Generation af 3D hud Organoid fra ledningen blod-afledte induceret pluripotente stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi foreslår en protokol, der viser hvordan du differentiere inducerede pluripotente stamceller-afledt keratinocytter og fibroblaster og generere en 3D hud organoid, ved hjælp af disse keratinocytter og fibroblaster. Denne protokol indeholder en yderligere skridt til at generere en humaniseret mus model. Teknikken præsenteret her vil forbedre dermatologiske forskning.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Huden er kroppens største organ og har mange funktioner. Huden fungerer som en fysisk barriere og protektor af kroppen og regulerer kropsfunktioner. Biomimetik er efterligning af modeller, systemer og elementer i naturen med henblik på at løse komplekse menneskelige problemer1. Huden Biomimetik er et nyttigt værktøj til in vitro-sygdom forskning og in vivo regenerativ medicin. Menneskelige inducerede pluripotente stamceller (iPSCs) har karakteristisk for ubegrænset spredning og differentiering evne til tre Kim lag. Menneskets iPSCs er genereret ud fra forskellige primære celler, såsom blodlegemer, keratinocytter, fibroblaster og meget mere. Blandt dem, ledningen blod mononukleære celler (CBMCs) er dukket op som en alternativ celle kilde fra perspektivet af allogene regenerativ medicin. CBMCs er nyttige i regenerativ medicin, fordi human leukocyt antigen (HLA) at skrive er afgørende for cellen banksystem. Vi leverer en metode for differentiering af CBMC-iPSCs til keratinocytter og fibroblaster og generation af en 3D hud organoid. CBMC-iPSC-afledte keratinocytter og fibroblaster har kendetegn svarende til en primær cellelinie. 3D hud organoids genereres ved at lægge en epidermale lag på en dermal lag. Ved hjælp af transplantation denne 3D hud organoid, genereres en humaniseret mus model. Denne undersøgelse viser, at en 3D menneskelige iPSC-afledte hud organoid kan være en roman, alternative værktøj til dermatologiske research in vitro- og in vivo.

Introduction

Huden dækker den yderste overfladen af kroppen og beskytter indre organer. Huden har forskellige funktioner, herunder beskyttelse mod patogener, absorberende og opbevaring af vand, regulering af kropstemperatur, og udskiller kroppen affald2. Hudtransplantation kan klassificeres afhængig af huden kilde; grafts ved hjælp af huden fra en anden donor kaldes allografts, og grafts ved hjælp af patientens egen hud er autografts. Selv om en autograft er den foretrukne behandling på grund af sin lave afvisning risiko, er hud biopsier svære at udføre på patienter med alvorlige læsioner eller et utilstrækkeligt antal hudceller. Hos patienter med alvorlige forbrændinger er tre gange antallet af hudens celler nødvendige for at dække store områder. De begrænsede mængder af hudceller fra en patient krop resulterer i situationer, hvor allogenous transplantation er nødvendige. En allograft bruges midlertidigt, indtil autolog transplantation kan udføres, da det normalt er afvist af værtens immunsystem efter ca 1 uge3. For at overvinde afvisning af patientens immunsystem, skal grafts komme fra en kilde med de samme immune identitet som den patient4.

Menneskets iPSCs er en spirende kilde af celler for stamcelle terapi5. Menneskets iPSCs er genereret fra somatiske celler, ved hjælp af omprogrammering faktorer såsom OCT4, SOX2, Klf4 og c-Myc6. Ved hjælp af menneskelige iPSCs overvinder de etiske og immunologiske aspekter af embryonale stamceller (økonomiske)7,8. Menneskelige iPSCs har pluripotency og kan differentiere sig til tre Kim lag9. Forekomsten af HLA, en kritisk faktor for regenerativ medicin, bestemmer immunresponset og muligheden for afvisning10. Brugen af patient-afledte iPSCs løser problemerne med celle-kilde begrænsning og immunsystemet afvisning. CBMCs er også dukket op som en alternativ celle kilde for regenerativ medicin11. Obligatorisk HLA maskinskrivning, som opstår under CBMC bank, kan nemt bruges til forskning og transplantation. Yderligere, homozygot HLA-type iPSCs kan bredt anvende til forskellige patienter12. En CBMC-iPSC bank er en roman og effektiv strategi for Celleterapi og allogen regenerativ medicin12,13,14. I denne undersøgelse, vi bruger CBMC-iPSCs, differentierede keratinocytter og fibroblaster, og generere stratificeret 3D hudlag. Resultaterne fra denne undersøgelse tyder på, at en CBMC-iPSC-afledte 3D hud organoid er en roman værktøj til in vitro- og in vivo dermatologiske forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedurer, der involverer dyr blev udført i overensstemmelse med laboratoriet dyr Welfare Act, vejledning i pleje og brugen af forsøgsdyr, og de retningslinjer og politikker for gnaver eksperimenter, som de institutionelle Animal Care og Brug Udvalget (IACUC) af School of Medicine i det katolske universitet i Korea. Undersøgelse-protokollen blev godkendt af det institutionelle Review Board af katolske universitet i Korea (CUMC-2018-0191-01). IACUC og afdeling af laboratoriet dyr (DOLA) af den katolske universitet Korea, Songeui Campus akkrediteret Korea Excellence dyr laboratorium anlægget af Korea Food and Drug Administration i 2017 og erhvervede Association for vurdering og Akkreditering af Laboratory Animal Care International (AAALAC) International fuld akkreditering i 2018.

1. hud Celledifferentiering fra induceret pluripotente stamceller

  1. Medium forberedelse
    Bemærk: Gemme alle medium ved 4 ° C i mørke omgivelser for op til 3 måneder. Filtrere alle medium ved hjælp af et 0,22 μm polyethersulfone filtersystem før brug for sterilisation. Alle medium var til rådighed i en samlet maengde paa 500 mL.
    1. Forberede KDM1 (keratinocytter differentiering mellem 1). Mix Dulbecco ændret Eagle Medium (DMEM) / F12 medium (3:1) med 2% føtal bovint serum (FBS), 0,3 mmol/L L-ascorbinsyre, 5 μg/mL insulin og 24 µg/mL adenin.
    2. Forberede KDM2 (keratinocytter differentiering mellem 2). Mix defineret keratinocytter serumfrit medium (Se Tabel af materialer) med 0,3 mmol/l L-ascorbinsyre, 5 μg/mL insulin og 10 μg/mL adenin.
      Bemærk: Definerede keratinocytter serumfrit medium er optimeret til at understøtte vækst og ekspansion af keratinocytter.
    3. Forberede KDM3 (keratinocytter differentiering mellem 3). Mix defineret keratinocytter serumfrit medium og keratinocytter serumfrit medium (1:1) Se Tabel af materialer for detaljer.
      Bemærk: Keratinocytter serumfrit medium er optimeret til vækst og vedligeholdelse af keratinocytter.
    4. Forberede FDM1 (fibroblast differentiering mellem 1). Mix DMEM/F12 medium (3:1) med 5% FBS, 5 μg/mL insulin, 0.18 mM adenin og 10 ng/mL epidermal vækstfaktor (EGF).
    5. Forberede FDM2 (fibroblast differentiering mellem 2). Mix DMEM/F12 medium (1:1) med 5% FBS og 1% uvæsentlige aminosyrer.
    6. Forberede EP1 (epitelial medium 1). Mix DMEM/F12 (3:1) med 4 mM L-glutamin, 40 μM adenin, 10 μg/mL transferrin, 10 μg/mL insulin og 0,1% FBS.
    7. Forberede EP2 (epitelial medium 2). Bland EP1 og 1,8 mM calciumchlorid.
    8. Forberede EP3 (epitelial medium 3, cornification medium). Mix F12 medium med 4 mM L-glutamin, 40 μM adenin, 10 μg/mL transferrin, 10 μg/mL insulin, 2% FBS, og 1,8 mM calciumchlorid.
  2. Embryonale organ generation
    1. Generere CBMC-iPSCs ved hjælp af den protokol, der er vist i en tidligere undersøgelse12.
    2. Frakke kultur retter, ved hjælp af vitronectin. Forberede 5 mL til at belægge en 100 mm parabol.
      1. Tø og resuspend 50 μL af 0,5 mg/mL vitronectin (endelig koncentration: 5 µg/mL) med 5 mL sterilt fosfatbufferet saltopløsning (PBS). Føje løsningen til opvasken og inkuberes ved stuetemperatur (RT) for 1 h. aspirat belægningsmaterialet før brug (for ikke at udtørre).
    3. Opretholde de CBMC-afledte iPSCs til den vitronectin-belagt 100 mm plade og ændre iPSC medium (E8) dagligt ved 37 ° C med 10% CO2.
    4. Generere embryonale organer (EBs) ved hjælp af den protokol, der er vist i en tidligere undersøgelse15 (beskrevet kort som følger). Udvide iPSCs ved at ændre mediet, indtil cellerne har nået 80% sammenløb. På 80% confluence, fjerne medium og vask med PBS.
    5. Behandling af celler med 1 mL af 1 mM ethylendiamintetra syre (EDTA). Der inkuberes ved 37 ° C med 5% CO2 for 2 min og høste de celler ved hjælp af 3 mL af E8 medium. Der centrifugeres celler ved 250 x g i 2 min.
    6. Opsug supernatanten og anvende 5 mL af E8 medium til cellerne. Tælle celler ved hjælp af en hemocytometer og overføre 1 x 106 celler til en ny 15 mL konisk slange. Der centrifugeres celler ved 250 x g i 2 min.
    7. Resuspend de overførte celler med 2,5 mL af EB dannelse medium med 10 μM Rho-associerede kinase (ROCK) hæmmer. Drop 1 x 104 celler (25 µL/drop) på en noncoated kultur plade låget ved hjælp af en 10-100 μl multikanalpipette. Form 100 EBs fra 1 x 106 celler (1 x 104 celler/1 EB). Vend skålen og hænge på slipværktøjet til låget.
      Bemærk: ROCK inhibitor er nødvendig under trinnet udlæg i forbindelse med vedligeholdelse og differentiering. Tilføje ROCK-hæmmer kun på stadiet EB sammenlægning.
    8. Inkuber dråber ved 37 ° C med 5% CO2 i 1 dag.
    9. Den næste dag, høste 100 EBs og bruge dem til differentiering. Udviske låget på plade med iPSC medium (E8 medium) eller PBS og høste dens indhold til en 50 mL konisk slange. Vedligeholde EBs på RT for 1 min til at udligne dem. Opsug supernatanten, resuspend EBs med E8 medium og fastholde dem i en 90 mm petriskål indtil differentieringen.
  3. Differentiering af CBMC-iPSCs af keratinocytter
    Bemærk: En ordning af keratinocytter differentiering fra CBMC-iPSCs, se figur 1A.
    1. Høst af 100 EBs til en 50 mL konisk slange med iPSC medium eller PBS. Vedligehold på RT for 1 min til at slå sig ned i EBs. Sørg for, de slår sig ned i bunden af den koniske rør. Opsug supernatanten og resuspend EBs med E8 medium med 1 ng/mL ben morfogenetiske proteiner 4 (BMP4). Overføre EBs til en 90 mm petriskål og vedligeholde dem ved 37 ° C med 5% CO2 i 1 dag.
    2. Coat kultur retter, ved hjælp af type IV-kollagen. Forberede 5 mL af type IV kollagen til at belægge en 100 mm parabol.
      1. Tø og resuspend type IV kollagen løsning (endelig koncentration: 50 µg/mL) med 0,05 N HCl. tilføje løsningen til opvasken og inkuberes ved RT i 1 h. Aspirér belægningsmaterialet før brug (for ikke at udtørre).
        Bemærk: Før du bruger pladerne, vaske op 3 x med PBS til at fjerne enhver syre.
    3. Høste EBs (trin 1.3.1) til en 50 mL konisk slange og vedligeholde dem på RT for 1 min til at udligne dem. Kontroller de bosætte sig i bunden af den koniske rør, Aspirér supernatanten og resuspend EBs i 6 mL af KDM1 med 10 µM ROCK inhibitor. Overføre EBs til type IV kollagen-belagt 100 mm parabol.
      Bemærk: Tilføje ROCK-hæmmer kun på stadiet EB vedhæftet fil.
    4. Mellem dage 0 – 8, ændre medium hver anden dag til KDM1 med 3 µM retinoid syre (RA) og 25 ng/mL hver BMP4 og EGF. Vedligeholde EBs ved 37 ° C med 5% CO2.
    5. Mellem dage 9-12, ændre mediet hver anden dag til KDM2 med 3 µM RA, 25 ng/mL BMP4 og 20 ng/mL EGF.
    6. Mellem dage 13-30, ændre mediet hver anden dag til KDM3 med 10 ng/mL BMP4 og 20 ng/mL EGF.
  4. Differentiering af CBMC-iPSC fibroblaster
    Bemærk: En ordning af fibroblast differentiering fra CBMC-iPSCs, se figur 2A.
    1. Frakke kultur retter, ved hjælp af basalmembranen matrix. Forberede 5 mL til at belægge en 100 mm parabol.
      1. Tø basalmembranen matrix (endelig koncentration: 600 ng/mL) og fortyndes det med DMEM/F12 medium. Føje løsningen til opvasken og inkuberes ved 37 ° C i 30 min. aspirat belægningsmaterialet før brug (for ikke at udtørre).
    2. Høst af 100 EBs til en 50 mL konisk slange med en pipette med iPSC medium eller PBS. Vedligehold på RT for 1 min til at slå sig ned i EBs. Sikre, at de slår sig ned i bunden af den koniske rør. Fjern supernatanten.
    3. Resuspend EBs ved hjælp af en 1.000 µL pipette i 6 mL af FDM1 med 10 µM ROCK inhibitor. Overføre EBs (med medium) til en basalmembran matrix-belagt 100 mm parabol og inkuberes ved 37 ° C med 5% CO2. Opdater FDM1 hver anden dag for 3 dage.
      Bemærk: Kun tilføje ROCK-hæmmer på stadiet EB vedhæftet fil.
    4. Tilføje 0,5 nM ben morfogenetiske proteiner 4 (BMP 4) til FDM1 mellem dage 4 og 6.
    5. På dag 7, ændre mediet til FDM2 hver anden dag i 1 uge.
    6. På dag 14, tilsættes 1 mL af 1 mM EDTA og inkuberes ved 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL af FDM2 og centrifugeres ved 250 x g for 2 min. Fjern supernatanten og resuspend celler i 5 mL af FDM1.
    7. Tælle celler ved hjælp af en hemocytometer, resuspend 2 x 106 celler med FDM1 medium, og overføre cellerne til noncoated fadet. Vedligeholde celler ved 37 ° C med 5% CO2 og ændre mediet hver anden dag.
    8. Frakke kultur retter, ved hjælp af type I-kollagen. Forberede 5 mL til at belægge en 100 mm parabol. Fortyndes type I-kollagen løsning (endelig koncentration: 50 µg/mL) i 0,02 N eddikesyre. Føje løsningen til opvasken og inkuberes ved RT i 1 h. aspirat belægningsmaterialet før brug (for ikke at udtørre).
      Bemærk: Før du bruger pladerne, vaske op 3 x med PBS til at fjerne syren.
    9. Dag 21, tilsættes 1 mL af 1 mM EDTA og inkuberes ved 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL af FDM1 og centrifugeres ved 250 x g for 2 min. Fjern supernatanten og resuspend celler i 5 mL af FDM1. Tælle celler ved hjælp af en hemocytometer og overførsel 2 x 106 celler til typen jeg kollagen-belagt 100 mm fad med FDM1 medium. Vedligeholde celler ved 37 ° C med 5% CO2 og ændre mediet hver anden dag.
    10. Dag 28, tilsættes 1 mL af 1 mM EDTA og inkuberes ved 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL af FDM1 og centrifugeres ved 250 x g for 2 min. Fjern supernatanten og resuspend celler i 5 mL af FDM1. Tælle celler ved hjælp af en hemocytometer og overføre 2 x 106 celler til et noncoated fad med FDM1 medium. Vedligeholde celle ved 37 ° C med 5% CO2 og ændre mediet hver anden dag.
      Bemærk: iPSC-afledte fibroblaster formere sig som en primær fibroblast cellelinie og passage op til 10 passager. I denne undersøgelse brugte vi iPSC-afledte fibroblaster af to til fem passager for yderligere analyse.

2. anvendelse af hiPSC-afledte differentierede celler

  1. Generation af 3D huden organoid
    1. Forberede neutraliseret type jeg kollagen på is, efter fabrikantens anvisninger. Som endelige koncentration, bruge 3 mg/mL for type I-kollagen (type I-lager koncentration af kollagen er 3,47 mg/mL), og sørg for, at det endelige rumfang af blandingen er 5 mL. Beregning af volumen 10 x PBS (endelige mængden/10 = 0,5 mL). Beregne omfanget af type I-kollagen til at blive brugt (endelige rumfang x endelige kollagen koncentration / lager kollagen koncentrationen = 5 mL x 3 mg / mL / 3,47 mg / mL = 4.32 mL). Beregning af volumen af 1 N NaOH (mængden af kollagen anvendes x 0,023 mL = 0,1 mL). Beregning af volumen af dH2O (endelige rumfang - mængden af kollagen - volumen på 10 x PBS - bind 1 N NaOH = 5 mL - 4.32 mL-0,5 mL-0,1 mL = 0,08 mL). Bland indholdet af røret og holde den på køl indtil klar til brug.
    2. Der tilsættes 1 mL af EDTA til iPSC-afledte fibroblaster fra trin 1.4.10 og inkuberes ved 37 ° C med 5% CO2 for 2 min. høste de fritliggende celler, tælle celler ved hjælp af en hemocytometer og overføre 2 x 105 celler til en ny 15 mL konisk slange. Der centrifugeres ved 250 x g for 2 min og Fjern supernatanten. Resuspend celler af de iPSC-afledte fibroblaster i 1,5 mL af FDM1 og neutraliseret typen jeg kollagen løsning (1:1).
      Bemærk: Bland løsning forsigtigt for at undgå boblerne.
    3. Placere membran Indsæt på en 6-godt mikrotiterplade, Overfør blandingen til skæret og inkuberes ved RT i 30 min.
      Bemærk: Flyt ikke pladerne.
    4. Efter at have bekræftet gellation, tilsættes 2 mL af medium til toppen af Indsæt og 3 mL til bunden af brønden. Inkuber matrix af fibroblaster og kollagen ved 37 ° C med 5% CO2 i 5-7 dage, indtil gellation er komplet og længere kontrakter.
    5. Efter den komplette gellation, frigøre den iPSC-afledte keratinocytter (fra trin 1.3.6) ved hjælp af EDTA. Der tilsættes 1 mL af EDTA og inkuberes ved 37 ° C med 5% CO2 for 2 min. høste de fritliggende celler, tælle dem ved hjælp af en hemocytometer og overføre 1 x 106 celler til en ny 15 mL konisk slange. Der centrifugeres ved 250 x g i 2 min.
    6. Fjern supernatanten og resuspend 1 x 106 celler i 50-100 µL af lavt calcium epitelial medium 1 (EP1).
    7. Opsug alle medium i matrixen (Se trin 2.1.5) og frø 1 x 106 celler af de iPSC-afledte keratinocytter på hver fibroblast lag. Inkuber plade ved 37 ° C med 5% CO2 i 30 min.
      Bemærk: Flyt ikke pladen og tilføjer ikke noget medie til fastgørelse af keratinocytter.
    8. Tilsættes 2 mL EP1 til toppen af indsatsen og 3 mL af EP1 til bunden af brønden.
    9. Efter 2 dage, Aspirér alle medium i membranen Indsæt plade og ændre medium til normal calcium EP2 for 2 dage.
    10. Efter 2 dage, Aspirér alle medium og tilsættes 3 mL cornification medium kun til bunden for at generere en luft-flydende interface.
    11. Vedligeholde 3D hud organoid i op til 14 dage ved 37 ° C med 5% CO2 og ændre mediet hver anden dag. Høste 3D hud organoid ved at skære kanten af indsatsen, og bruge det til en yderligere undersøgelse af farvning og huden graft.
  2. Skin graft
    1. Udføre inhalation anæstesi på NOD/scid mus (mandlige, 6 uger gamle), ved hjælp af en standard, institutionelt godkendte metode. Skin graft, barbere pels af hver mus dorsale huden.
    2. Fjerne en 1 cm x 2 cm sektion af musens hud, bruger buet saks med pincet.
    3. Placer CBMC-iPSC-afledte 3D hud organoid på defektstedets og sutur med en tie-over dressing metode med silke suturer.
    4. Observere musene i 2 uger og ofrer dem for histologiske analyse. Farvnings-protokollen blev bekræftet i tidligere undersøgelser16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Huden består for det meste af epidermis og dermis. Keratinocytter er den største celletype af epidermis, og fibroblaster er den største celletype af dermis. Ordningen af keratinocytter differentiering er vist i figur 1A. CBMC-iPCSc blev opretholdt i en vitronectin-belagte fad (figur 1B). I denne undersøgelse opdelte vi CBMC-iPSCs til keratinocytter og fibroblaster ved hjælp af EB dannelse. Vi genereret EBs ved hjælp af hængende drop metode til at sikre en ensartet og kontrolleret differentiering af keratinocytter og fibroblaster (figur 1C). EBs var vedhæftet type IV kollagen-belagte plader for keratinocyt differentiering, og mediet blev ændret dagligt. CBMC-iPSCs blev behandlet med RA, BMP4 og EGF. CBMC-iPSCs blev differentieret til keratinocytter. Under differentieringen, morfologi af den CBMC-iPSC-afledte keratinocytter ændres over tid (tillægs figur 1).

CBMC-iPSC-afledte keratinocytter har morfologier svarende til primære keratinocytter (fig. 1D). Genekspression af de pluripotente markør OCT4 var downregulated i CBMC-iPSC-afledte keratinocytter. Primer sekvenser er vist i tabel 1. Udtryk af keratinocytter markører Np63, KRT5, og KRT14 blev øget i CBMC-iPSC-afledte keratinocytter (figur 1F). CBMC-iPSC-afledte keratinocytter blev bekræftet af udtryk af Np63 og KRT14 af Immunhistokemi (figur 1E). Disse resultater bekræftede, at CBMC-iPSC-afledte keratinocytter har karakter af primær keratinocytter.

Ordningen af fibroblast differentiering er vist i figur 2A. Vi også fastholdt CBMC-iPSCs i en vitronectin-belagte fad og brugt EB dannelse fibroblast differentiering (figur 2B, C). Vi vedlagt EBs basalmembranen matrix-belagte plader og ændret medium hver anden dag. Udvækst celler blev overført til noncoated og skriv jeg kollagen-belagte plader. CBMC-iPSCs blev differentieret til fibroblaster. Under differentieringen, morfologi af de CBMC-iPSC-afledte fibroblaster ændres over tid (tillægs figur 2).

CBMC-iPSC-afledte fibroblaster har morfologier svarende til primære fibroblaster (figur 2D). Udtryk af pluripotente stamceller markør OCT4 var downregulated i CBMC-iPSC-afledte fibroblaster. Fibroblast markører for COL1A1, COL1A2, COL3A1 og CD44 var upregulated i CBMC-iPSC-afledte fibroblaster (figur 2F). Primer sekvenser er vist i tabel 1. Også, CBMC-iPSC-afledte fibroblaster blev bekræftet af udtryk for vimentin, fibronektin af Immunhistokemi (figur 2E). Disse resultater tyder på, at CBMC-iPSC-afledte fibroblaster er magen til primære fibroblaster.

Vi genereret en 3D hud organoid ved hjælp af CBMC-iPSC-afledte keratinocytter og fibroblaster. Ordningen for dannelsen af 3D hud organoid er vist i fig. 3A. Vi genereret en 3D hud organoid på en membran Indsæt pladen. For den 3D kultur, CBMC-iPSC-afledte fibroblaster blev stratificeret med type kollagen og belagt med CBMC-iPSC-afledte keratinocytter. Efter såning CBMC-iPSC-afledte keratinocytter, blev mediet ændret til en normal calcium koncentrationen i 2 dage. Efter 2 dage, blev et højt calcium koncentration medium tilføjet kun til den nedre kammer for dannelsen af luft-flydende interface kultur. Air-liquid Interfacekulturens induceret modning og stratificering af keratinocytter. Tykkelsen af 3D hud organoid blev øget i løbet af 3D kultur. Disse resultater bekræftes, at 3D hud organoid blev genereret fra iPSC-afledte keratinocytter og fibroblaster af hæmatoxylin og eosin (H & E) farvning (figur 3C).

Bruger CBMC-iPSC-afledte 3D hud organoid, genereret vi en humaniseret mus model (figur 3B) ved podning 3D hud organoid til mus. En 1 cm x 2 cm defekt blev induceret, og slips-over-metode blev brugt til transplantation. Efter 2 uger, den transplanterede hud var effektivt podet til mus, og vi bekræftede dette ved H & E og andre analyse (figur 3D). Keratinocytter modning og epidermal differentiering markører for loricrin og KRT14 var udtrykt i CBMC-iPSC-afledte 3D hud organoids (figur 3E). CBMC-iPSC-afledte 3D hud organoids blev funktionelt differentieret, podet effektivt på mus og effektivt helbredt mus overfladefejl.

Figure 1
Figur 1 : Keratinocytter differentiering af CBMC-iPSCs. (A) ordningen af keratinocytter differentiering fra CBMC-iPSCs. (B og C) morfologi af CBMC-iPSCs (panel B) og iPSC-afledte EBs (panel C). (D) morfologi af den CBMC-iPSC-afledte keratinocytter. (E) andre analyse af Np63 (rød) og KRT14 (grøn), sammen med DAPI farvning (blå). Skala barer = 100 μm. (F) genekspression af pluripotente markør og keratinocytter markører for iPSC-afledte keratinocytter (iPSC-Ks). Graferne viser gennemsnitlige med SEM fem uafhængige prøver. Forskelle mellem grupper blev undersøgt for Statistisk signifikans ved hjælp af Student's t-test. T-test blev anvendt til at analysere ikke-parametrisk kvantitative datasæt, og den en-sidede p-værdi blev beregnet (*p < 0,05, **p < 0,01, ***p < 0,001 viste Statistisk signifikans). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Fibroblast differentiering af CBMC-iPSCs. (A) ordningen af fibroblast differentiering fra CBMC-iPSCs. (B og C) morfologi af CBMC-iPSCs (panel B) og iPSC-afledte EBs (panel C). (D) morfologi af de CBMC-iPSC-afledte fibroblaster. (E) andre analyse af vimentin (rød) og fibronektin (rød), sammen med DAPI farvning (blå). Skala barer = 100 μm. (F) genekspression af pluripotente markør og fibroblast markører for iPSC-afledte fibroblast (iPSC-Fs). Graferne viser gennemsnitlige med SEM fem uafhængige prøver. Forskelle mellem grupper blev undersøgt for Statistisk signifikans ved hjælp af Student's t-test. T-test blev anvendt til at analysere ikke-parametrisk kvantitative datasæt, og den en-sidede p-værdi blev beregnet (*p < 0,05, **p < 0,01, ***p < 0,001 viste Statistisk signifikans). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Generation af CBMC-iPSC-afledte huden organoid og humaniseret mus model. (A) skematisk diagram over iPSC-afledte hud organoid (iSO) generation proces. (B) Transplantation proces af iSO ind i musene. (C) histologiske analyse af in vitro-iSO. (D) histologiske analyse af den transplanterede iSO in vivo. (E-H) Andre analyse af loricrin og KRT14. MOCK kontrol (panel E), transplanterede iSO (panel F, loricrin), mus hud (negativ kontrol, bedømmelseskomite G), transplanterede iSO (panel H, KRT14). Skala barer = 200 μm. Venligst klik her for at se en større version af dette tal.

Supplementary Figure 1
Tillægs figur 1: morfologi af iPSC-afledte keratinocytter. Venligst klik her for at se en større version af dette tal.

Supplementary Figure 2
Tillægs figur 2: morfologi af iPSC-afledte fibroblaster. Venligst klik her for at se en større version af dette tal.

Destinationsnavnet Retning Primer sekvens (5' - 3') Størrelse (basepar) Refseq_ID
OCT4 Fremad
Omvendt
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Fremad
Omvendt
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Fremad
Omvendt
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Fremad
Omvendt
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Fremad
Omvendt
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Fremad
Omvendt
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Fremad
Omvendt
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Fremad
Omvendt
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Fremad
Omvendt
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Fremad
Omvendt
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin Fremad
Omvendt
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Fremad
Omvendt
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabel 1: Sekvenser af primere bruges til kvantitative real-time polymerase kæde reaktion.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Menneskets iPSCs er blevet foreslået som et nyt alternativ til personlig regenerativ medicin17. Patient-afledte personlig iPSCs afspejle patient karakteristika, der kan anvendes til sygdom modellering, stof screening og autolog transplantation18,19. Brugen af patient-afledte iPSCs kan også overvinde problemer vedrørende primærelementer, mangel på passende celle numre og immun reaktioner5,17,19. Generation af personlige iPSCs er imidlertid ikke økonomisk muligt tid, omkostninger og arbejdskraft restriktioner. HLA-homozygote CBMC-afledte iPSCs er dukket op som en ny mulighed. HLA-homozygote iPSCs kan være økonomisk værdifulde og kan anvendes på et stort antal patienter8,11,12,13. Derudover opstår HLA typning af CBMCs under bank cellelagring, hvilket gør dem nemme at bruge til forskning og transplantation. Protokoller til at differentiere CBMC-iPSCs i cardiomyocytes, hepatocytter og chondrocytter har været rapporteret16,20,21,22,23.

Epidermal og dermale lag er komponenter af huden. Epidermis består af keratinocytter og dermis består af fibroblaster. Så opdelte vi CBMC-iPSCs til keratinocytter og fibroblaster, henholdsvis. For differentiering, uniformerede, velkontrollerede og optimeret EBs blev genereret af hængende drop metode15,24. Type IV kollagen er en vigtig del af basalmembranen. Keratinocytter differentiering, blev EBs vedhæftet en type IV kollagen-belagt retter. CBMC-iPSC-afledte keratinocytter havde en brosten-lignende morfologi (fig. 1D). Keratinocytter markører Np63 og KRT14 var udtrykt i iPSC-Ks (figur 1E, F). Dette resultat bekræftet, at RA og BMP4 induceret opregulering af keratinocytter markører. Endvidere blev CBMC-iPSCs differentieret til keratinocytter svarende til primære keratinocytter.

Fibroblast differentiering, EBs blev knyttet til basalmembranen matrix-belagte plader, og de differentierede celler blev seriefremstillede passaged ind på noncoated og skriv jeg kollagen-belagte plader. En seriel subkultur blev tilskyndet til at angive fibroblast differentiering. Fibroblaster producerede en ekstracellulære matrix (ECM), der havde migration og vedhæftning funktioner. Fibroblaster også producere rigelige kollagen komponenter25. I CBMC-iPSC-afledte fibroblaster, blev fibroblast overflade markør CD44 øget. Udtryk for kollagen var upregulated i iPSC-Fs (figur 2F). Udtryk for fibronektin og vimentin blev øget i iPSC-Fs (figur 2E).

Ved hjælp af differentierede keratinocytter og fibroblaster, genereret vi CBMC-iPSC-afledte hud organoids (fig. 3A). Vi brugte en air-liquid Interfacekulturens med en high-calcium medium, som inducerede stratificeret lag af CBMC-iPSC-afledte hud organoids. Den høje koncentration af calcium var nødvendigt for keratinocytter modning in vivo og in vitro, mens air-liquid interface blev brugt til at udvikle flerlaget strata26,27,28. Vi brugte denne metode til at efterligne ægte hud og histologiske analyse viste, at huden blev stratificeret (figur 3C). For at bekræfte mulighed for sårheling, transplanterede vi iSO ind i musene hud, ved hjælp af metoden slips-over dressing (figur 3D). Efter transplantation, hud organoids var effektivt podet og helbredt mus huden tilstrækkeligt. KRT14 kom til udtryk i den basale lag af stratifying planocellulære og nonsquamous epitheler. Loricrin er en hovedbestanddel af stratum corneum fundet i terminalt differentieret og keratiniseret epitelceller29,30. Epidermal differentiering markør af loricrin var udtrykt i transplanterede hud. Udtryk for KRT14 og loricrin bekræftet at huden organoid var fuldt modne og differentiering blev demonstreret ved immunhistokemisk farvning (figur 3E).

I denne undersøgelse udviklede vi en protokol til at differentiere CBMC-iPSCs i keratinocytter og fibroblaster, de vigtigste celletyper af menneskelige hud. Vi bekræftede, at CBMC-iPSC-afledte keratinocytter og fibroblaster viste fænotyper svarende til primær cellelinjer. Med disse differentierede celler, vi genereret en 3D huden organoid og podede det i NOD/scid mus ved hjælp af metoden slips-over dressing. Denne oprindelige teknik blev første gang beskrevet i 1929 af Blair og Brown og har været almindeligt brugt i hudtransplantation31,32. Denne metode forhindret graften i bevægelse, foretrak en god vedhæftning på såret og dermed accelereret væv healing. Histologiske analyse bekræftet, at 3D hud organoid efterlignede en menneskelige hud fænotype, der med held stratificeret og modnet over 2 uger. Hudtransplantation udføres normalt ved hjælp af enkelt celler af keratinocytter og fibroblaster af silicium boble kammer33,34. Dette system er let at pode men vi behøvede mere tid for observeret at transplantation effektivitet efter graft. Plast eller silicium salen fungerer som en barriere mod de mus hud. 3D hud organoid system-afledte iPSCs bruge ikke en plastik eller silicium kammer. I dette system var transplantation effektiv; men det var svært at blokere den naturlige helingsproces af mus. Så, at musene hud omfattet mange dele af iSO i lang tid efter transplantation. Dette er en del af den metode, der præsenteres her, skal forbedres.

Afslutningsvis, er CBMC-iPSCs en potentiel kilde til celle for hudtransplantation. Ved hjælp af disse protokoller, CBMC-iPSC-afledte keratinocytter, kan fibroblaster, og en 3D hud organoid bruges i undersøgelser vedrørende dermatologi, drug og kosmetiske screening og regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af en bevilling fra Korea Healthcare Technology R & D-projektet, Ministeriet for sundhed, velfærd og familiespørgsmål, Republikken Korea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics