter deux fois les mêmes colonies) et représentent le pourcentage de viabilité des cellules dans un graphe. Prendre des images numériques des plaques pour la représentation de la figure ( Figure 3 a).

4. Phénotypique caractérisation du Docetaxel acquis phénotype de résistance via analyse qRT-PCR

Remarque : cellules résistantes au docétaxel (DR) présentent un profil d’expression différente par rapport à leurs lignées parentales 28 , 29. par conséquent, le succès de la sélection peuvent être vérifié par qRT-PCR en utilisant des amorces pour des marqueurs spécifiques (pour les séquences d’amorces, reportez-vous à la section matériaux ; pour plus de détails, reportez-vous à la section de résultats). Cela devrait être fait après chaque tour de sélection en commençant après le troisième tour. Alternativement, évaluation du phénotype résistant au Docetaxel Western Blot est également possible.

  1. Extrait de l’ARN des cellules parentales et Docetaxel-résistant à l’aide d’un kit d’extraction d’ARN et d’après le fabricant ' s directives (voir la Table des matières et réactifs pour plus de détails). En utilisant un minimum de 1-2 x 10 6 cellules est recommandé.
  2. Quantifier RNA à 260 absorbance de nm, à l’aide d’un spectrophotomètre. Pour les meilleurs de la pureté, les 260 nm/280 nm absorbance de taux devraient être proche de 2.0.
  3. Perfo
  4. RM reverse transcription pour obtenir l’ADN complémentaire (ADNc) en utilisant le kit de transcription inverse et suivant le fabricant ' s directives (voir la Table des matières et réactifs pour plus de détails), à l’aide de 1 µg d’ARN dans un 20 µL mélange de réaction (si un montant plus élevé de l’ADNc est nécessaire, étendre le mélange de la réaction en conséquence).
  5. Préparer la réaction de qPCR en trois exemplaires pour chaque gène d’intérêt, comme suit :
    - 2 µL d’apprêt avant de 10 µM
    - 2 µL d’apprêt inverse de 10 µM
    - 10 mélange maître de µL SYBR Green PCR
    - 5 µL H 2 O
    -1 µL de l’ADNc nouvellement préparé à l’étape 4.3.
    Remarque : Consultez la Table des matières pour les séquences des amorces utilisées dans le présent protocole.
  6. Définir le programme de la PCR comme suit :
    - 95 ° C pendant 15 min
    - 94 ° C pendant 30 s |
    -56 ° C pendant 40 s | 40 fois
    - 72 ° C pendant 30 s |
  7. Pour analyser les résultats de qPCR et déterminer les changements dans l’expression des gènes entre parents et DR échantillons, les valeurs de seuil (Ct) de cycle pour chaque gène d’intérêt sont déterminées en triple exemplaire, et la moyenne normalisée pour le contrôle de chargement (en moyenne en triple actine ) pour DR (DR Ct) et les cellules parentales (Ct parentale). Les valeurs pour les cellules parentales sont normalisés à 1. ΔCt (DR Ct - Ct parental) est déterminé à obtenir les ARNm finale pli modifications et représenté dans un graphe. Une augmentation de > 2 ou une diminution de < 0,5 sont considérés comme significatifs et une bonne validation de la mise en place de la Docetaxel acquis phénotype résistant ( Figure 3 b).

Representative Results

Ce protocole conduira à la création de cellules de cancer de la prostate résistant à Docetaxel (DR). Le délai de réalisation peut varier de 4 à 7 mois comme le montre la représentation schématique des étapes protocole dans la Figure 1 a et 1 b de la Figure. L’investissement de temps peut varier selon la lignée cellulaire de choix et la gamme des concentrations du médicament utilisé comme décrit dans le protocole. Ce qui est important, la détermination de la concentration de Docetaxel IC50 pour chaque lignée cellulaire permet la conception de la drogue à l’escalade de la gamme de concentrations d’utiliser le protocole pour les cellules de choix (Figure 2 a). Une fois démarré, le protocole initial Docetaxel effets sur les cellules DU145 et 22Rv1 peuvent être observés à différents moments au microscope pour surveiller si le protocole fonctionne correctement. Suggérées : points dans le temps de suivre le processus de traitement de docétaxel : avant l’exposition au docétaxel (de base), après exposition de Docetaxel pendant 72 h, 7 jours et 14 jours. Notez que seule une minorité de cellules tumorales survivent à l’exposition de Docetaxel et générer des clones, qui peuvent être observées au microscope (Figure 2 b).

Colonie représentant formation analyses et graphiques de la quantification de l’autorité parentale et les cellules nouvellement produits Docetaxel-résistant (DR) sont indiquées dans la Figure 3 a. Notez que les cellules résistantes au Docetaxel générés peuvent survivre à des concentrations du médicament jusqu'à 1000 plus élevées que les cellules parentales.

Enfin, le phénotype résistant au docétaxel peut être validé par qRT-PCR (Figure 3 b). Notez que les cellules résistantes au Docetaxel, comparés aux cellules parentales, affichent vers le haut-règlement caractéristique de ABCB1 et GATA2 et vers le bas-règlement de CK19 et CDH1. Ces gènes ont été sélectionnés pour la validation, parce que nous avons déjà expérimentalement montré dans notre œuvre précédemment publiée GATA2 upregulation et downregulation de CK19 avec CDH1 dans les deux DR cellule modèles28,29. Le gène ABCB1 a également été sélectionné comme un gène discontinue qui a été démontré par d’autres pour être constamment augmenté dans les cellules résistantes aux médicaments18,19. Cependant, il est important de noter que les autres gènes peuvent être choisis selon la littérature et selon les modèles cellulaires et les médicaments choisis pour générer des cellules résistantes par le chercheur.

Figure 1
Figure 1 : chronologie de la génération des modèles de cellules de cancer de la prostate résistant au Docetaxel. (A) le diagramme représentatif de la chronologie de protocole pour la génération de modèles de cellule Docetaxel-résistant. Illustration représente le traitement Docetaxel, étapes de validation et le temps nécessaire pour chaque partie. (B) Représentation schématique des étapes de validation du protocole notamment des essais de formation de colonie fonctionnelle des cellules parentales et résistant au Docetaxel traités par docétaxel concentrations indiquées pendant 72 h (en rouge), représentant graphe de pourcentage de la colonie et qRT-PCR pour validation phénotypique. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : génération de cancer de la prostate résistant au Docetaxel cellule modèle systèmes. (A) schéma illustrant la détermination de le Docetaxel IC50 dans les lignées cellulaires de cancer de la prostate parental DU145 et 22Rv1 (étape 1 du protocole). Pourcentages attendus de la viabilité cellulaire et le Docetaxel-escalade de dose les concentrations nécessaires sont inclus. Représentant DU145 et 22Rv1 cellules graphiques de viabilité indiquant 5 nM comme la CI50 après 72 h d’exposition de Docetaxel sont inclus. Les expériences sont réanalysés et données représentent les images de microscopie moyenne ± SD. (B) champ lumineux représentant des DU145 et 22Rv1 cellules à indiquent pendant la génération de la résistance du docétaxel (étape 2 du protocole). Flèches rouges indiquent un clone du docétaxel résistant à la fin du protocole. Barreaux de l’échelle = 50 nm. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : caractérisation phénotypique et fonctionnelle des modèles cellulaires résistant au Docetaxel. (A) colonie représentant formation essais sur des cellules parentales et résistant au Docetaxel traités par docétaxel concentrations indiquées pendant 72 h. pourcentage des colonies pour chaque concentration de traitement est représentée dans le graphique inclus. Les expériences sont réanalysés et données représentent la moyenne ± SD. échelle bars = 5 mm. (B) DR/parental ARNm fold augmentation relative quantifiés par qRT-PCR de ABCB1, GATA2, CK19 et CDH1 apparaissent. Toutes les données brutes de qPCR est normalisée à l’actine (voir le protocole pour plus de détails). Les expériences sont réanalysés et données représentent la moyenne ± SD. * p < 0,05. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

Dans ce manuscrit, nous décrivons une méthode pour générer des systèmes de modèles résistant au Docetaxel cancer de la prostate cellulaire qui permet l’étude des mécanismes qui contribuent à l’acquisition du phénotype chimiorésistance. Alors que cette approche est très fiable et reproductible, il faudrait quelques limitations potentielles. Depuis seulement une petite fraction de la population en masse de cellules exposera chimiorésistance28, il est recommandé de commencer avec une grande population de cellules (nous plaque généralement de 20 doses de 150 cm2, qui représentent environ 1,2 x 108 cellules). Les étapes clés du protocole devraient considérer pour assurer le succès de la procédure. Tout d’abord, il est très important d’utiliser le docétaxel même fraîchement préparé stock pour l’utilisation de long terme (stock de 10 mM aliquotes peuvent être utilisés pour les années lorsque stocké correctement dans à-80 ° C). Légers changements dans l’aliquote de docétaxel peuvent influer les résultats de la CI50, génération du moment où la ligne cellulaire et les résultats de la formation de colonie. Deuxièmement, il est crucial de commencer le protocole de détermination de la CI50 dans chaque ligne de la cellule individuelle, car les variations peuvent se produire lorsque vous utilisez un nouveau lot de cellules. En troisième lieu, il est essentiel de surveiller que le traitement de la toxicomanie est efficace en contrôlant les cellules au microscope fréquemment afin que toutes les erreurs peuvent être détectées rapidement et corrigées. Enfin, nous vous recommandons de toujours garder un stock d’étapes intermédiaires en cas de contamination ou de problèmes inattendus qui pourraient influer sur la viabilité des cellules au milieu du protocole. Important, notre protocole vise à produire des modèles de la pharmacorésistance en exposant des cellules de cancer de la prostate à des doses élevées de Docetaxel pendant 72 h, suivie de périodes de récupération long, plutôt que des concentrations plus faibles de constantes de la drogue dans une tentative d’imiter le meilleur clinique scénario a indiqué pour le traitement du cancer de la prostate avec ce taxane agent15,16.

En outre, il convient de noter que les cellules résistantes aux médicaments présentent une grande plasticité, qui peut conduire à une perte progressive des propriétés de résistance acquise au fil du temps. Par conséquent, l’extension de l’utilisation de ces cellules pour plus de 2-3 mois de culture n’est pas recommandé. Si un approvisionnement permanent est nécessaire il est recommandé de générer continuellement des nouveaux lots de cellules résistantes. Toutefois, si des lots de cellules ont été cultivés pendant une période prolongée, colonie formation essais et qPCR permet de réévaluer leur résistance. Une autre alternative consiste à accroître la résistance décroissante en traitant les cellules avec une forte dose de docétaxel pendant 72 h (500-1 000 nM). Après une période de récupération d’une à deux semaines, le phénotype peut être re-testé par formation de qPCR et colonie des essais. Il est également possible, bien que non recommandé, pour stocker les aliquotes de cellules traitées dans l’azote liquide (en BF, 10 % DMSO). Veuillez noter qu’après un cycle de gel-dégel, le phénotype de chimiorésistance devrait toujours être réévalué avec les méthodes susmentionnées.

Malgré ces mises en garde, nous avons28,29 et autres30,31,32,,33 ont été en mesure d’employer correctement ces systèmes modèles pour identifier la clé roman cellulaire et mécanismes moléculaires conduisant à élevé déclenchant les tumeur capacité, la survie des cellules et agressivité chez les cellules résistantes au Docetaxel. En utilisant ces systèmes de modèle de cellules de cancer, nous avons découvert que les cellules présentant un phénotype non différencié, caractérisé par l’absence de marqueurs de différenciation épithéliale et liés à la prostate et de la surexpression de targetable développementale (encoche et Voies de signalisation de hérisson), survivre exposition chimiothérapeutiques28. Dans une seconde étude, en utilisant ces modèles avec gène patients accessibles au public des ensembles de données24,25, nous avons découvert que le facteur de transcription pionnier GATA2 est fortement surexprimé dans métastatique résistant à la castration cellules de cancer de la prostate résistant à la chimiothérapie. GATA2 augmente la survie des cellules en activant directement une kinase en aval IGF2-dépendante de signalisation réseau29. Notamment, ces études ont permis d’identifier de nouveaux rôles clés de GATA2 dans le cancer de la prostate métastatique avancé agressivité34.

Le développement de la résistance aux médicaments est un problème qui n’est pas limité à Docetaxel et cancer de la prostate, car il est répandue parmi beaucoup d’autres types de cancers traités avec un large éventail de médicaments chimiothérapiques. En effet, les restrictions semblables sur la disponibilité de modèles expérimentaux, et il est concevable que notre protocole peut être adaptée pour étudier d’autres types de cancer et de leurs mécanismes respectifs chimiorésistance.

La génération de cellules résistantes au Docetaxel, tel que décrit dans le présent protocole peut servir comme un outil fonctionnel pour identifier de nouveaux mécanismes moléculaires et cellulaires de la chimiorésistance. Cela ouvre la voie à la recherche de nouvelles cibles, sur lequel le développement de nouveaux traitements pour le cancer de la prostate très malin pourrait articuler, repoussant une fois de plus les limites de ce que nous savons sur cette maladie et la manière de traiter ses patients.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt financier concurrentes.

Acknowledgments

V.R.-B. est financé par le U.S. Department of Health & Human Services, NIH, National Cancer Institute accordez numéro 1 K22 CA207458-01 et J.D.-D. reçoit un financement du U.S. Department of Health & Human Services, NIH, National Cancer Institute accordez numéro 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics