Поколение 3D кожи органоид из пуповинной крови производные индуцированных плюрипотентных стволовых клеток

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Мы предлагаем протокол, который показывает, как для дифференциации кератиноцитов индуцированных плюрипотентных стволовых клеток и фибробластов и создания 3D кожи органоид, используя эти кератиноцитов и фибробластов. Этот протокол содержит дополнительный шаг генерации модели гуманизированные мышей. Техника, представленная здесь будет улучшить дерматологические исследования.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Кожа является крупнейшим органом органа и имеет множество функций. Кожа действует как физический барьер и защитник тела и регулирует функции организма. Биомиметики это имитация моделей, систем и элементов природы с целью решения сложных проблем человека1. Биомиметики кожи является полезным инструментом для исследований в пробирке болезней и в естественных условиях восстановительной медицины. Человеческое индуцированных плюрипотентных стволовых клеток (iPSCs) имеют характеристику неограниченного распространения и способность дифференциации три зародышевых. Человеческого iPSCs генерируются из различных начальных клеток, таких как клетки крови, кератиноциты, фибробласты и многое другое. Среди них мононуклеарных клеток пуповинной крови (CBMCs) появились как источник альтернативной ячейки с точки зрения аллогенной регенеративной медицины. CBMCs являются полезными в регенеративной медицине, потому что человеческий лейкоцитарный антиген (HLA) ввод имеет важное значение для ячейки, банковской системы. Мы предоставляем метод дифференциации СВМС iPSCs в кератиноцитов и фибробластов и для поколения органоид 3D кожи. СВМС iPSC производные кератиноцитов и фибробласты имеют характеристики похож на главной ячейки строки. Organoids 3D кожи генерируются путем наложения эпидермального слоя на слой дермы. По пересадке этой 3D кожи органоид, формируется модель гуманизированные мышей. Это исследование показывает, что органоид 3D человеческого iPSC производные кожи может быть роман, альтернативные инструментом дерматологических исследований в vitro и in vivo.

Introduction

Кожа покрывает внешней поверхности тела и защищает внутренние органы. Кожа имеет различные функции, в том числе защиты от патогенов, поглощая и хранения воды, регулирование температуры тела и выделяют тела отходов2. Пересадке кожи могут быть классифицированы в зависимости от источника кожи; графтов, использование кожи от другого донора называются аллотрансплантантов, и трансплантатов, используя кожи пациента являются аутотрансплантантов. Хотя аутотрансплантатом является предпочтительным лечения из-за его низкой неприятие риска, биопсия кожи, трудно выполнить на пациентов с серьезными повреждениями или недостаточное количество клеток кожи. У больных с ожогами в три раза количество клеток кожи необходимы для покрытия больших территорий. В ситуациях, когда необходима трансплантация аллогенных приводит ограниченное количество клеток кожи от тела пациента. Аллотрансплантата используется временно, до аутологичной трансплантации может быть выполнена, поскольку обычно оно отклоняется иммунной системой хозяина, после примерно 1 неделю3. Чтобы преодолеть неприятие иммунной системой пациента, графтов должна исходить от источника с тем же идентификатором иммунитета пациента4.

Человеческого iPSCs являются источником новых клеток для клеточной терапии5. Человеческого iPSCs генерируются из соматических клеток, используя перепрограммирования факторов, таких как OCT4, SOX2, Klf4 и c-Myc6. С помощью человеческого iPSCs преодолевает этические и иммунологические аспекты эмбриональных стволовых клеток (ЭСК)7,8. Человеческого iPSCs имеют плюрипотентности и могут дифференцироваться в три зародышевых9. Наличие HLA, решающим фактором в регенеративной медицине, определяет иммунный ответ и возможность отказа10. Использование пациента производные iPSCs решает проблемы отказа ограничения и иммунной системы клетки источник. CBMCs также стали источником альтернативной ячейки для регенеративной медицины11. Обязательное HLA набрав, которая происходит во время СВМС банковской, легко может использоваться для исследования и трансплантации. Кроме того, гомозиготных HLA-типа iPSCs может широко применяют для различных пациентов12. СВМС iPSC банк — Роман и эффективную стратегию для клеточной терапии и аллогенных регенеративной медицины12,,1314. В этом исследовании мы используем СВМС iPSCs, дифференцированные в кератиноцитов и фибробластов и генерировать слои стратифицированной 3D кожи. Результаты этого исследования свидетельствуют о СВМС iPSC производные 3D кожи органоид Роман инструмент для в vitro и in vivo дерматологические исследования.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры с участием животных были выполнены в соответствии с Закон о социальном обеспечении лабораторных животных, руководство по уходу и использованию лабораторных животных, и руководящие принципы и политику для грызунов экспериментов институциональный уход животных и Используйте Комитет (IACUC) школы медицины в Католическом университете Кореи. Протокол исследования был одобрен Советом по рассмотрению институциональных католический университет Кореи (CUMC-2018-0191-01). IACUC и Отдел лабораторных животных (ДЬОЛА) в католический университет Кореи, Songeui Кампус аккредитованных Кореи Excellence животных Лаборатория Кореи продовольствия и медикаментов в 2017 и приобретенных ассоциации оценки и Аккредитация международных полную аккредитацию лабораторных животных международного (AAALAC) в 2018 году.

1. кожа дифференцировки клеток от индуцированных плюрипотентных стволовых клеток

  1. Средний подготовка
    Примечание: Сохранить все среды при температуре 4 ° C в темноте на срок до 3 месяцев. Фильтр все среды, используя систему фильтров Полиэфирсульфон 0,22 мкм перед использованием для стерилизации. Все среды была доступна в общем объеме 500 мл.
    1. Подготовка KDM1 (кератиноцитов дифференциация средний 1). Mix Дульбекко изменения орла среднего (DMEM) / F12 среднего (3:1) с 2% плода бычьим сывороточным (ФБС), 0.3 L-Аскорбиновая кислота ммоль/Л, 5 мкг/мл инсулина и 24 мкг/мл аденин.
    2. Подготовка KDM2 (кератиноцитов дифференциации среднего 2). Mix определены кератиноцитов сыворотки бесплатно средний (см. Таблицу материалы) с 0.3 L-Аскорбиновая кислота ммоль/л, 5 мкг/мл инсулина и аденин 10 мкг/мл.
      Примечание: Определенные кератиноцитов сыворотки свободный среднего оптимизирован для поддержки роста и расширения кератиноцитов.
    3. Подготовка KDM3 (кератиноцитов дифференциация средний 3). Mix определены кератиноцитов сыворотки бесплатно среднего и кератиноцитов сыворотки бесплатно среднего (1:1) Таблица материалов для деталей.
      Примечание: Кератиноцитов сыворотки свободный среднего оптимизирована для роста и поддержания кератиноцитов.
    4. Подготовка FDM1 (фибробластов дифференциация средний 1). Mix DMEM/F12 среднего (3:1) с 5% FBS, 5 мкг/мл инсулин, аденин 0,18 мм и 10 нг/мл эпидермального фактора роста (EGF).
    5. Подготовить FDM2 (фибробластов дифференциации среднего 2). Mix DMEM/F12 среднего (1:1) с 5% FBS и 1% заменимых аминокислот.
    6. Подготовить EP1 (эпителиальные средний 1). Mix DMEM/F12 (3:1) с 4 мм L-глютамином, 40 мкм аденин, 10 мкг/мл трансферрин, 10 мкг/мл инсулина и 0,1% FBS.
    7. Подготовить EP2 (эпителиальные средний 2). Mix EP1 и хлористый кальций 1,8 мм.
    8. Подготовить EP3 (эпителиальные средний 3, средний ороговения). Mix F12 средний с 4 мм L-глютамином, 40 мкм аденин, трансферрин 10 мкг/мл, 10 мкг/мл инсулин, 2% FBS и хлористый кальций 1,8 мм.
  2. Поколение эмбриональных тела
    1. Генерировать СВМС iPSCs с использованием протокола, показано в предыдущем исследовании12.
    2. Герб культуры блюда, используя vitronectin. Подготовьте 5 мл, чтобы покрыть 100 мм блюдо.
      1. Размораживание и Ресуспензируйте 50 мкл 0.5 мг/мл vitronectin (конечная концентрация: 5 мкг/мл) с 5 мл стерильной фосфат амортизированное saline (PBS). Добавить решение в посуду и инкубации при комнатной температуре (RT) за 1 ч. аспирационная материала покрытия перед использованием (не высохнуть).
    3. Поддерживать СВМС производные iPSCs с покрытием vitronectin 100 мм пластины и изменить iPSC среднего (E8) ежедневно при 37 ° C с 10% CO2.
    4. Генерировать эмбриональных органов (EBs), используя протокол, показано в предыдущем исследовании15 (кратко описывается следующим). Разверните iPSCs, изменив носитель до тех пор, пока клетки достигли 80% слияния. При впадении в 80% удалите среды и мыть с PBS.
    5. Лечить клетки с 1 мл раствора 1 мм Этилендиаминтетрауксусная кислота (ЭДТА). Инкубировать при 37 ° C с 5% CO2 на 2 мин и урожай ячейки, используя 3 мл среды E8. Центрифуга клетки на 250 x g на 2 мин.
    6. Аспирационная супернатант и применить 5 мл E8 среды к ячейкам. Подсчитать ячейки, используя Горяева и передачи 1 x 106 клеток к новой 15 мл Конические трубки. Центрифуга клетки на 250 x g на 2 мин.
    7. Ресуспензируйте передаваемых клетки с 2,5 мл EB формирования среды с 10 ингибитора киназы Ро связанные (рок) мкм. Падение 1 х 104 клетки (25 мкл/drop) на крышке плита noncoated культуры, с помощью 10-100 мкл многоканальные пипетки. EBs в форме 100 от 1 x 106 клеток (1 х 104 клетки/1 EB). Перевернуть блюдо и повесить на капли на крышке.
      Примечание: Рок ингибитор необходимо на этапе вложение в процессе обслуживания и дифференциации. Добавление ингибитора рок только на этапе агрегирования EB.
    8. Инкубируйте капель при 37 ° C с 5% CO2 на 1 день.
    9. Следующий день, урожай 100 EBs и использовать их для дифференциации. Промойте крышку плиты с iPSC средний (E8 средний) или PBS и урожай его содержимое в 50 мл Конические трубки. Поддерживать EBs на RT 1 мин для их урегулирования. Аспирационная супернатанта, Ресуспензируйте EBs с E8 среднего и поддерживать их в чашке Петри 90 мм до дифференциации.
  3. Дифференцировка СВМС iPSCs на кератиноциты
    Примечание: Для схемы дифференциации кератиноцитов от СВМС iPSCs, см. рис. 1A.
    1. Урожай 100 EBs 50 мл Конические трубки с iPSC среднего или PBS. Сохранить на RT 1 мин, чтобы успокоиться EBs. Убедитесь, что они оседают на дне Конические трубки. Аспирационная супернатант и Ресуспензируйте EBs с E8 средний с 1 нг/мл костный морфогенетический белок 4 (BMP4). Передача EBs до 90 мм Петри и поддерживать их при 37 ° C с 5% CO2 на 1 день.
    2. Герб культуры блюда, используя тип IV коллагена. Подготовьте 5 мл тип IV коллагена для покрытия блюдо 100 мм.
      1. Размораживание и Ресуспензируйте типа IV коллагена раствор (конечная концентрация: 50 мкг/мл) с 0,05 N HCl. Добавить решение в посуду и Инкубируйте на RT 1 ч. аспирационная материала покрытия перед использованием (не высохнуть).
        Примечание: Перед использованием плиты, мыть посуду 3 x с PBS для удаления любых кислоты.
    3. Урожай EBs (шаг 1.3.1) 50 мл Конические трубки и поддерживать их на RT 1 мин для их урегулирования. Убедитесь, что они оседают на дне Конические трубки, аспирационная супернатант и Ресуспензируйте EBs в 6 мл KDM1 с 10 мкм рок ингибитора. EBs передать тип IV коллаген покрытием 100 мм блюдо.
      Примечание: Добавление рок ингибитор только на стадии вложение EB.
    4. Между 0-8 дней измените среднего каждый другой день, чтобы KDM1 с 3 мкм ретиноевой кислоты (РА) и 25 нг/мл каждый BMP4 и EGF. Поддерживать EBs при 37 ° C с 5% CO2.
    5. От дней 9 – 12 измените среднего каждый день KDM2 с 3 мкм RA, 25 нг/мл BMP4 и EGF 20 нг/мл.
    6. Между 13 – 30 дней измените средство каждый день на KDM3 с 10 нг/мл BMP4 и EGF 20 нг/мл.
  4. Дифференциация СВМС iPSC в фибробластов
    Примечание: Для схемы фибробластов дифференциации от СВМС iPSCs, см. Рисунок 2A.
    1. Герб культуры блюда, с помощью базальной мембраны матрицы. Подготовьте 5 мл, чтобы покрыть 100 мм блюдо.
      1. Оттепель базальной мембраны матрица (конечная концентрация: 600 нг/мл) и разбавить его с среде DMEM/F12. Добавить решение в посуду и инкубировать при 37 ° C на 30 мин аспирата материала покрытия перед использованием (не высохнуть).
    2. Урожай 100 EBs 50 мл Конические трубки с помощью пипетки с iPSC среднего или PBS. Сохранить на RT 1 мин, чтобы успокоиться EBs. Убедитесь, что они оседают на дне Конические трубки. Удалите супернатант.
    3. Ресуспензируйте EBs, используя 1000 мкл пипетки в 6 мл FDM1 с 10 мкм рок ингибитора. EBs (с средний) передать блюдо матрица покрытием 100 мм базальной мембраны и инкубировать и при 37 ° C с 5% CO2. Обновление FDM1 каждый день в течение 3 дней.
      Примечание: Только добавьте ингибитор рок на стадии вложение EB.
    4. Добавьте 0.5 Нм костных морфогенетических белков 4 (BMP 4) FDM1 между 4 и 6 дней.
    5. На 7 день измените средство на FDM2 каждый день в течение 1 недели.
    6. На 14 день добавляют 1 мл 1 мм ЭДТА и инкубировать и при 37 ° C с 5% CO2 на 2 мин урожай клетки с 3 мл FDM2 и центрифуги на 250 x g 2 мин удалить супернатант и Ресуспензируйте клетки в 5 мл FDM1.
    7. Подсчитать ячейки, используя Горяева, Ресуспензируйте 2 х 106 клеток с FDM1 средой и передать noncoated блюдо клетки. Сохранить клетки при 37 ° C с 5% CO2 и изменения среды каждый день.
    8. Слой культуры блюда, с использованием типа коллагена. Подготовьте 5 мл, чтобы покрыть 100 мм блюдо. Разбавить типа коллагена раствор (конечная концентрация: 50 мкг/мл) в 0.02 N уксусной кислоты. Добавить решение в посуду и Инкубируйте на RT 1 h. аспирата материала покрытия перед использованием (не высохнуть).
      Примечание: Перед использованием плиты, мыть посуду 3 x с PBS для удаления кислоты.
    9. На 21 день добавляют 1 мл 1 мм ЭДТА и инкубировать и при 37 ° C с 5% CO2 на 2 мин урожай клетки с 3 мл FDM1 и центрифуги на 250 x g 2 мин удалить супернатант и Ресуспензируйте клетки в 5 мл FDM1. Счетчик клеток с помощью Горяева и передачи 2 x 106 ячеек к типу я коллагена покрытием 100 мм блюдо с FDM1 средой. Сохранить клетки при 37 ° C с 5% CO2 и изменения среды каждый день.
    10. День 28 добавляют 1 мл 1 мм ЭДТА и инкубировать при 37 ° C с 5% CO2 на 2 мин урожай клетки с 3 мл FDM1 и центрифуги на 250 x g 2 мин удалить супернатант и Ресуспензируйте клетки в 5 мл FDM1. Подсчитать ячейки, используя Горяева и передачи 2 х 106 клеток в noncoated блюдо с FDM1 средой. Поддержания клеток при 37 ° C с 5% CO2 и изменения среды каждый день.
      Примечание: iPSC производные фибробластов размножаться как линия клетки первичной фибробластов и проезд до 10 ходов. В этом исследовании мы использовали фибробластов iPSC производный от двух до пяти проходы для дальнейшего анализа.

2. применение hiPSC производные дифференцированных клеток

  1. Поколение 3D кожи органоид
    1. Подготовить нейтрализованы типа я коллагена на льду, следуя рекомендациям изготовителя. Как конечная концентрация, используйте 3 мг/мл для типа коллагена (типа акций концентрация Коллаген является 3.47 мг/мл) и убедитесь, что конечный объем смеси составляет 5 мл. Рассчитать объем 10 x PBS (окончательный объем/10 = 0.5 мл). Рассчитать объем типа коллаген использоваться (окончательный объем x окончательные коллаген концентрации / фондовый коллагена концентрация = 5 мл x 3 мг / мл / 3.47 мг / мл = 4.32 мл). Рассчитать объем 1 N NaOH (объем коллагена использоваться x 0,023 = 0,1 мл). Рассчитать объем dH2O (окончательный объем - объем коллагена - объем 10 ПБС - объем 1 N NaOH = 5 мл - 4,32 мл-0,5-0,1 мл = 0,08 мл). Смешать содержимое трубки и держать его на льду до готовой к использованию.
    2. Добавить 1 мл раствора ЭДТА в iPSC производные фибробласты из шага 1.4.10 и инкубировать и при 37 ° C с 5% CO2 на 2 мин урожай отдельные клетки, подсчитать количество ячеек с помощью Горяева и 2 x 105 клетки перехода к новой 15 мл Конические трубки. Центрифуга на 250 x g на 2 мин и удалить супернатант. Ресуспензируйте клетки фибробластов iPSC производные в 1,5 мл FDM1 и нейтрализовать тип я коллагена раствор (1:1).
      Примечание: Смешайте раствор осторожно, чтобы избежать пузырей.
    3. Место вставки мембраны на 6-ну микроплиты, передача смеси вставки и Инкубируйте 30 мин в рт.
      Примечание: Не перемещайте пластины.
    4. После подтверждения гелеобразования, добавьте 2 мл среды в верхней части вставки и 3 мл в нижней части скважины. Инкубируйте матрица фибробластов и коллагена при 37 ° C с 5% CO2 для 5-7 дней, пока не завершится гелеобразования и больше не контрактов.
    5. После полного гелеобразования, отсоединить iPSC производные кератиноциты (из шага 1.3.6) с помощью ЭДТА. Добавьте 1 mL ЭДТА и инкубировать и при 37 ° C с 5% CO2 на 2 мин урожай отдельные клетки, считать их с помощью Горяева и передачи 1 x 106 клеток к новой 15 мл Конические трубки. Центрифуга на 250 x g на 2 мин.
    6. Удалить супернатант и Ресуспензируйте 1 x 106 клеток в 50-100 мкл низким содержанием кальция эпителиальных средних 1 (EP1).
    7. Аспирационная всех средних в матрице (см. шаг 2.1.5) и семян 1 х 106 клеток кератиноцитов iPSC производных на каждый слой фибробластов. Инкубируйте пластины при 37 ° C с 5% CO2 на 30 мин.
      Примечание: Не перемещайте пластину и не добавляйте любые средства для крепления кератиноцитов.
    8. Добавьте 2 мл EP1 в верхней части вставки и 3 мл EP1 в нижней части скважины.
    9. После 2 дней аспирационная всех средних в пластину вставки мембраны и измените средний нормальный кальция EP2 за 2 дня.
    10. После 2 дней аспирационная всех средних и добавить 3 мл среды ороговения только снизу для создания интерфейса, воздух жидкость.
    11. Поддерживать органоид 3D кожи на срок до 14 дней при 37 ° C с 5% CO2 и изменения среды каждый день. Урожай органоид 3D кожи на передний край insert и использовать его для дальнейшего изучения окрашивание и кожного лоскута.
  2. Кожного лоскута
    1. Выполнять ингаляционной анестезии на Нод/scid мышей (мужской, 6 недель), стандарт, институционально утвержденным методом. Для кожного лоскута брить мех каждой мыши спинной кожи.
    2. Удалите часть кожи мыши, используя щипцы изогнутые ножницы 1 см x 2 см.
    3. Место органоид СВМС iPSC производные 3D кожи на месте дефекта и шовный материал, с помощью метода галстук за Туалетная с шелковыми швами.
    4. Соблюдать мышей в течение 2 недель и пожертвовать их для гистологического анализа. Окрашивание протокол проверялось в предыдущих исследованиях16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Кожа состоит, по большей части, из эпидермиса и дермы. Кератиноциты тип основных клеток эпидермиса, и фибробласты тип основной ячейки дермы. Схема дифференциации кератиноцитов показана на рисунке 1A. СВМС iPCSc были сохранены в блюдо vitronectin покрытием (рис. 1Б). В этом исследовании мы продифференцировано СВМС iPSCs в кератиноцитов и фибробластов, с помощью формирования EB. Мы создали EBs с помощью висит падение метод для обеспечения единообразного и контролируемых дифференциации кератиноцитов и фибробластов (рис. 1C). EBs были прикреплены к типу IV коллаген покрытием пластин для дифференциации кератиноцитов, и средство было изменено ежедневно. СВМС iPSCs относились с РА, BMP4 и EGF. СВМС iPSCs были дифференцированы на кератиноцитов. Во время дифференциации морфология СВМС iPSC производные кератиноцитов меняются с течением времени (дополнительный рис. 1).

СВМС iPSC производные кератиноцитов имеют морфологии похож на основной кератиноциты (рис. 1D). Экспрессии генов плюрипотентных маркера OCT4 был downregulated в СВМС iPSC производные кератиноцитов. Грунтовка последовательности приведены в таблице 1. Выражение кератиноцитов маркеров Np63, KRT5 и KRT14 был увеличен в СВМС iPSC производные кератиноциты (рис. 1F). СВМС iPSC производные кератиноцитов были подтверждены выражением Np63 и KRT14, иммуногистохимия (рис. 1E). Эти результаты подтвердили, что СВМС iPSC производные кератиноцитов характеристики первичного кератиноцитов.

Схема разделения фибробластов показано в рисунке 2A. Мы также поддерживали СВМС iPSCs в vitronectin покрытием блюдо и используется формирование EB для дифференциации фибробластов (рис. 2B, C). Мы придает EBs пластины с покрытием матрицу базальной мембраны и изменил среднего каждый день. Нарост клетки были переведены в noncoated и типа коллаген покрытием пластин. СВМС iPSCs были продифференцированы для фибробластов. Во время дифференциации морфология СВМС iPSC производные фибробластов меняются с течением времени (дополнительный рисунок 2).

СВМС iPSC производные фибробластов имеют морфологии похож на основной фибробластов (Рисунок 2D). Выражение плюрипотентных стволовых клеток маркер OCT4 был downregulated в СВМС iPSC производные фибробластов. Маркеры фибробластов и COL1A1, COL1A2, COL3A1, CD44 были upregulated в СВМС iPSC производные фибробластов (Рисунок 2F). Грунтовка последовательности приведены в таблице 1. Кроме того СВМС iPSC производные фибробластов были подтверждены выражением виментин и фибронектин иммуногистохимия (2 рисунокE). Эти результаты показывают, что фибробласты СВМС iPSC производные похожи на первичный фибробластов.

Мы создали 3D кожи органоид, используя СВМС iPSC производные кератиноцитов и фибробластов. Схема формирования 3D кожи органоид показан на рисунке 3A. Мы создали 3D кожи органоид на пластине вставки мембраны. Для 3D культуры, СВМС iPSC производные фибробластов были стратифицированы с типом коллагена и обложил с СВМС iPSC производные кератиноцитов. После посева СВМС iPSC производные кератиноцитов, средство было изменено на нормальной кальция концентрации на 2 дня. После 2 дней средняя концентрация кальция была добавлена только в нижнюю палату для формирования культуры жидкость воздуха интерфейса. Воздух жидкость интерфейс культуры индуцированной созревания и стратификации кератиноцитов. Во время 3D культуры была увеличена толщина органоид 3D кожи. Эти результаты подтвердили, что 3D кожи органоид был создан из iPSC производные кератиноцитов и фибробласты гематоксилином и эозином (H & E) окрашивание (рис. 3C).

С помощью органоид СВМС iPSC производные 3D кожи, мы порожденных модель гуманизированные мышей (рис. 3B) прививки органоид 3D кожи для мышей. Вызванные дефектом 1 см x 2 см, и галстук за метод был использован для трансплантации. После 2 недель пересаженные кожи эффективно привитые для мышей, и это подтверждено H & E и иммуноцитохимическое анализ (рис. 3D). Кератиноцитов созревания и эпидермальный дифференциация маркеры loricrin и KRT14 были выражены в organoids СВМС iPSC производные 3D кожи (рис. 3E). Organoids СВМС iPSC производные 3D кожи были функционально продифференцировано, эффективно привитым мышей и эффективно зарубцевавшиеся дефекты кожи мышей.

Figure 1
Рисунок 1 : Дифференциации кератиноцитов СВМС iPSCs. (A) схема дифференциации кератиноцитов от СВМС iPSCs. (B и C) морфология СВМС iPSCs (группа B) и iPSC производные EBs (группа C). (D) морфология СВМС iPSC производные кератиноцитов. (E) анализ иммуноцитохимическое Np63 (красный) и KRT14 (зеленый), вместе с DAPI окрашивание (синий). Масштаб баров = 100 мкм. (F) выражение гена плюрипотентных маркер и кератиноцитов маркеры iPSC производные кератиноциты (iPSC-Ks). Графики показывают среднее с SEM пяти независимых выборок. Различия между группами были изучены для статистической значимости, используя студента t-теста. T-тест был применен для анализа непараметрических количественные наборы данных и одностороннее p-значение было рассчитано (*p < 0,05, **p < 0.01, ***p < 0,001 указал статистической значимости). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Дифференцировку фибробластов СВМС iPSCs. (A) схема фибробластов дифференциации от СВМС iPSCs. (B и C) морфология СВМС iPSCs (группа B) и iPSC производные EBs (группа C). (D) морфология СВМС iPSC производные фибробластов. (E) анализ иммуноцитохимическое виментин (красный) и фибронектина (красный), а также DAPI окрашивание (синий). Масштаб баров = 100 мкм. (F) выражение гена плюрипотентных маркер и фибробластов маркеры iPSC производные фибробластов (iPSC-Fs). Графики показывают среднее с SEM пяти независимых выборок. Различия между группами были изучены для статистической значимости, используя студента t-теста. T-тест был применен для анализа непараметрических количественные наборы данных и одностороннее p-значение было рассчитано (*p < 0,05, **p < 0.01, ***p < 0,001 указал статистической значимости). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Поколение модели гуманизированные мышей и СВМС iPSC производные кожи органоид. (A) принципиальная схема процесса генерации iPSC производные кожи органоид (iSO). (B) трансплантации процесс iSO в мышей. (C) гистологический анализ iSO в пробирке. (D) гистологический анализ пересаженных iSO в естественных условиях. (E-H) Анализ иммуноцитохимическое loricrin и KRT14. МАКЕТ элемента управления (группа E), пересаженных iSO (группа F, loricrin), кожи мышей (отрицательный контроль, группа G), пересаженных iSO (группа H, KRT14). Масштаб баров = 200 мкм. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Supplementary Figure 1
Дополнительный рисунок 1: морфология iPSC производные кератиноцитов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Supplementary Figure 2
Дополнительный рисунок 2: морфология iPSC производные фибробластов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Имя целевого объекта Направление Последовательность праймера (5' - 3') Размер (пар) Refseq_ID
OCT4 Вперед
Реверс
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Вперед
Реверс
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Вперед
Реверс
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Вперед
Реверс
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Вперед
Реверс
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Вперед
Реверс
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Вперед
Реверс
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Вперед
Реверс
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Вперед
Реверс
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Вперед
Реверс
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Виментин Вперед
Реверс
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Вперед
Реверс
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Таблица 1: Последовательности праймеров для количественных реального времени полимеразной цепной реакции.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Как новая альтернатива для персональной восстановительной медицины17было предложено человека iPSCs. Пациент производные персонализированные iPSCs отражают пациента характеристики, которые могут использоваться для моделирования заболевания, наркотиков скрининг и аутологичной трансплантации18,19. Использование пациента производные iPSCs можно также преодолеть проблемы, касающиеся начальной ячейки, отсутствие число адекватных клеток и иммунных реакций5,17,19. Однако поколение персонализированных iPSCs не является экономически осуществимо, время, стоимость и труда ограничений. HLA-гомозиготных СВМС производные iPSCs появились как новую возможность. HLA-гомозиготных iPSCs может быть экономически ценных и может быть применен к большое количество пациентов8,11,12,13. Кроме того HLA типирование CBMCs происходит во время хранения банка клеток, тем самым делая их легко использовать для научных исследований и трансплантации. Протоколы дифференцироваться СВМС iPSCs в кардиомиоцитов, гепатоцитов и хрящевые клетки были сообщила16,-20,-21,-22,-23.

Слои эпидермиса и дермы являются компонентами кожи. Эпидермис состоит из кератиноцитов и Дерма состоит из фибробластов. Таким образом мы продифференцировано СВМС iPSCs в кератиноцитов и фибробластов, соответственно. Для дифференциации, униформе, хорошо контролируемых и оптимизированный EBs были получены путем висеть падение метод15,24. Тип IV Коллаген является основным компонентом базальной мембраны. Для дифференциации кератиноцитов EBs были прикреплены к типу IV коллаген покрытием блюда. СВМС iPSC производные кератиноцитов имел булыжник как морфология (рис. 1D). Кератиноцитов маркеры Np63 и KRT14 были выражены в iPSC-Ks (Рисунок 1E, F). Что результат подтвердил, что РА и BMP4 индуцированных upregulation кератиноцитов маркеров. Кроме того СВМС iPSCs были дифференцированы в кератиноцитов похож на основной кератиноцитов.

Для дифференциации фибробластов, EBs были прикреплены к базальной мембраны матрица покрытием пластин, и дифференцированных клеток были последовательно пассированной на noncoated и типа коллаген покрытием пластин. Серийный субкультура был вынужден указать фибробластов дифференциации. Фибробласты производится внеклеточного матрикса (ECM), что функции миграции и адгезии. Фибробласты также производят обильные коллаген компоненты25. В СВМС iPSC производные фибробластов маркер поверхности фибробласта CD44 было увеличено. Выражение коллагена был upregulated в iPSC-Fs (Рисунок 2F). Выражение фибронектина и виментин было увеличено в iPSC-Fs (2 рисунокE).

Использование дифференцированного кератиноцитов и фибробластов, мы создали organoids СВМС iPSC производные кожи (рис. 3А). Мы использовали интерфейс воздуха жидкость культуры среднего высокого кальция, что индуцированной стратифицированных слоев organoids СВМС iPSC производные кожи. Высокая концентрация кальция необходимо для созревания кератиноцитов в vivo и in vitro, в то время как воздух жидкость интерфейс был использован для разработки многослойных слоев26,27,28. Мы использовали этот метод для имитации реального кожи и гистологической анализ показал, что кожа была расслаиваются (рис. 3C). Для подтверждения способности заживления ран, мы пересадили iSO кожи мышей, с помощью метода галстук за Туалетная (рис. 3D). После пересадки organoids кожи эффективно были привиты и адекватно исцеления кожи мышей. KRT14 была выражена в базальный слой стратификации плоскоклеточный и nonsquamous эпителия. Loricrin является основным компонентом рогового направлению неизлечимо дифференцированной и ороговевших клеток эпителия29,30. Эпидермальный дифференциации маркер loricrin была выражена в трансплантированы кожи. Выражение KRT14 и loricrin подтвердил, что кожа органоид был полностью зрелые, и дифференциация была продемонстрирована иммуногистохимическое окрашивание (рис. 3E).

В этом исследовании мы разработали протокол, чтобы дифференцироваться СВМС iPSCs в кератиноцитов и фибробластов, типы основных клеток кожи человека. Мы подтвердили, что СВМС iPSC производные кератиноцитов и фибробласты показал фенотипов похож на начальных клеточных линий. С помощью этих дифференцированных клеток, мы генерируется органоид 3D кожи и привиты к NOD/scid мышей с использованием метода галстук за Туалетная. Эта оригинальная методика была впервые описана в 1929 году Блэра и Брауна и широко использовалась для пересадки кожи31,32. Этот метод предотвратить перемещение трансплантата, благоприятствования хорошей адгезией к ране и таким образом ускорить заживление тканей. Гистологический анализ подтвердил, что 3D кожи органоид передразнил фенотипа кожи человека успешно расслаиваются и созрел более 2 недель. Пересадки кожи обычно выполняется с помощью единичных клеток кератиноцитов и фибробластов кремния пузырь палата33,34. Эта система проста в графт, но нам нужно больше времени для наблюдать эффективность трансплантации после трансплантата. Пластик или кремния палата функционирует как барьер против мышей кожи. IPSCs системы производный органоид 3D кожи не использовать пластиковые или кремния камеры. В этой системе пересадка была эффективной; Однако было трудно блокировать естественный процесс исцеления мышей. Таким образом кожи мышей охватывает многие части iSO долгое время после пересадки. Это является частью метода, представленные здесь, должны быть улучшены.

В заключение СВМС iPSCs являются потенциальным источником ячейки для кожи графтов. С помощью этих протоколов, СВМС iPSC производные кератиноцитов, фибробластов и 3D кожи органоид может использоваться в исследованиях в области дерматологии, наркотиков и косметической скрининг и регенеративной медицины.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа была поддержана грант от Кореи здравоохранения технологии R & D проекта, Министерство здравоохранения, благосостояния и делам семьи, Республика Корея (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics