Generatie van 3D huid Organoid van koord bloed afkomstige geïnduceerde pluripotente stamcellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wij stellen voor een protocol dat laat zien hoe geïnduceerde pluripotente stamcel afkomstige keratinocyten en fibroblasten differentiëren en genereren een 3D huid organoid, met behulp van deze keratinocyten en fibroblasten. Dit protocol bevat een extra stap van het genereren van een gehumaniseerd muizen model. De techniek die hier gepresenteerd zal dermatologische onderzoek verbeteren.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De huid is het grootste orgaan van het lichaam en heeft vele functies. De huid fungeert als een fysieke barrière en de beschermer van het lichaam en regelt lichaamsfuncties. Biomimetics is de nabootsing van de modellen, systemen en elementen van de natuur met het oog op het oplossen van complexe menselijke problemen1. Huid biomimetics is een nuttig instrument voor onderzoek van de ziekte in vitro en in vivo regeneratieve geneeskunde. Menselijke geïnduceerde pluripotente stamcellen (iPSCs) hebben het kenmerk van onbeperkte proliferatie en de mogelijkheid van differentiatie op drie lagen van de kiem. Menselijke iPSCs worden gegenereerd uit verschillende primaire cellen, zoals cellen van het bloed, keratinocyten, fibroblasten en meer. Onder hen, hebben koord bloed mononucleaire cellen (CBMCs) naar voren gekomen als een bron van alternatieve cel vanuit het perspectief van allogene regeneratieve geneeskunde. CBMCs zijn nuttig in de regeneratieve geneeskunde omdat menselijke leukocyten antigeen (HLA) te typen naar de cel bankwezen essentieel. Wij bieden een methode voor de differentiatie van CBMC-iPSCs in keratinocyten en fibroblasten en generatie van een 3D huid organoid. Keratinocyten CBMC-iPSC-afgeleide en fibroblasten hebben kenmerken vergelijkbaar met een oplaadbare batterij-lijn. De 3D huid organoids worden gegenereerd door een epidermale laag op een dermale laag bedekken. Door het transplanteren van deze 3D huid organoid, wordt een gehumaniseerd muizen model gegenereerd. Deze studie toont aan dat een 3D menselijke iPSC afkomstige huid organoid een nieuwe, alternatieve tool voor dermatologische onderzoek in vitro en in vivo wellicht.

Introduction

Huid heeft betrekking op de buitenste oppervlakte van het lichaam en beschermt de inwendige organen. De huid heeft verschillende functies, met inbegrip van bescherming tegen ziekteverwekkers, opvangen en opslaan van water, regulering van de lichaamstemperatuur, en lichaam afscheiden afval2. Huid protheses kunnen worden ingedeeld, afhankelijk van de bron van de huid; transplantaties met behulp van de huid van een andere donor allografts worden genoemd, en enten met de huid van de patiënt zijn autografts. Hoewel het een autograft is de aangewezen behandeling vanwege zijn lage afwijzing risico, zijn huid biopsieën moeilijk uit te voeren op patiënten met ernstige letsels of een onvoldoende aantal huidcellen. Bij patiënten met ernstige brandwonden zijn drie keer het aantal huidcellen nodig om grote gebieden bestrijken. De beperkte beschikbaarheid van huidcellen van het lichaam van een patiënt leidt tot situaties waarin allogenous transplantatie noodzakelijk is. Een allograft wordt tijdelijk gebruikt totdat autologe transplantatie kan worden uitgevoerd omdat het meestal wordt afgewezen door het immuunsysteem van de gastheer na ongeveer 1 week3. Om te overwinnen afwijzing door het immuunsysteem van de patiënt, moeten protheses komen uit een bron met dezelfde immuun identiteit als de patiënt4.

Menselijke iPSCs zijn een opkomende bron van cellen voor stamcel therapie5. Menselijke iPSCs worden gegenereerd uit lichaamscellen, met behulp van herprogrammering factoren zoals OCT4, SOX2, Klf4 en c-Myc6. Met behulp van menselijke iPSCs overwint de ethische en immunologische kwesties van embryonale stamcellen (SER's)7,8. Menselijke iPSCs pluripotent hebben en kunt onderscheiden in drie lagen van de kiem9. De aanwezigheid van HLA, een kritische factor in de regeneratieve geneeskunde, bepaalt de immuunrespons en de mogelijkheid van verwerping10. Het gebruik van patiënt-afgeleide iPSCs verhelpt de problemen van cel-source beperking en immuunsysteem afwijzing. CBMCs hebben ook naar voren gekomen als een bron van alternatieve cel voor regeneratieve geneeskunde11. Verplichte HLA typen, die tijdens CBMC bankieren optreedt, kan gemakkelijk worden gebruikt voor onderzoek en transplantatie. Verdere, homozygoot HLA-type iPSCs kunt grote schaal toepassen van verschillende patiënten12. Een bank CBMC-iPSC is een roman en efficiënte strategie voor celtherapie en allogene regeneratieve geneeskunde12,13,14. In deze studie, wij gebruiken CBMC-iPSCs, onderscheiden in keratinocyten en fibroblasten, en genereren van gestratificeerde 3D huidlagen. Resultaten van deze studie suggereren dat een 3D huid CBMC-iPSC-afgeleide organoid een nieuwe tool voor in vitro en in vivo dermatologische onderzoek is.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedures waarbij dieren werden uitgevoerd overeenkomstig de laboratorium akte van de welzijn van de dieren, de gids voor de verzorging en het gebruik van proefdieren, en de richtlijnen en het beleid voor knaagdieren experimenten geboden door de institutionele Animal Care en Gebruik Comité (IACUC) van de School of Medicine van de Katholieke Universiteit van Korea. Het studie-protocol werd goedgekeurd door de institutionele Review Board van de Katholieke Universiteit van Korea (CUMC-2018-0191-01). De IACUC en het departement van laboratorium dieren (DOLA) van de Katholieke Universiteit van Korea, Songeui Campus geaccrediteerde de Korea Excellence dier laboratorium faciliteit van de Korea Food and Drug Administration in 2017 en verworven vereniging voor beoordeling en Erkenning van de internationale volledige accreditatie Laboratory Animal Care International (AAALAC) in 2018.

1. de celdifferentiatie van geïnduceerde pluripotente stamcellen van de huid

  1. Middellange voorbereiding
    Opmerking: Bewaar alle medium bij 4 ° C in een donkere omgeving voor maximaal 3 maanden. Filteren alle medium gebruik van een systeem van de filter van het polyethersulfon 0,22 μm vóór gebruik voor sterilisatie. Alle medium was beschikbaar in een totaal volume van 500 mL.
    1. Bereiden van KDM1 (Keratinocyt differentiatie medium 1). De mix Dulbecco bewerkt Eagle's Medium (DMEM) / F12 medium (3:1) met 2% foetale runderserum (FBS), 0.3 mmol/L L-ascorbinezuur, 5 μg/mL insuline en 24 µg/mL adenine.
    2. Bereiden van KDM2 (Keratinocyt differentiatie medium 2). Mix gedefinieerd Keratinocyt serumvrij middellange (Zie de Tabel van materialen) met 0.3 mmol/l-L-ascorbinezuur, 5 μg/mL insuline en 10 μg/mL adenine.
      Opmerking: Gedefinieerde Keratinocyt serumvrij medium is geoptimaliseerd voor de ondersteuning van de groei en de uitbreiding van keratinocyten.
    3. Bereiden van KDM3 (Keratinocyt differentiatie gemiddeld 3). Mix gedefinieerd Keratinocyt serumvrij medium en Keratinocyt serumvrij medium (1:1) Zie de Tabel van materialen voor meer informatie.
      Opmerking: Keratinocyt serumvrij medium is geoptimaliseerd voor de groei en het onderhoud van keratinocyten.
    4. Bereiden van FDM1 (fibroblast differentiatie medium 1). Mix DMEM/F12 medium (3:1) met 5% FBS, 5 μg/mL insuline 0.18 mM adenine en 10 ng/mL epidermale groeifactor (EGF).
    5. Bereiden van FDM2 (fibroblast differentiatie medium 2). Mix DMEM/F12 medium (1:1) met 5% FBS en 1% niet-essentiële aminozuren.
    6. EP1 bereiden (epitheliale medium 1). Mix DMEM/F12 (3:1) met 4 mM L-glutamine, 40 μM adenine 10 μg/mL transferrine, 10 μg/mL insuline en 0,1% FBS.
    7. Bereiden EP2 (epitheliale medium 2). Meng EP1 en 1,8 mM calciumchloride.
    8. Bereiden EP3 (epitheliale medium 3, cornification medium). Mix-F12 medium met 4 mM L-glutamine, 40 μM adenine, 10 μg/mL transferrine, 10 μg/mL insuline, 2% FBS en 1,8 mM calciumchloride.
  2. Embryonale lichaam generatie
    1. Genereren van CBMC-iPSCs met behulp van het protocol weergegeven in een eerdere studie12.
    2. Jas cultuur gerechten, met behulp van vitronectin. Bereiden 5 mL jas een schotel van 100 mm.
      1. Ontdooien en resuspendeer 50 μl van 0, 5 mg/mL vitronectin (eindconcentratie: 5 µg/mL) met 5 mL steriele-fosfaatgebufferde zoutoplossing (PBS). Voeg de oplossing aan de gerechten en Incubeer bij kamertemperatuur (RT) voor 1 h. Aspirate het materiaal van de bekleding vóór gebruik (niet te drogen).
    3. De CBMC afkomstige iPSCs tot de vitronectin-gecoat 100 mm plaat en veranderen het iPSC medium (E8) dagelijks bij 37 ° C met 10% CO2handhaven.
    4. Genereren van embryonale organen (EBs) met behulp van het protocol weergegeven in een eerdere studie15 (kort als volgt beschreven). Vouw iPSCs uit door het veranderen van het medium, totdat de cellen hebben 80% samenvloeiing bereikt. Bij 80% samenvloeiing, verwijder het medium en wassen met PBS.
    5. De cellen met 1 mL 1 mM ethyleendiamminetetra azijnzuuroplossing (NA2EDTA) behandelen. Incubeer bij 37 ° C met 5% CO2 gedurende 2 minuten en oogsten van de cellen met behulp van 3 mL E8 voedingsbodem. Centrifugeer de cellen bij 250 x g gedurende 2 min.
    6. De bovendrijvende substantie gecombineerd en 5 mL van E8 medium toepassen op de cellen. Met behulp van een hemocytometer cellen tellen en 1 x 106 cellen overbrengen in een nieuwe conische tube van 15 mL. Centrifugeer de cellen bij 250 x g gedurende 2 min.
    7. Resuspendeer de overgedragen cellen met 2,5 mL van EB vorming medium met 10 μM Rho-geassocieerde kinase (ROCK) remmer. Dalen 1 x 104 cellen (25 µL/druppel) op een noncoated cultuur plaat deksel met een 10-100 μl meerkanaalspipet. Formulier 100 EBs uit 1 x 106 cellen (1 x 104 cellen/1 EB). Draai de schotel en hangen de druppel aan het deksel.
      Opmerking: ROCK-remmer is nodig tijdens de stap van de bijlage bij het onderhoud en differentiatie. De ROCK-remmer alleen in de EB aggregatie stadium toevoegt.
    8. Incubeer de druppels bij 37 ° C met 5% CO2 voor 1 dag.
    9. De volgende dag, oogst de 100 EBs en ze gebruiken voor differentiatie. Het deksel van de plaat met iPSC medium (E8 medium) of PBS wassen en oogst van de inhoud ervan naar een conische tube van 50 mL. Het handhaven van het EBs op RT voor 1 min om hen settelen. Gecombineerd het supernatant en resuspendeer de EBs met E8 medium deze in een 90 mm petrischaal te handhaven tot de differentiatie.
  3. Differentiatie van CBMC-iPSCs in keratinocyten
    Opmerking: Voor een regeling van de Keratinocyt differentiatie van CBMC-iPSCs, Zie Figuur 1A.
    1. Oogst de 100 EBs aan een conische buis van 50 mL met iPSC medium of PBS. Zorg ervoor dat RT voor 1 min neer het EBs te regelen. Zorg ervoor dat ze zich aan de onderkant van de conische buis. Gecombineerd het supernatant en resuspendeer de EBs met E8 medium met 1 ng/mL bot morfogenetische eiwit 4 (BMP4). De EBs overbrengen in een 90 mm petrischaal en handhaven bij 37 ° C met 5% CO2 voor 1 dag.
    2. Jas gerechten, cultuur, gebruikmakend van type IV collageen. Bereiden van 5 mL van type IV collageen jas een schotel van 100 mm.
      1. Ontdooien en resuspendeer de type IV collageen oplossing (eindconcentratie: 50 µg/mL) met 0,05 N HCl. Voeg de oplossing aan de gerechten en Incubeer bij RT gedurende 1 h. gecombineerd het materiaal van de bekleding vóór gebruik (niet te drogen).
        Opmerking: Voordat u de platen, de afwas 3 x met PBS te verwijderen van een zuur.
    3. Oogst de EBs (stap 1.3.1) aan een conische buis van 50 mL en handhaven op RT voor 1 min om hen settelen. Zorg ervoor dat ze vestigen op de onderkant van de conische buis, gecombineerd het supernatant en resuspendeer de EBs in 6 mL KDM1 met 10 µM ROCK-remmer. De EBs overbrengen in de type IV collageen beklede 100 mm schotel.
      Opmerking: Voeg het ROCK-remmer alleen het stadium EB bijlage.
    4. Tussen dagen 0 – 8, door het medium om de andere dag te KDM1 met retinoïnezuur 3 µM (RA) en 25 ng/mL elke BMP4 en EGF te wijzigen. Het handhaven van het EBs bij 37 ° C met 5% CO2.
    5. Tussen dagen 9 – 12: omzetten in het medium om de andere dag KDM2 met 3 µM RA, 25 ng/mL BMP4 en 20 ng/mL EGF.
    6. Tussen dagen 13 – 30: omzetten in het medium om de andere dag KDM3 met 10 ng/mL BMP4 en 20 ng/mL EGF.
  4. Differentiatie van CBMC-iPSC in fibroblasten
    Opmerking: Voor een regeling van de fibroblast differentiatie van CBMC-iPSCs, Zie Figuur 2.
    1. Jas cultuur gerechten, met behulp van kelder membraan matrix. Bereiden 5 mL jas een schotel van 100 mm.
      1. Ontdooien kelder membraan matrix (eindconcentratie: 600 ng/mL) en Verdun het met DMEM/F12 medium. Voeg de oplossing aan de gerechten en Incubeer bij 37 ° C gedurende 30 minuten Aspirate de coating materiaal vóór gebruik (niet te drogen).
    2. Oogst de 100 EBs naar een conische tube van 50 mL, met behulp van een precisiepipet met iPSC medium of PBS. Zorg ervoor dat RT voor 1 min neer het EBs te regelen. Zorgen dat ze zich aan de onderkant van de conische buis. Verwijder het supernatant.
    3. Resuspendeer de EBs met behulp van een 1.000 µL precisiepipet in 6 mL FDM1 met 10 µM ROCK-remmer. De EBs (met medium) overbrengen in een kelder membraan 100 mm matrix beklede schotel en Incubeer bij 37 ° C met 5% CO2. Vernieuw de FDM1 elke andere dag gedurende 3 dagen.
      Opmerking: Alleen toevoegen de ROCK-remmer stadium de bijlage EB.
    4. 0.5 nM bot morfogenetische eiwit 4 (BMP 4) toevoegen aan de FDM1 tussen 4 en 6 dagen.
    5. Op dag 7, omzetten in het medium FDM2 om de andere dag voor 1 week.
    6. Op dag 14, voeg 1 mL 1 mM EDTA en Incubeer bij 37 ° C met 5% CO2 voor 2 min. oogst de cellen met 3 mL FDM2 en centrifuge op 250 x g voor 2 min. Verwijder het supernatant en resuspendeer de cellen in 5 mL FDM1.
    7. Met behulp van een hemocytometer cellen tellen, 2 x 106 cellen met FDM1 medium resuspendeer en overbrengen van de cellen naar de noncoated schotel. Handhaven van de cellen bij 37 ° C met 5% CO2 en wijzig het medium om de andere dag.
    8. Jas cultuur gerechten, met behulp van controletype I collageen. Bereiden 5 mL jas een schotel van 100 mm. Verdun controletype I collageen oplossing (eindconcentratie: 50 µg/mL) in 0,02 N azijnzuur. Voeg de oplossing aan de gerechten en Incubeer bij RT gedurende 1 h. Aspirate het materiaal van de bekleding vóór gebruik (niet te drogen).
      Opmerking: Voordat u de platen, de afwas 3 x met PBS te verwijderen van het zuur.
    9. Op dag 21, voeg 1 mL 1 mM EDTA en Incubeer bij 37 ° C met 5% CO2 voor 2 min. oogst de cellen met 3 mL FDM1 en centrifuge op 250 x g voor 2 min. Verwijder het supernatant en resuspendeer de cellen in 5 mL FDM1. Graaf de cellen met behulp van een hemocytometer en de overdracht 2 x 106 cellen met het type ik 100 mm collageen beklede schotel met FDM1 medium. Handhaven van de cellen bij 37 ° C met 5% CO2 en wijzig het medium om de andere dag.
    10. Op dag 28, voeg 1 mL 1 mM EDTA en Incubeer bij 37 ° C met 5% CO2 voor 2 min. oogst de cellen met 3 mL FDM1 en centrifuge op 250 x g voor 2 min. Verwijder het supernatant en resuspendeer de cellen in 5 mL FDM1. Tellen van de cellen met behulp van een hemocytometer en 2 x 106 cellen overbrengen door een noncoated schotel met FDM1 medium. Handhaven van de cel bij 37 ° C met 5% CO2 en wijzig het medium om de andere dag.
      Opmerking: iPSC afkomstige fibroblasten vermenigvuldigen als een primaire fibroblast cellijn en passage tot 10 passages. In deze studie gebruikten we iPSC afkomstige fibroblasten van twee tot vijf passages voor verdere analyse.

2. de toepassing van gedifferentieerde cellen hiPSC afkomstige

  1. Generatie van 3D huid organoid
    1. Bereiden van geneutraliseerde type I collageen op ijs, na de aanbevelingen van de fabrikant. Als de uiteindelijke concentratie, gebruik maken van 3 mg/mL voor type I collageen (voorraad concentratie van controletype I collageen is 3,47 mg/mL), en zorg ervoor dat het uiteindelijke volume van het mengsel is 5 mL. Berekenen van het volume van 10 x PBS (laatste volume/10 = 0,5 mL). Berekenen van het volume van controletype I collageen moet worden gebruikt (eindvolume x laatste collageen concentratie / voorraad collageen concentratie = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Berekenen van het volume van 1 N NaOH (hoeveelheid collageen te gebruiken x 0.023 mL = 0,1 mL). Berekenen van het volume van de dH2O (eindvolume - volume van collageen - volume van 10 x PBS - volume van 1 N NaOH = 5 mL - 4,32 mL-0,5 mL 0,1 mL = 0,08 mL). Meng de inhoud van de tube en houden het op ijs totdat klaar voor gebruik.
    2. 1 mL van de EDTA toevoegen aan de fibroblasten iPSC-afgeleid uit stap 1.4.10 en Incubeer bij 37 ° C met 5% CO2 2 min. oogst de vrijstaande cellen, cellen met behulp van een hemocytometer tellen en 2 x 105 cellen overbrengen in een nieuwe conische tube van 15 mL. Centrifugeer bij 250 x g gedurende 2 minuten en verwijder de bovendrijvende substantie. Resuspendeer de cellen van de iPSC-afgeleide fibroblasten in 1,5 mL van FDM1 en het type geneutraliseerd ik collageen oplossing (1:1).
      Opmerking: Meng de oplossing voorzichtig om te voorkomen dat de bubbels.
    3. Plaats het membraan invoegen op een 6-well microplate, het mengsel overbrengen in de insert en Incubeer bij RT gedurende 30 min.
      Opmerking: Verplaats niet de platen.
    4. Na het bevestigen van de gelering, voeg toe 2 mL medium naar de top van het donormateriaal en 3 mL tot de bodem van de put. Incubeer de matrix van fibroblasten en collageen bij 37 ° C met 5% CO2 voor 5-7 dagen, totdat de gelering voltooid is en niet langer contracten.
    5. Na de volledige gelering, Los de iPSC-afgeleide keratinocyten (uit stap 1.3.6) met behulp van EDTA. Voeg 1 mL EDTA en Incubeer bij 37 ° C met 5% CO2 voor 2 min. oogst de vrijstaande cellen tellen ze met behulp van een hemocytometer en 1 x 106 cellen overbrengen in een nieuwe conische tube van 15 mL. Centrifugeer bij 250 x g gedurende 2 min.
    6. Verwijder het supernatant en resuspendeer 1 x 106 cellen in 50-100 µL van lage calcium epitheliale medium 1 (EP1).
    7. Alle medium in de matrix gecombineerd (zie stap 2.1.5) en 1 x 106 cellen van de iPSC-afgeleide keratinocyten op elke laag van de fibroblast zaad. Incubeer de plaat bij 37 ° C met 5% CO2 voor 30 min.
      Opmerking: Verplaats de plaat niet en voeg niet elk medium voor de bevestiging van keratinocyt.
    8. Voeg 2 mL EP1 tot de bovenkant van het donormateriaal en 3 mL EP1 naar de bodem van de put.
    9. Na 2 dagen, gecombineerd alle medium in de membraan invoegen plaat en wijzig het medium in normale calcium EP2 voor 2 dagen.
    10. Na 2 dagen, gecombineerd alle middellange en voeg 3 mL van het cornification medium alleen aan de onderkant voor het genereren van een lucht-vloeistof-interface.
    11. De organoid 3D huid gedurende maximaal 14 dagen bij 37 ° C met 5% CO2 en wijzig het medium om de andere dag. Oogst de 3D huid-organoid door het snijden van de rand van het invoegen en gebruiken voor een verdere studie van de kleuring en huidtransplantatie.
  2. Huidtransplantatie
    1. Inademing verdoving uitvoeren op knik/scid muizen (mannelijke, 6 weken oud), met behulp van een standaard, institutioneel erkende methode. Scheren voor huidtransplantatie, de vacht van de dorsale huid van elke muis.
    2. Verwijder een sectie 1 x 2 cm van de muis in de huid, met behulp van gebogen schaar met een tang.
    3. Plaats de 3D huid CBMC-iPSC-afgeleide organoid op de site van defect en hechtdraad met behulp van de methode van een stropdas-over dressing met zijde hechtingen.
    4. Observeren van de muizen voor 2 weken en offeren ze histologische p.a.. De kleuring protocol werd gecontroleerd in eerdere studies16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Huid is samengesteld, voor het grootste deel van de epidermis en de dermis. Keratinocyten zijn de belangrijkste celtype van de epidermis en fibroblasten de belangrijkste celtype van de dermis. De regeling van Keratinocyt differentiatie is afgebeeld in Figuur 1A. CBMC-iPCSc werden onderhouden in een vitronectin-gecoate schotel (Figuur 1B). In deze studie onderscheiden we CBMC-iPSCs in keratinocyten en fibroblasten met EB vorming. We genereerden EBs met behulp van de opknoping drop methode om een uniforme en gecontroleerde differentiatie van keratinocyten en fibroblasten (Figuur 1C). EBs IV collageen beklede platen voor Keratinocyt differentiatie typt u waren verbonden, en het medium was dagelijks verschoond. CBMC-iPSCs werden behandeld met RA, BMP4 en EGF. CBMC-iPSCs waren gedifferentieerd naar keratinocyten. Tijdens de differentiatie, de morfologie van de keratinocyten van CBMC-iPSC-afgeleide veranderd na verloop van tijd (aanvullende figuur 1).

CBMC-iPSC-afgeleide keratinocyten hebben morphologies vergelijkbaar met primaire keratinocyten (Figuur 1D). De expressie van genen van de pluripotente markering OCT4 was werden in keratinocyten CBMC-iPSC-afgeleide. Primer reeksen worden weergegeven in tabel 1. De expressie van Keratinocyt markers, Np63, KRT5, en KRT14 werd verhoogd in CBMC-iPSC-afgeleide keratinocyten (Figuur 1F). Keratinocyten CBMC-iPSC-afgeleid werden bevestigd door de uitdrukking van Np63 en KRT14 van immunohistochemistry (Figuur 1E). Deze resultaten bevestigd dat CBMC-iPSC-afgeleide keratinocyten de kenmerken van primaire keratinocyten zijn.

De regeling van de fibroblast differentiatie wordt weergegeven in Figuur 2. We ook onderhouden CBMC-iPSCs in een vitronectin beklede schaal en EB vorming gebruikt voor fibroblast differentiatie (Figuur 2B, C). Wij de EBs aan kelder membraan matrix beklede platen en veranderd het medium om de andere dag. Uitgroei cellen werden overgebracht naar noncoated en typ ik collageen beklede platen. CBMC-iPSCs werden onderscheiden voor fibroblasten. Tijdens de differentiatie, de morfologie van de fibroblasten CBMC-iPSC-afgeleide veranderd na verloop van tijd (aanvullende figuur 2).

Fibroblasten CBMC-iPSC-afgeleide hebben morphologies vergelijkbaar met primaire fibroblasten (Figuur 2D). De expressie van pluripotente stamcel markering OCT4 was werden in CBMC-iPSC-afgeleide fibroblasten. Fibroblast markers van COL1A1, COL1A2, COL3A1 en CD44 waren upregulated in CBMC-iPSC-afgeleide fibroblasten (Figuur 2F). Primer reeksen worden weergegeven in tabel 1. Ook, fibroblasten CBMC-iPSC-afgeleid werden bevestigd door de uitdrukking van vimentin en fibronectine door immunohistochemistry(Figuur 2). Deze resultaten suggereren dat CBMC-iPSC-afgeleide fibroblasten vergelijkbaar met primaire fibroblasten zijn.

We genereerden een 3D huid organoid met behulp van de keratinocyten CBMC-iPSC-afgeleide en fibroblasten. De regeling van de vorming van de 3D huid organoid is afgebeeld in Figuur 3A. We genereerden een 3D huid organoid op een membraan invoegen plaat. Voor de 3D cultuur, fibroblasten CBMC-iPSC-afgeleid werden gelaagde met type I collageen en overtrok met CBMC-iPSC-afgeleide keratinocyten. Na het zaaien de keratinocyten CBMC-iPSC-afgeleid, werd het medium veranderd in een normaal calcium concentratie gedurende 2 dagen. Na 2 dagen, was een hoog calcium concentratie medium alleen toegevoegd aan de tweede kamer voor de vorming van lucht-liquid interface cultuur. De lucht-liquid interface cultuur geïnduceerde de rijping en de gelaagdheid van de keratinocyten. De dikte van de huid van de 3D-organoid werd verhoogd tijdens 3D cultuur. Deze resultaten bevestigd dat de huid van de 3D organoid van iPSC afkomstige keratinocyten en fibroblasten werd gegenereerd door haematoxyline en eosine (H & E) vlekken (Figuur 3C).

Met behulp van de 3D huid CBMC iPSC-afkomstige organoid, we een gehumaniseerd muizen model (Figuur 3B) gegenereerd door het enten van de 3D huid organoid aan de muizen. Een 1 x 2 cm defect werd veroorzaakt, en de tie-over-methode werd gebruikt voor transplantatie. Na 2 weken, de getransplanteerde huid efficiënt met de muizen was geënt en we dit bevestigd door H & E en immunocytochemische analyse (Figuur 3D). Keratinocyt rijping en de epidermale differentiatie markers van loricrin en KRT14 werden uitgedrukt in de CBMC-iPSC-afgeleide 3D huid organoids (Figuur 3E). De CBMC-iPSC-afgeleide 3D huid organoids waren functioneel gedifferentieerd, efficiënt geënt op muizen en effectief genezen muizen huid gebreken.

Figure 1
Figuur 1 : Keratinocyt differentiatie van CBMC-iPSCs. (A) schema van Keratinocyt differentiatie van CBMC-iPSCs. (B en C) morfologie van de CBMC-iPSCs (deelvenster B) en de iPSC-afgeleide EBs (deelvenster C). (D) de morfologie van de keratinocyten van CBMC-iPSC-afgeleide. (E) immunocytochemische analyse van Np63 (rood) en KRT14 (groen), samen met de DAPI kleuring (blauw). De schaal balken = 100 μm. (F) de expressie van genen van de pluripotente marker en Keratinocyt markers van iPSC afkomstige keratinocyten (iPSC-Ks). De grafieken tonen het gemiddelde met SEM van vijf onafhankelijke monsters. Verschillen tussen groepen werden onderzocht voor statistische significantie met behulp van de Student t-test. De t-test werd toegepast voor het analyseren van niet-parametrische kwantitatieve datasets en de eenzijdige p-waarde werd berekend (*p < 0,05, **p < 0,01, ***p < 0.001 aangegeven statistische significantie). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Fibroblast differentiatie van CBMC-iPSCs. (A) schema van de fibroblast differentiatie van CBMC-iPSCs. (B en C) morfologie van de CBMC-iPSCs (deelvenster B) en de iPSC-afgeleide EBs (deelvenster C). (D) de morfologie van de fibroblasten CBMC-iPSC-afgeleide. (E) immunocytochemische analyse van vimentin (rood) en fibronectine (rood), samen met de DAPI kleuring (blauw). De schaal balken = 100 μm. (F) de expressie van genen van de pluripotente marker en fibroblast markers van iPSC afkomstige fibroblast (iPSC-Fs). De grafieken tonen het gemiddelde met SEM van vijf onafhankelijke monsters. Verschillen tussen groepen werden onderzocht voor statistische significantie met behulp van de Student t-test. De t-test werd toegepast voor het analyseren van niet-parametrische kwantitatieve datasets en de eenzijdige p-waarde werd berekend (*p < 0,05, **p < 0,01, ***p < 0.001 aangegeven statistische significantie). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Generatie van CBMC-iPSC-afgeleide huid organoid en gehumaniseerd muizen model. (A) schematisch diagram van het iPSC afkomstige huid proces voor de generatie van de organoid (iSO). (B) transplantatie proces van de iSO in muizen. (C) histologische analyse van de in vitro iSO. (D) histologische analyse van de getransplanteerde iSO in vivo. (E-H) Immunocytochemische analyse van loricrin en KRT14. BESPOTTEN (bedieningspaneel E) getransplanteerde iSO (deelvenster F, loricrin), muizen huid (negatieve controle, deelvenster G), getransplanteerde iSO (deelvenster H, KRT14). De schaal balken = 200 μm. Klik hier voor een grotere versie van dit cijfer.

Supplementary Figure 1
Aanvullende figuur 1: morfologie van iPSC afkomstige keratinocyten. Klik hier voor een grotere versie van dit cijfer.

Supplementary Figure 2
Aanvullende figuur 2: morfologie van iPSC afkomstige fibroblasten. Klik hier voor een grotere versie van dit cijfer.

Doel naam Richting Primer sequentie (5' - 3') Grootte (basenparen) Refseq_ID
OCT4 Voorwaarts
Omgekeerde
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Voorwaarts
Omgekeerde
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Voorwaarts
Omgekeerde
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Voorwaarts
Omgekeerde
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Voorwaarts
Omgekeerde
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Voorwaarts
Omgekeerde
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Voorwaarts
Omgekeerde
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Voorwaarts
Omgekeerde
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Voorwaarts
Omgekeerde
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Voorwaarts
Omgekeerde
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin Voorwaarts
Omgekeerde
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Voorwaarts
Omgekeerde
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabel 1: Reeksen inleidingen gebruikt voor kwantitatieve real-time polymerasekettingreactie.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Menselijke iPSCs hebben gesuggereerd als een nieuw alternatief voor gepersonaliseerde regeneratieve geneeskunde17. Gepersonaliseerde iPSCs patiënt afkomstige weerspiegelen patiënt kenmerken die kunnen worden gebruikt voor de modellering van de ziekte, drug screening, en autologe transplantatie18,19. Het gebruik van patiënt-afgeleide iPSCs kan ook problemen met betrekking tot de primaire cellen, een gebrek aan voldoende cel nummers en immuunreacties5,17,19. De generatie van gepersonaliseerde iPSCs is echter niet economisch haalbaar als gevolg van de tijd, kosten en beperkingen van de arbeid. HLA-homozygoot CBMC afkomstige iPSCs opgedoken als een nieuwe mogelijkheid. HLA-homozygoot iPSCs kunnen economisch waardevol en kan worden toegepast op een groot aantal patiënten8,11,12,13. Bovendien, HLA-typering van CBMCs treedt op tijdens de cel bank opslag, waardoor ze gemakkelijk te gebruiken voor onderzoek en transplantatie. Protocollen om te onderscheiden van CBMC-iPSCs in cardiomyocytes, hepatocyten en chondrocyten geweest16,20,21,22,23gemeld.

Epidermale en dermale lagen zijn onderdelen van de huid. De opperhuid bestaat van keratinocyten en de dermis bestaat uit fibroblasten. Dus, wij onderscheid gemaakt tussen CBMC-iPSCs keratinocyten en fibroblasten, respectievelijk. Voor de differentiatie, geüniformeerde, goed gecontroleerd en geoptimaliseerde EBs werden gegenereerd door de opknoping drop methode15,24. Type IV collageen is een belangrijk onderdeel van het membraan van de kelder. Keratinocyt differentiatie, EBs waren verbonden IV collageen beklede gerechten typt u. Keratinocyten CBMC-iPSC-afgeleide hadden een geplaveide-achtige morfologie (Figuur 1D). Keratinocyt markeringen Np63 en KRT14 werden uitgedrukt in iPSC-Ks (Figuur 1E, F). Dat resultaat bevestigd dat RA en BMP4 de opregulatie van de Keratinocyt markers geïnduceerde. Bovendien werden CBMC-iPSCs onderscheid gemaakt tussen keratinocyten vergelijkbaar met primaire keratinocyten.

Voor differentiatie van de fibroblast, EBs werden gekoppeld aan kelder membraan matrix beklede platen en de gedifferentieerde cellen werden serieel gepasseerd op noncoated en typ ik collageen beklede platen. Een seriële subcultuur was geïnduceerde fibroblast differentiatie opgeven. Fibroblasten geproduceerd een extracellulaire matrix (ECM) die migratie en hechting functies had. Fibroblasten produceren ook overvloedig collageen onderdelen25. In CBMC-iPSC-afgeleide fibroblasten, werd de fibroblast oppervlakte markering CD44 verhoogd. De expressie van de collageen was upregulated in iPSC-Fs (Figuur 2F). De uitdrukking van de fibronectin en vimentin werd verhoogd in iPSC-Fs(Figuur 2).

Met behulp van de gedifferentieerde keratinocyten en fibroblasten, we genereerden CBMC-iPSC-afgeleide huid organoids (Figuur 3A). We gebruikten een lucht-liquid interface cultuur met een hoog-calcium-medium dat gestratificeerd lagen van CBMC-iPSC-afgeleide huid organoids geïnduceerde. De hoge concentratie van calcium moest Keratinocyt rijping in vivo en in vitro, terwijl de lucht-vloeistof-interface werd gebruikt om meerdere lagen lagen26,27,28. We gebruikten deze methode om na te bootsen van echte huid, en histologische analyse toonde aan dat de huid was gelaagde (Figuur 3C). Om te bevestigen de wond-genezing vermogen, we de iSO in getransplanteerd muizen huid, met behulp van de methode van de stropdas-over dressing (Figuur 3D). Na de transplantatie, de huid organoids efficiënt waren geënt en genezen van de huid van de muizen afdoende. KRT14 kwam tot uitdrukking in de basale laag van stratificatie squamous en nonsquamous epitheel. Loricrin is een hoofdbestanddeel van het stratum corneum gevonden terminaal gedifferentieerd en keratinized epitheliale cellen29,30. De markering van de epidermale differentiatie van loricrin kwam tot uitdrukking in de getransplanteerde huid. De uitdrukking van KRT14 en loricrin bevestigd dat de organoid van de huid volledig volwassen was, en differentiatie werd aangetoond door immunohistochemische kleuring (Figuur 3E).

In deze studie ontwikkelden we een protocol te differentiëren van CBMC-iPSCs in keratinocyten en fibroblasten, de belangrijkste celtypen van menselijke huid. We hebben bevestigd dat de keratinocyten CBMC-iPSC-afgeleide en fibroblasten fenotypen vergelijkbaar met primaire cellijnen toonde. Met behulp van deze gedifferentieerde cellen, wij een 3D huid organoid gegenereerd en het geënt met knik/scid muizen met behulp van de methode stropdas-over dressing. Deze originele techniek werd voor het eerst beschreven in 1929 door Blair en Brown en is vaak gebruikt voor huidtransplantatie31,32. Deze methode verhinderd dat de prothese verplaatsen, een goede hechting op de wond begunstigd, en dus versnelde genezing van weefsel. Histologische analyse bevestigd dat de 3D huid organoid deed een menselijke huid fenotype dat succesvol gelaagde en verviel van meer dan 2 weken. Huidtransplantatie is algemeen uitgevoerd van één cuvetten van keratinocyten en fibroblasten door silicium bubble kamer33,34. Dit systeem is gemakkelijk te enten maar we meer tijd nodig had voor transplantatie efficiëntie waargenomen na graft. De plastic of siliconen kamer fungeert als een barrière tegen de muizen in de huid. De 3D huid organoid systeem-afgeleide iPSCs gebruik geen een plastic of siliconen kamer. In dit systeem was transplantatie efficiënt; het was echter moeilijk te blokkeren van het natuurlijke genezingsproces van muizen. Dus, de muizen van huid gedekt vele delen van de iSO voor een lange tijd na de transplantatie. Dit is een onderdeel van de methode die hier gepresenteerd die moet worden verbeterd.

Kortom, zijn CBMC-iPSCs een potentiële bron van de cel voor huid transplantaties. Met behulp van deze protocollen, CBMC-iPSC-afgeleide keratinocyten, kan fibroblasten en een 3D huid-organoid worden gebruikt in studies met betrekking tot Dermatologie, drug en cosmetic screening en regeneratieve geneeskunde.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door een subsidie van het Korea gezondheidszorg Technology R & D Project, ministerie van volksgezondheid, welzijn en familie zaken, Republiek Korea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics