Эффективным в Vitro транспонирования метод транскрипционно регулируемых Спящая красоты системой упакованы в дефектных лентивирусные вектор интеграции

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Этот протокол описывает метод для достижения стабильной интеграции гена интереса в геноме человека транскрипционно регулируемой системой Спящая красавица . Как сообщается, подготовка интеграции дефектных лентивирусные векторы, трансдукция в пробирке клеток человека и молекулярного анализа на transduced клетки.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Спящая красавица (SB) transposon система-вирусных интеграции с доказанной эффективностью для переноса генов и функциональной геномики. Для оптимизации механизма transposon SB, заняты транскрипционно регулируемых гиперактивный Транспозаза (SB100X) и на основе T2 transposon. Как правило Транспозаза и transposon плазмиды transfection временно предоставляются и SB100X выражение определяется учредительными промоутер. Здесь мы описываем эффективный метод для доставки компонентов SB для клеток человека, которые устойчивы к несколько методов трансфекции физические и химические, контролировать выражение SB100X и стабильно интегрировать ген интереса (ГОИ) через «вырезать и вставить» SB механизма. Выражение гиперактивный Транспозаза жестко контролируется системой тет-ON, широко используется для управления экспрессии генов с 1992 года. Гена интереса в окружении Перевернутый повторяется (IR) T2 transposon. Оба компонента SB упакованы в интеграции дефектных лентивирусные векторы временно производится в HEK293T клетках. Клетки человека, линии клетки или клетки первичной из тканей человека, находятся в vitro временно преобразованы с вирусных векторов. После добавления доксициклин (dox, тетрациклин аналоговый) в питательной среды доработки Транспозаза выражение измеряется и приводит длинный длительный интеграции гена интереса в геноме клеток лечение. Этот метод является эффективным и применимым к клеточной линии (например, клетки HeLa) и главные ячейки (например, человека первичной кератиноцитов) и таким образом представляет собой ценный инструмент для генной инженерии и передача терапевтических генов.

Introduction

Гиперактивный SB100X Транспозаза, в сочетании с transposon на основе T2 уже используется в доклинических гена терапии приложения1,2,3, геном модификации4,5, и индуцированных плюрипотентных стволовых клеток (iPSC) перепрограммирования6,7. Как правило компоненты SB временно предоставляемые плазмида transfection и сильный промоутер учредительный диски выражение Транспозаза. Однако несмотря на улучшение новых методов трансфекции, поставка системы 2 компонентных остается проблемой для многих приложений. Таким образом разработка нового протокола доставки имеет растущий интерес. Помимо методов трансфекции для плазмида8 и мРНК9, вирусный доставки на основе аденовирусных10,11аденоассоциированный вирусный (AAV)12, бакуловирусы13, gammaretroviral14 и в прошлом был предложен лентивирусные векторы15 . В частности системы выбора должны гарантировать переходных доставки компонентов SB без интеграции вирусный вектор. Тем не менее учредительный выражение Транспозаза поднимает проблемы безопасности ввиду опасности неконтролируемого rehopping transposon.

Таким образом регуляцию SB100X системой изысканный тет-ON является первой задачей. Клонированные изменение тет отзывчивым промоутер, полученные путем замены оригинального промоутер развитых минимальной цитомегаловирусом (CMV) с минимальными промоутер (-81) гена Timidine киназы (ТЗ) вирус простого герпеса-1 (ВПГ-1)16, вверх по течению КДНК SB100X (pTetOTKSB100X). Мутировавшие реверс тетрациклин transactivator rtTA2s-17 м2 выражается под контролем сильного учредительный промоутер (phosphoglycerate промоутер, ПГК) клонирован в различных плазмида (НКПС PGKrtTA2S-м2). При добавлении к питательной среды, dox связывает rtTA2s-модулятор м2 и тросов тет промоутер сложных или, полученный в жестко регулируемых индукции SB100X выражение18.

Вторая основная задача возникает от неэффективных transfection клетки человека первичной несколько физических и химических методов. Для эффективной доставки Транспозаза в клетках человека устойчив к трансфекции, SB100X и rtTA2s-м2 выражение кассеты упаковываются в два интеграции дефектных лентивирусные векторы (IDLVs)19: IDLVTKSB и IDLVrtTA2s- М2. Вирусных векторов временно производятся как третьего поколения векторов в HEK293T клетки20 и pseudotyped с гликопротеина G вируса Vescicular стоматит (VSV-G), который предоставляет широкий спектр инфекции. Вектор частицы сосредоточены на ultracentrifugation и титруют immunocapture p24 Gag ВИЧ-1. Передавать линии клетки и клетки первичной, вектор частицы complexed с Полибрен и инкубируют с клеток-мишеней в наличие или отсутствие dox. Снадобь зависимо активации выражения SB100X в transduced клетках измеряется количественного RT-PCR (qRT ПЦР)18.

После того, как продемонстрировал тет регулируется SB100X выражение, транспонирования ГОИ (например, Зеленый флуоресцирующий белок, GFP) в целевой ячейке геном следующим молекулярные события, четко схематизируются бак и Миккельсен21. Третий IDLV вектор, перевозящих что выражение кассету для ГОИ, клонированные между IRs T2-transposon (IDLVT2) должен быть построен и упакованы как упомянуто выше. Наконец три IDLV векторов может использоваться эффективно передают клетки человека (например, первичной кератиноцитов) в пробирке и интегрировать ГОИ присутствии доксициклин18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. плазмид занятых

Примечание: Плазмида НКПС PGKrtTA2S-м2 был любезно предоставляемый профессор Zappavigna (Университет Модены и Реджо-Эмилии, Модена, Италия). PCMVSB100X плазмиды, перевозящих кодирующая последовательность гиперактивный Транспозаза и transposon плазмиды pT2/BH были любезно предоставленных профессор з. Ivics (Институт Пауля Эрлиха, Ланген, Германия) и профессор з. Izvak (центр Макса Дельбрюка молекулярной медицины, Берлин, Германия).

  1. Для всех форм клонирования в Escherichia Coli (E. coli), следуйте клонирования стратегия выбора и энзима ограничения процедуры или амплификации PCR фрагмента клонируемую.
    Примечание: В таблице 1 приведены все плазмид, используемые в настоящем Протоколе. Описание и ссылки для каждой плазмида предоставляются.

2. вирусный вектор производство

Примечание: Все вирусных векторов производятся в биологической капот на BSL2 уровне биобезопасности сдерживания согласно институциональных норм и правил.

  1. Культура сторонником HEK293T клетки в Дульбекко изменение орел среднего дополнена 10% HyClone сыворотки, 100 ед/мл пенициллин стрептомицином и глютамин 2 мм.
  2. День 0: Подготовьте пять 15 см пластины/вирусной подготовки и семян 5.5x106 ячеек в 30 мл среды.
  3. День 1: Transfection
    1. Перед началом трансфекции, подготовьте 100 мл физраствора буфера 2 x HEPES (ОБД):
      NaCl (5 М) 5,6 мл
      HEPES (1 М) 10,0 мл
      Na2HPO4 (0,5 М) 0,3 мл
      Стерильная вода 84,1 мл
      Отрегулируйте к пэ-ашу 7.1 с 37% HCl.
      Примечание: 2 x HBS можно хранить при 4 ° C. Точное рН является чрезвычайно важным для эффективного transfection. Оптимальный рН-7.10 в 7.12.
    2. Удаление средних и добавьте 22,5 мл/тарелка свежих средних 4 ч до transfection.
    3. Transfect HEK293T клетки с передачи плазмида, плазмида pMD.Lg/pRRE.D64VInt упаковка, конверт кодирования плазмида pMD2.G и pRSV-Rev (Таблица 1) согласно следующей суммы/пластину:
      Передача плазмида 25.00 мкг
      pMD.Lg/pRRE.D64VInt 16.25 мкг
      pMD2.G 8,75 мкг
      pRSV-Rev 6,25 мкг
      Примечание: Плазмида ДНК готовятся согласно протоколу CsCl описал Маниатис22 или используя набор очищения плазмиды эндотоксинов бесплатно.
      1. Ресуспензируйте 56,25 мкг ДНК (смесь 4 плазмид) в 1,125 мл стерильной воды и 125 мкл 2,5 М CaCl2 (решение A).
      2. Добавьте 1.250 мл 2 x HBS конические пластиковых пробирок стерильные 15 мл (раствор B).
      3. Добавить решение (1.250 мл) B (1.250 мл) каплям при восходящей с 1 или 2 мл пипетки (трансфекции решения, общий объем 2.500 мл).
      4. Проинкубируйте втечение 20 мин при комнатной температуре (RT).
      5. С помощью P1000 микропипеткой, распространите все решения трансфекции (2.500 мл) в монослое клеток каплям.
    4. Инкубируйте на ночь в инкубатор культуры клеток при 37 ° C, 5% CO2.
  4. День 2: Удалите среды и добавляют 15 мл свежего среды (см. шаг 2.1).
  5. День 3: Сбор и сконцентрировать лентивирусные частиц содержащих супернатант.
    1. Собирать супернатант (~ 70 мл) от всех (n = 5), transfected клеток пластины фильтра через 0.45 мкм PESS фильтра и заполнить 2 polyallomer трубы (1-дюйма x 3,5 дюйма) / вирусный подготовки.
    2. Концентрата вектор частицы ultracentrifugation в 106000 x g для 2,5 ч, при 15 ° C с тормозом.
    3. Сразу же после остановки ultracentrifugation (чтобы избежать ресуспендирования гранул в трубку), осторожно налить супернатант в контейнер, содержащие отбеливатель 10% и приостановить 2 едва видны гранулы в 100 мкл ПБС (+ 1% BSA). Это нормально, как гранулы ясно и очень маленький. Используйте концентрированный вектор свежеприготовленные, или аликвота и хранить вирусных препаратов-80 ° c.
      Предупреждение: Супернатант содержит лентивирусные частицы, которые должны быть тщательно отбеленные прежде чем выбросить в биологически опасных отходов.
  6. Для Титруйте вирусный вектор подготовки, используйте набор immunocapture p24 Gag ВИЧ-1, согласно протоколу производителя.
    Примечание: Чтобы стандартизировать производство вирусный вектор, могут быть использованы на основе липосом реагентов. Тем не менее титр вирусных вектор сильно зависит эффективность трансфекции и чистоты плазмидной ДНК.

3. трансдукции линий клеток человека (например, клетки HeLa)

Примечание: Клетки HeLa культивируемых в среде Дульбекко изменение орла с 10% плода телячьей сыворотки, 100 ед/мл пенициллин стрептомицином и глютамин 2 мм. В таблице 1 перечислены все векторов, используемые в настоящем Протоколе. Представлено описание для каждого вектора. Трансдукция клеток HeLa позволяет проверить регуляцию SB Транспозаза в лучших дозы комбинации двух векторов, IDLV. Вариация IDLV доз могут быть связаны с вектор частицы титрования и целевой тип ячейки.

  1. День 0: Семян 2 x 105 клеток в 3 мл среды для каждой скважины 6-ну плиты. Подготовка 4 скважины.
  2. День 1: Трансдукции НеЬа клетки.
    1. Для каждого условия, разбавить лентивирусные векторы для заключительного тома 1 мл среды (см. примечание выше) в присутствии 10 мкл Полибрен (конечная концентрация 8 мкг/мл):
      Разбавление хорошо # 1: макет transduced клетки (отрицательный контроль).
      Разбавление хорошо # 2: IDLVTKSB вектор (2600 нг p24).
      Разведение для скважин #3, #4: IDLVTKSB вектор (2600 нг p24) + IDLVrtTA2s-вектор м2 (9600 нг p24).
    2. Удалите носитель из каждой скважины, где клетки НеЬа были покрытием в день 0 и добавьте лентивирусные вектор разведений в соответствующий хорошо.
    3. Spinoculate 6-ну пластины в 754 x g за 45 минут на 20-25 ° C, а затем передачи пластину 6-ну инкубатор культуры клеток при 37 ° C и 5% CO2.
    4. После 6 часов замените свежей среды на всех скважинах средних содержащие векторов и добавьте доксициклин 1 мкм в хорошо #4. Положите пластину в инкубатор культуры клеток при 37 ° C за 48 ч.
  3. День 3: Подготовка клетки Пелле извлечение RNA.
    1. Перед отсоединением клетки, приготовьте рабочий раствор трипсина (1 x):
      2,5% трипсина (10 x) 5,0 мл
      500 мм ЭДТА (конечная концентрация = 5 мм) 0.5 мл
      1 x 44,5 PBS мл
    2. Теплый трипсина рабочего раствора при 37 ° C перед использованием. Сохранить рабочий раствор трипсина на 4 ° C.
    3. Удаление средних и вымыть клетки с ПБС. Добавить 0,5 мл подогретым 37 ° C трипсина рабочего раствора в каждой скважине и инкубировать при 37 ° C 7 мин (в инкубатор культуры клеток).
    4. После инкубации, добавить 0,5 мл сыворотки содержащих среднего для каждой скважины для инактивации трипсина и собирать клетки в пластиковых пробирок. Промыть хорошо один раз с 3 мл ПБС и центрифуги суспензию клеток для 5 мин на 240 x g.
    5. Вымыть клетки с 5 мл 1 x PBS, центрифуги для 5 мин на 240 x g и удалить супернатант. Используйте свеже собранных клеток гранулы или хранить при температуре-80 ° C. Извлечение всего РНК из окатышей для выполнения полуколичественного RT-PCR (см. шаг 6).

4. трансдукции начальных клеток человека (например, кератиноциты)

Примечание: Человека первичной кератиноцитов посеяна на смертельно облученного 3T3-J2 клетки (фидер слой)23, рода подарок от Янь Barrandon (EPFL, Лозанна, Швейцария).

  1. Рост клеток 3T3-J2 Швейцарский мыши в Дульбекко изменение орел среде с 10% доноров бычьим сывороточным, 50 ед/мл пенициллин стрептомицином и глютамин 4 мм (средний 3T3).
  2. Расти кератиноциты, покрытие на смертельно облученного 3T3-J2 клетки в cFAD средний, Дульбекко изменение Eagle среднего и ветчиной F12 СМИ смесь (3:1) содержащий плода бычьим сывороточным (10%), пенициллин стрептомицином (1%), глютамин (2%), инсулин (5 мкг/мл), аденин ( 0,18 мм), гидрокортизон (0,4 мкг/мл), токсинного холеры (0.1 Нм) и трийодтиронин (2 Нм).
  3. День 0: Семя 3 x 105 смертельно облученных клеток 3T3-J2, предварительно разводят в 3T3 среднего до конечной концентрации 1 Х 105 клеток/мл в каждую лунку 6-ну пластины. Подготовьте 9 скважин.
  4. День 1: Трансдукции первичного кератиноцитов
    Примечание: Трансдукции кератиноцитов позволяет количественная оценка регуляцию SB Транспозаза в лучшие комбинации двух векторов IDLV (qRT-PCR) и проверки интеграции ГОИ (ГПУП) в клетки-мишени (по cytofluorimetric анализ).
    1. Перед отсоединением клетки, приготовьте рабочий раствор трипсина:
      0,5% трипсина ЭДТА (10 x) 5,0 мл
      500 мм ЭДТА (конечная концентрация = 5 мм) 0.5 мл
      1 x 44,5 PBS мл
    2. Теплый трипсина рабочего раствора при 37 ° C перед использованием. Сохранить рабочий раствор трипсина на 4 ° C.
    3. Чтобы отсоединить subconfluent кератиноцитов в культуре, удалите среднего, вымыть клетки с ПБС и добавить 1 мл раствора рабочего подогретым трипсина в каждой скважине. Инкубируйте при 37 ° C 15 мин в инкубатор культуры клеток.
    4. После инкубации клеток хорошо Ресуспензируйте тщательно и передать пластиковых пробирок, содержащий 2 мл сыворотки, содержащего суспензию клеток среднего (если многие клетки по-прежнему прилагаются, Проинкубируйте дополнительных минут при 37 ° C). Промыть хорошо один раз с 3 мл 1 x PBS или свежие среднего и добавить полоскания решение для пластиковых пробирок с суспензию клеток.
    5. Центрифуга для 5 мин на 580 x g и удалить супернатант.
    6. Вымыть клетки с 5 мл 1 x PBS, центрифуги для 5 мин на 580 x g и удалить супернатант.
    7. В 15 мл полипропиленовые трубы разбавляют кератиноцитов5 1.6x10 в 1 мл cFAD среды, одного разрежения для каждого условия.
    8. Разбавьте лентивирусные векторы в 1 мл cFAD среды в присутствии 20 мкл Полибрен (конечная концентрация 8 мкг/мл на окончательный объем 2 мл):
      Разведениях для скважин #1, #2, #3: макет transduced клетки (отрицательный контроль без векторов).
      Разведениях для скважин #4, #5: IDLVTKSB вектор (13000 нг p24) + IDLVrtTA2s-вектор м2 (48000 нг p24).
      Разведениях для скважин #6, #7, #8, #9: IDLVTKSB вектор (13000 нг p24) + IDLVrtTA2s-вектор м2 (48000 нг p24) + IDLVT2 вектор (9,160 нг p24).
    9. Передают клеток в суспензии путем добавления каждого разведения лентивирусные вектор (1 мл) для соответствующего кератиноцитов подвеска (1.6x105 кератиноцитов в 1 мл).
    10. Удалите носитель из смертельно облученного 3T3-J2 клетки осеменены на день 0 и пластины преобразованы кератиноциты (1.6x105 кератиноцитов в 2 мл) на них. После преобразования и приступить к следующему.
    11. Инкубируйте на 25 ° C в течение 30 минут, а затем перенесите клетки до 37 ° C в инкубатор культуры клеток на 6 ч.
      Примечание: Сделать не spinoculate первичной кератиноцитов, как жизнеспособность и распространения будут сильно затронуты.
    12. После 6 часов добавьте 1 mL cFAD среды в каждой скважине. Добавьте 1 мкм доксициклин (конечная концентрация) в скважинах, #5, #8 и #9. Возвращение клетки до 37 ° C.
  5. День 2: Замените 3 мл KC среды с 10 нг/мл EGF среднего cFAD.
  6. День 3: Trypsinize и вымыть клетки из скважин #1, #4 и #5 как описано раньше (см. 4.4.1 в 4.4.6). Заблокировать ячейки окатышей на-80 ° C для извлечения всего РНК для qRT ПЦР-анализа (см. шаг 7).
  7. Trypsinize клетки от хорошо #2, #6 и #8, как описано в шагах 4.4.1 до 4.4.5 и выполнять cytofluorimetric анализ для экспрессия гена GFP (см. шаг 5).
  8. Держите культуры от скважин #3, #7 и #9 на по крайней мере 3-4 удвоений, достаточных для разбавления ООН комплексной IDLVT2 вектор (5 дней для человека первичной кератиноцитов, покрытие на фидер слой).
  9. День 6: Примерно 5 дней пост трансдукции, trypsinize клетки (см. шаги 4.4.1 до 4.4.5) из скважин, #3, #7 и #9 для выполнения анализа cytofluorimetric экспрессия гена GFP (см. шаг 5).
    Примечание: Эксперимент сроков и электромеханической эффективности являются весьма под влиянием главной ячейки типа и изменчивость собранных образцов.

5. Cytofluorimetric анализ на transduced первичной кератиноцитов

Примечание: Проточный цитометр, настроен с голубой лазер (488 нм), красный лазер (633 нм) и фильтров для обнаружения GFP и APC флуоресценции занятых (см. Таблицу материалов).

  1. Различать кератиноцитов от 3T3-J2 фидер слоя, лейбл преобразованы кератиноцитов отдельностоящий в день 3 и 6 (см. шаги 4,7 и 4,9) день с мыши моноклональные APC-конъюгированных антител анти фидера.
    1. Подготовка 4 мл окрашивания буфер для каждого образца:
      5% FBS 200 МКЛ
      500 мм ЭДТА (конечная концентрация = 2,5 мм) 20 мкл
      PBS 1 x 3780 мкл
    2. Стирайте отдельные клетки с 1 мл окрашивания буфера. Центрифуга для 5 мин на 580 x g и удалить супернатант.
    3. В трубке для приобретения цитометрии потока Ресуспензируйте 5 х 104 клетки в 100 мкл окрашивание буфера и добавить 2 мкл антител против подачи (1:50). Хорошо перемешайте и Инкубируйте 30 мин на льду в темноте.
    4. После 30 мин мыть с 2 мл окрашивания буфера. Центрифуга для 5 мин на 580 x g и удалить супернатант. Ресуспензируйте в 200 мкл окрашивания буфера.
    5. Приобрести APC и GFP сигналов, cytofluorimetric анализ18. Часть клетки GFP+ популяции клеток БТРуказывает transduced кератиноцитов.
      Примечание: При необходимости, исправить цветного образца до проточной цитометрии с 2% параформальдегида в PBS 1 x и хранить при 4 ° C в темноте до запуска.
  2. Анализ потока данных цитометрии путем построения соотношение между процент GFP+клеток на конечную точку (5 дней) и процент GFP+клетки 2 дней после трансдукции, нормализуется до остаточного уровня IDLVT2-преобразованы клетки.

6. полуколичественного RT-PCR

Примечание: Используйте ПЦР тепловая велосипедист.

  1. Извлечение RNA от преобразованы или управления ячейки, используя комплект для очистки РНК, по словам производителя протокол.
    Примечание: Общая РНК может храниться при температуре-80 ° C.
  2. Синтез cDNA в 20 мкл реакции с использованием 100 нг всего РНК и обратная транскриптаза комплекта, по словам производителя протокол.
    Примечание: cDNA может храниться при температуре-20 ° C.
  3. Дизайн праймеров для SB100X, rtTA2s-м2 и GAPDH (уборка гена).
    Предлагаемые проекты:
    SB вперед грунтовка: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB обратный грунтовка: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 вперед грунтовка: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 обратный грунтовка: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH вперед грунтовка: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH обратный грунтовка: 5'CCACCACCCTGTTGCTGTAG3'
  4. Выполните ПЦР в окончательной реакции объем 50 мкл. В частности Соберите в каждую ПЦР-пробирку следующие реакции:
    cDNA (разбавления 1:5) (из шага 6.2) 1.00 мкл
    Вперед грунтовка (10 мкм сток) 1.00 мкл
    Обратный грунтовка (10 мкм сток) 1.00 мкл
    дНТФ (10 мкм сток) 1.00 мкл
    Буфер (+ MgCl2) (10 x сток) 5.00 мкл
    Taq-полимеразы (5 U/мкл бульон) 0.25 мкл
    Стерильную воду 40,75 мкл
  5. Используйте следующую программу тепловая велосипедист: 1 цикл при 95 ° C за 5 мин затем продолжить с 95 ° C за 30 s, 58 ° C за 30 s и 72 ° C для 30 s для 34 циклов для SB100X, 32 циклов для rtTA2s-M2 и 25 циклов для GAPDH.
  6. Подготовьте гель агарозы 1%. Растворите 1 g агарозы в 100 мл КЭ 1 x (10 x фондовой разводят в стерильной воде), в стакан или настой. Растопите в микроволновке, закрученной каждую минуту до тех пор, пока полностью не растворится агарозы. Охладить расплавленный агарозы до тех пор, пока он достигает приблизительно 50 ° C, а затем добавьте 5 мкл бромид ethidium (10 мг/мл бульона). Налейте растопленное агарозы в собранном каппу с гребнем, для литья гель.
  7. Загрузить образцы (по 10 мкл) на геле агарозы и провести электрофорез.
  8. При желании приобрести картину гель и денситометрических анализ на ПЦР диапазонах.

7. количественного RT-PCR (qRT-PCR)

Примечание: Коммерческая система обнаружения последовательности используется. Праймеры PCR и 6-Карбоксифлуоресцеина (FAM) зонд для Глицеральдегид-3-фосфат дегидрогеназа (GAPDH) приобретаются коммерчески.

  1. Ретро транскрипция шаг 6.2 см.
  2. Используйте программное обеспечение для разработки грунты и зонд конкретных для SB100X.
    Предлагаемая конструкция:
    SB.2 вперед грунтовка: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 обратный грунтовка: 5'-CCCCATGTGCAGTTGCAA-3'
    зонд SB FAM: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Выполните Real-Time PCR в 96-луночных пластины с ПЦР Мастер микс и грунтовки + зонд смесь, в окончательном реакции объем 25 мкл. В частности рассмотрим следующие реакции для каждой скважины:
    cDNA (1:10 разрежения в стерильной воде) 1.00 мкл
    2 x Мастер микс 12,50 мкл
    Праймеры + 20 x зонд смешать 1,25 мкл
    Стерильную воду 10.25 мкл
    Примечание: Выполните все реакции в трех экземплярах. Чтобы избежать ошибок, дозирования, готовят смесь для по крайней мере n + 3 реакций (без cDNA). Алиготе, используя многоканальные пипетки.
  4. Запуск ПЦР в реальном времени, используя следующую программу: 1 цикл на 95 ° C в течение 10 мин, затем 40 циклов 95 ° c 15 s и 60 ° C за 1 мин и удерживайте при 4 ° C.
  5. Анализ данных qRT-PCR, нормализующее относительное выражение (значение RQ) SB100X до уровня GAPDH того же образца cDNA, 2ΔΔCT количественной, используя программное обеспечение для анализа типичных данных.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

С помощью процедуры представлены здесь, три IDLV векторы нося SB компоненты (SB100X, rtTA2S-transposon м2 и T2-GFP) были упакованы и используется для эффективной доставки и плотно регулировать систему SB в клетках человека. На рисунке 1A показана схема для в vitro трансдукции клеток HeLa, который был проведен для оценки регуляцию SB Транспозаза с лучшими дозы комбинации двух векторов IDLV (сообщается в таблице 2). Регуляцию SB100X измеряется qRT ПЦР (рис. 1B) и как значение относительной величины (RQ) в рамках государства (IDLVTKSB только RQ = 1). В transduced клетки HeLa был получен пищеводный активации (+ dox) SB100X выражения на фоне (IDLVTKSB). Примечательно, cotransduced клетки HeLa в отсутствие dox показал Транспозаза выражение сопоставимых выкл государствам, указывающих жесткий контроль над TetTK промоутер rtTA2s-модулятор м2.

Figure 1
Рисунок 1: Трансдукции НеЬа клетки для выражения транскрипционно регулируется SB Транспозаза перевозимых векторов IDLV. (A) схема в vitro трансдукции НеЬа клетки с IDLVs для выражения Транспозаза. (B) qRT ПЦР-анализа клеток HeLa преобразованы с IDLVTKSB (2600 нг p24) в присутствии (+) или (-) отсутствие IDLVrtTA2S-м2 (9600 нг p24) и 1 мкм доксициклин (dox). Пунктирная линия соединяет образцы, демонстрирующие существенно разные значения (*** P < 0,005). Эксперимент проводился в трех экземплярах. Значит, S.E.M отображается как ошибка бары. (Рис. изменение от Cocchiarella, F. et al., 2016-18). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Например на рисунке 2 показан начиная эксперимент, чтобы достичь оптимального регуляцию Транспозаза дозы. НеЬа клетки были преобразованы с увеличением дозы (130, 260 и 2600 нг p24) из IDLVTKSB в сочетании с IDLVrtTA2s-м2 (960 и 9600 нг p24), в присутствии или отсутствии dox. Полуколичественного ПЦР-анализ ясно показывает, что высокие дозы обеих IDLVs были обязаны решительно побуждать SB100X выражение. Тип ячейки различные целевые и вариации в вирусный вектор титрование может привести к sup оптимальное выражение SB, и поэтому рекомендуется выполнять дозировка параметр экспериментов.

Figure 2
Рисунок 2: IDLV дозы установления эксперимент в клетки HeLa определить оптимальную дозу сочетание двух IDLVs. Полуколичественного анализа ПЦР-на клетки HeLa, совместно преобразованы с разными дозами IDLVTKSB вектора (130, 260 и 2600 нг p24) в отсутствие или наличие IDLVrtTA2s-вектор м2 (960 и 9600 нг p24) и dox. GAPDH был усилен как стандартный элемент управления. SB100X Транспозаза и rtTA2s-выражение м2 сообщается во всех протестированных условиях; NC = отрицательный контроль. (Рис. изменение от Cocchiarella, F. et al., 2016-18). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Транскрипционный анализ регулируемых SB система может также использоваться в начальной клеток, особенно в те клетки устойчивы к несколько методов трансфекции, такие человеческие кератиноциты первичной. Рисунок 3 показывает, что схема для трансдукции первичных кератиноцитов, культивируемых на смертельно облученного 3T3-J2 фидер слой, с IDLV векторы нося регулируемых компонентов SB, в наличие или отсутствие dox побудить SB100X выражение.

Figure 3
Рисунок 3: трансдукции в суспензии человеческого первичной кератиноцитов с IDLV векторные выражения транскрипционно регулируется SB Транспозаза и transposon. Схема в vitro трансдукции человека первичной кератиноцитов с IDLVs выразить транскрипционно регулируется SB Транспозаза и transposon, в присутствии или отсутствии dox 1 мкм. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

QRT ПЦР-анализа в Рисунок 4A показывает что лучший доза сочетание Транспозаза и модулятор векторов, сообщается в таблице 2, привело к 15 раз активации SB выражения над государство (-dox). Транспозиция эксперимента была исполнена в кератиноцитов, преобразованы с трех векторов IDLV (IDLVTKSB, IDLVrtTA2s-м2 и IDLVT2) в присутствии или отсутствии dox. Выражение из ГОИ (ГПУП) понесенные, T2-transposon, в отсеке APC , была измерена потока цитометр анализ 2 дней после трансдукции (КДС) и на endopoint культуры (5 дней для человека первичной кератиноцитов). Конечная точка была достигнута, когда неинтегрированные T2-GFP transposon упала до едва обнаружению уровень (в среднем на 0,6%) за счет деления клеток-зависимых от разрежения. Рисунок 4B показывает соотношение между процент GFP+ , что клетки в APC отделение конечной точкой и 2 дня после трансдукции, нормализуется уровень остаточного transposon только. Это указывает процент клеток, хостинг по крайней мере 1 копию выраженной ГОИ стабильно интегрированы в их геном, начисленных на 12% для человека первичной кератиноцитов.

Figure 4
Рисунок 4: анализ выражения Транспозаза и гена GFP в transduced человека первичной кератиноцитов. (A) qRT ПЦР анализа на первичной кератиноцитов, преобразованы с IDLVTKSB и IDLVrtTA2S-м2 в присутствии или отсутствии dox 1 мкм. (B) совместно трансдукции первичных кератиноцитов для выражения Транспозаза в присутствии или отсутствии dox с IDLVT2 transposon и IDLVs. На оси y % GFP+ клетки 5dpt / % GFP+ клетки 2 АКДС * 100 (средний ± SEM двух экспериментов). ** Отображает существенно разные значения (P < 0,05). (Рис. изменение от Cocchiarella, F. et al., 2016-18). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Плазмиды Описание Ссылки
НКПС TetOTKSB Передачи используется для создания IDLVTKSB вектор плазмиды. Эта плазмида, производный от pTetOTKSB, после клонирования TetOTKSB в НКПС лентивирусные позвоночника. 18, 20
НКПС PGKrtTA2S-м2 Передачи плазмида, используется для создания IDLVrtTA2s-вектор м2. предоставляемые профессор V. Zappavigna
НКПС T2GFP Передачи используется для создания IDLVT2 вектор плазмиды. Эта плазмида, производный от pT2GFP, после клонирования GFP между T2-transposon IRs в НКПС лентивирусные позвоночника. 18, 20
pMD.Lg/pRRE.D64VInt Упаковка плазмиду для создания векторных IDLV. 19
pMD2.G Плазмиды кодирования для VSV-G конверт для создания лентивирусные вектор. 20
pRSV-Rev Rev плазмиду для создания лентивирусные вектор. 20
Вектор Описание
IDLVTKSB Интеграции дефектных лентивирусные вектор для выражения SB100X под контролем промотора тет отзывчивым ТЗ.
IDLVrtTA2s-M2 Дефектные лентивирусные вектор интеграции для выражения rtTA2s-модулятор м2 под контролем промотора ПГК.
IDLVT2 Дефектные лентивирусные вектор интеграции для выражения Пи клонированные между T2-transposon IRs.

Таблица 1: плазмиды и векторов, занятых в этом протоколе. Приводятся описания и ссылки.

Векторы Рыбка хела (2 x 105 клетки) Кератиноциты (1.6x105 клетки)
IDLVTKSB 2600 нг p24 13 000 нг p24
IDLVrtTA2s-M2 9,600 нг p24 48000 нг p24
IDLVT2 9,160 нг p24

Таблица 2: Оптимизированный вектор дозы для трансдукции НеЬа клетки и человека первичной кератиноцитов.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Здесь мы описываем широко доступной методологии стабильно интегрировать ГОЙ в геном клетки-мишени, Спящая красавица-опосредованной транспонирования. Хотя для обеспечения синцитиального метод для изменения генома была разработана система SB, эффективности механизма интеграции (Транспозаза и T2 transposon) является обязательным. Таким образом для использования системы SB на вряд ли transfectable Главные ячейки, вирусный доставки компонентов SB проводилась в последние годы10,12,15. Однако ни один из вирусных векторов, занятых до теперь этот вопрос учредительных выражения Транспозаза, который может привести к опасности неконтролируемого rehopping transposon.

Транскрипционно регулировать Транспозаза выражение, мы воспользовались изменение системы тет-ON16. Минимальный промоутер ТЗ сплавили Тето элемент привязки к rtTA2s-модулятор м2 присутствии dox, предоставленных доработки Транспозаза активации на фоне (off государство, в отсутствие dox). Регулирования производительности зависит от соответствующей IDLVs (IDLVTKSB и IDLVrtTA2s-м2) вектор дозы комбинации и типов клеток (например, клетки HeLa и человеческие кератиноциты первичного). Независимо от клеток-мишеней вектор дозы должны обеспечить наивысший уровень трансдукции клеток-мишеней не затрагивая жизнеспособность клеток, таким образом эскалации дозы сочетание эксперимент в НеЬа клетки (или других клеточных линий) для определения оптимальных доз, в полуколичественного RT-PCR, настоятельно рекомендуется.

Транспозиция ГОИ оценивалась в Главные ячейки. Человека первичной кератиноцитов, семенами на слое фидер смертельно облученного 3T3-J2 были преобразованы с 3 IDLVs (IDLVTKSB, IDLVrtTA2s-м2 и IDLVT2) в экспериментально определенных дозах. Четкой dox зависимой активации Транспозаза была продемонстрирована qRT ПЦР. Кроме того стабильной интеграции ГОИ была продемонстрирована cytofluorimetric анализ экспрессии гена GFP в клетках, преобразованы в наличие или отсутствие dox, указывающий на возможность использовать IDLV платформы автомобиля транскрипционно регулируемых SB компоненты для первичной клетки и успешной интеграции ГОЙ в геном клетки-мишени.

Важнейшие шаги в протоколе являются IDLV вектор производство и трансдукция клеток-мишеней на оптимальную эффективность и комбинации вектора. Низкая трансфекции эффективность HEK293T клеток может привести к низкой вектор урожайности. Определение дозы IDLVTKSB и IDLVrtTA2s-необходимо, чтобы избежать дисбаланса тет-на компоненты, которые могут привести к высокой утечки в отсутствие модулятора или низкий раз индукции TetOTK промоутер после лечения dox м2. Эти важнейшие шаги могут решаться путем незначительных изменений. Например протокол transfection можно было бы стандартизировать использование коммерческих трансфекции реагентов. Трансдукция протокол должны быть адаптированы согласно ячейки тип интереса, особенно учитывая ли spinoculation увеличивает эффективность трансдукции не затрагивая жизнеспособность клеток. Векторы и Полибрен могут добавлены в среде культуры клеток-мишеней и заменить свежие среднего после 6 часов или на ночь инкубации. Также стоит отметить, что процент GFP+ клетки 5 дней после того, как трансдукции могут быть затронуты интеграции фон IDLVs.

Незначительные ограничения данного метода является, что векторы IDLV временно производятся transfection HEK293T клеток. В зависимости от вектора доз использоваться, повторил векторного произведения требуются. Второе ограничение связано с длиной ГОИ, как грузоподъемность IDLV вектора примерно 8 КБ.

В заключение этот метод позволяет интеграцию ГОИ через транскрипционно регулируемых компонентов SB, упакованы в IDLV векторов, которые, среди существующих методов доставки SB системы, показать широкий спектр тропизма и трансдукция высокой эффективности. Кроме того измененная система тет-ON позволяет регуляцию экспрессии SB100X, актуальным вопросом в риска transposon повторно островам или в нескольких событиях последовательного переноса, если они требуются. Возможности применения этого метода включают генома инженерных клеточных линий (например, клетки HeLa, HEK293 клетки) для установления стабильных упаковка клетки для вирусных векторов и интеграции терапевтических генов в клинических соответствующие главные ячейки.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарим Zappavigna профессор, Университет Модены и Реджо-Эмилии, Модена, Италия для предоставления нам НКПС PGKrtTA2S-плазмида м2. Мы также признаем профессор з. Ivics (Институт Пауля Ehlrich, Ланген, Германия) и профессор з. Izvak (центр Макса Дельбрюка молекулярной медицины, Берлин, Германия) для pCMVSB100X и pT2/BH плазмид. Эта работа была поддержана Дебра международного и итальянского министерства университетов и исследований.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics