डीएनए methylated immunoprecipitation

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस वीडियो डीएनए methylated immunoprecipitation (MeDIP) के लिए प्रोटोकॉल को दर्शाता है. MeDIP एक दो दिन की प्रक्रिया है कि चुनिंदा एक जीनोमिक डीएनए नमूने से डीएनए methylated टुकड़े अर्क विशिष्टता के साथ 5 मिथाइलसिटोसाइन के लिए एंटीबॉडी का उपयोग (MC विरोधी 5) है.

Cite this Article

Copy Citation | Download Citations

Thu, K. L., Vucic, E. A., Kennett, J. Y., Heryet, C., Brown, C. J., Lam, W. L., Wilson, I. M. Methylated DNA Immunoprecipitation. J. Vis. Exp. (23), e935, doi:10.3791/935 (2009).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

डीएनए निष्कर्षण और नमूना तैयारी

MeDIP के विभिन्न नमूनों की एक किस्म (संवर्धित कोशिकाओं, के रूप में formalin निर्धारित पैराफिन एम्बेडेड ऊतकों के रूप में अच्छी तरह से ताजा जमे हुए) से डीएनए के लिए इस्तेमाल किया जा सकता है. यह महत्वपूर्ण है histones के रूप में जुड़े प्रोटीन के बिना उच्च शुद्ध डीएनए का उपयोग करने के लिए. नमूना से जितना संभव हो उतना शाही सेना है, दूर के रूप में यह दोनों डीएनए quantitation और एंटीबॉडी बंधनकारी के साथ हस्तक्षेप कर सकते हैं यह भी महत्वपूर्ण है. MeDIP के लिए इस्तेमाल किया डीएनए की मात्रा 200 एनजी से 1 μg उपलब्ध डीएनए की मात्रा पर निर्भर करता है रेंज कर सकते हैं. इस प्रोटोकॉल को प्रदर्शित करने के लिए, डीएनए के एक μg इस्तेमाल किया जाएगा. निम्नलिखित प्रोटोकॉल संवर्धित कोशिकाओं से उच्च गुणवत्ता डबल असहाय डीएनए प्रदान करेगा. अन्य प्रोटोकॉल के अन्य प्रकार नमूना से डीएनए के निष्कर्षण के लिए नियोजित किया जाना चाहिए.

  1. एक 1.7 मिलीलीटर Eppendorf ट्यूब में एक सेल गोली पाचन बफर के 400 μl जोड़ें.
  2. ट्यूब proteinase कश्मीर के 100 μg जोड़ें, और 50 पर रातोंरात सेते डिग्री सेल्सियस
  3. 500 μl phenol 7 पीएच जोड़ें और inverting द्वारा धीरे लेकिन मिश्रण अच्छी तरह से.
  4. कमरे के तापमान पर 10 मिनट के लिए 13 000 जी में स्पिन.
  5. एक नया ट्यूब पर जलीय अंश (ऊपर) निकालें.
  6. दोहराएँ 3 5 के माध्यम से एक बार कदम है.
  7. 500 μl 01:01 phenol / क्लोरोफॉर्म 7 पीएच जोड़ें और inverting द्वारा धीरे लेकिन मिश्रण अच्छी तरह से.
  8. कमरे के तापमान पर 10 मिनट के लिए 13 000 जी में स्पिन.
  9. एक नया ट्यूब पर जलीय अंश (ऊपर) निकालें.
  10. RNase ए के 40 μg जोड़ें और 37 से कम 1 घंटा सेते डिग्री सेल्सियस
  11. 500 μl phenol 7 पीएच जोड़ें और inverting द्वारा धीरे लेकिन मिश्रण अच्छी तरह से.
  12. कमरे के तापमान पर 10 मिनट के लिए 13 000 जी में स्पिन.
  13. एक नया ट्यूब पर जलीय अंश (ऊपर) निकालें.
  14. दोहराएँ 11 13 के माध्यम से एक बार कदम है.
  15. 500 μl 01:01 phenol / क्लोरोफॉर्म 7 पीएच जोड़ें और inverting द्वारा धीरे लेकिन मिश्रण अच्छी तरह से.
  16. कमरे के तापमान पर 10 मिनट के लिए 13 000 जी में स्पिन.
  17. एक नया ट्यूब पर जलीय अंश (ऊपर) निकालें.
  18. 1/10th मात्रा 3 एम सोडियम एसीटेट (40 μl) जोड़ें और मिश्रण अच्छी तरह से.
  19. 100% इथेनॉल 2 मात्रा (900 μl) जोड़ें, मिश्रण अच्छी तरह से, और जगह -20 डिग्री सेल्सियस पर 20 मिनट के लिए.
  20. 4 में 20 मिनट के लिए 13 000 जी में स्पिन डिग्री सेल्सियस
  21. इथेनॉल निकालें, नाड़ी स्पिन, और अवशिष्ट इथेनॉल हटायें.
  22. 500 μl ठंड 70% इथेनॉल धोने जोड़ें. 4 में 20 मिनट के लिए 13 000 जी में स्पिन डिग्री सेल्सियस
  23. 70% इथेनॉल निकालें, नाड़ी, स्पिन और pipetting द्वारा अवशिष्ट इथेनॉल हटायें.
  24. एयर कमरे के तापमान पर 10 मिनट के लिए अवशिष्ट इथेनॉल के सभी निशान हटाने के लिए खुला टोपी के साथ गोली सूखी.
  25. निष्फल रातोंरात dH2O के 50 μl में 4 पर Resuspend डीएनए डिग्री सेल्सियस
  26. यों डीएनए एक NanoDrop स्पेक्ट्रोफोटोमीटर का उपयोग कर. एक 260 एक: 1.8 के अनुपात 280 आदर्श है.
  27. 100 बीपी सीढ़ी के साथ डीएनए और एक agarose जेल पर आकार सीमा की गुणवत्ता का निर्धारण करते हैं. जीनोमिक डीएनए के रूप में छोटा रूप में 10 एनजी 1.7% agarose जेल पर चला जा सकता है कि अत्यधिक SYBR गोल्ड जैसे डीएनए के छोटे मात्रा के प्रति संवेदनशील है एक डाई का उपयोग धुंधला द्वारा पीछा किया.
  28. एक नमूना प्रति siliconized ट्यूब में 50 μl की कुल मात्रा में मात्रा के शेष के साथ डीएनए के 1 μg निष्फल DH 2 ओ के साथ बनाया तैयार

डीएनए SONICATION

गैर प्रोटीन की विशिष्ट ट्यूब दीवारों के लिए बाध्य को रोकने के डीएनए sonication और MeDIP प्रोटोकॉल siliconzied ट्यूबों में प्रदर्शन किया जाना चाहिए. डीएनए नमूने के लिए इष्टतम sonication बार जेल वैद्युतकणसंचलन (27 चरण) से निर्धारित के रूप में डीएनए का नमूना विखंडन की डिग्री पर आधारित हैं. उदाहरण के लिए, संवर्धित कोशिकाओं से निकाले डीएनए बहुत उच्च आणविक भार है, और चाहिए बाद में अभिलेखीय नमूने जो अक्सर आंशिक रूप से अपमानित कर रहे हैं से निकाली डीएनए की तुलना में अधिक sonication की आवश्यकता होगी. यदि नमूने समान उच्च आण्विक भार के हैं, यह इस बिंदु पर के रूप में व्यक्तिगत प्रत्येक नमूने की जाँच के बिना इस प्रोटोकॉल में वर्णित sonication के साथ आगे बढ़ना करने के लिए उचित है. यदि नमूने अभिलेखीय नमूनों के साथ के रूप में खंडित कर रहे हैं, यह sonication संभावना प्रक्रिया sonication बार कम 300 100bp टुकड़े प्राप्त करने के द्वारा अनुकूलन के लिए आवश्यक हो जाएगा. यदि आप नमूने है कि आंशिक रूप से अपमानित sonication मानकों के अनुकूलन, ब्याज की उन से एक प्रतिनिधि नमूने पर प्रदर्शन किया जा सकता है है संसाधित करने के लिए उम्मीद है. डीएनए जेल वैद्युतकणसंचलन (27 चरण) से मनाया विखंडन की डिग्री के आधार पर, experimenter नमूना के लिए इष्टतम sonication समय पहले से फ़ैसला कर सकते हैं. यहाँ हम एक sonication द्वारा एक स्वचालित sonicating डिवाइस (Diagenode से Bioruptor, UCD-200 टीएम) उच्च आणविक भार डीएनए का उपयोग के साथ 300-1000 बीपी डीएनए टुकड़े प्राप्त विधि का वर्णन.

  1. Biorupter में पानी 4 बजे होना चाहिए डिग्री सेल्सियस
  2. स्वत: सेटिंग्स पर 7 मिनट (30 सेकंड 30 सेकंड अधिकतम शक्ति पर उतर) के लिए Sonicate.
  3. Sonicated और siliconized immunoprecipitation (आईपी) की प्रतिक्रिया के लिए 1.7 मिलीलीटर अपकेंद्रित्र ट्यूब में उत्पाद की जगह (40 μl) के 800 एनजी निकालें.
  4. शेष 200 एनजी (μl 10) करने के लिए इनपुट के रूप में में सेवा (IN) संदर्भ (4 बजे दुकान ° सी) डीएनए अलग निर्धारित करें.

    Methylated डीएनए के IMMUNOPRECIPITATON

    1. डीएनए कि आईपी रिएक्शन (800 एनजी) के लिए 95 ° C पर एक पानी के स्नान में 10 मिनट के लिए इस्तेमाल किया जाएगा denature.
    2. बर्फ पर तुरंत कूल. डीएनए शांत अगले कदम के साथ आगे बढ़ने से पहले पूरी तरह से (बर्फ पर लगभग 5 मिनट) चलो.
    3. 5 μg मोनोक्लोनल एंटीबॉडी जोड़ें.
    4. आईपी ​​बफर (इस प्रोटोकॉल भर में कमरे के तापमान पर इस्तेमाल किया) 500 μl के अंतिम मात्रा करने के लिए जोड़ें.
    5. ट्यूब धारक घूर्णन में 4 में 2 बजे ° सी के लिए सेते हैं.
    6. बस के पहले चरण 5 पूरा हो गया है, वाशिंग (6-11 चरण) द्वारा Dynabeads तैयार. सबसे पहले, मोती vortexing द्वारा शीशी में अच्छी तरह से resuspend.
    7. प्रतिक्रिया प्लस 1 प्रति resuspended Dynabeads के 30 μl (2 ~ 7 x 10) एक नई siliconized ट्यूब (उदाहरण के लिए, 8 प्रतिक्रियाओं कर अगर, 9, यानी 270 μl के लिए पर्याप्त मोती निकालने) में, स्थानांतरण.
    8. ट्यूब 2 मिनट के लिए कमरे के तापमान पर चुंबकीय रैक पर रखें.
    9. सतह पर तैरनेवाला पिपेट. जब सतह पर तैरनेवाला हटाने, पिपेट टिप के साथ अंदर दीवार (जहां मोती चुंबक को आकर्षित करने के लिए) के खिलाफ मनकों को छू से बचने.
    10. चुंबक से ट्यूब निकालें, और आईपी बफर की एक अतिरिक्त मात्रा (750 μl μl-1000) में मोती resuspend. 2 मिनट के लिए कमरे के तापमान पर चुंबकीय रैक पर वापस ट्यूब रखें.
    11. धोने अधिक एक बार दोहराएँ, और तब मूल चरण 7 में हटा मात्रा में आईपी बफर में धोया मोती resuspend.
    12. प्रत्येक IP प्रतिक्रिया धोया Dynabeads के 30 μl जोड़ें
    13. 4 में 2 बजे के लिए एक rotating ट्यूब धारक में सेते डिग्री सेल्सियस
    14. ऊष्मायन के बाद पूरा हो गया है, चुंबकीय रैक पर कमरे के तापमान पर 2 मिनट के लिए ट्यूब की जगह.
    15. सतह पर तैरनेवाला पिपेट. विंदुक टिप के साथ ट्यूब के अंदर दीवार (जहां मोती चुंबक को आकर्षित करने के लिए) को छूने से बचें. आईपी ​​बफर के 500 μl जोड़ें. ट्यूब सामग्री मिलाई और यह 2 मिनट के लिए चुंबकीय रैक पर वापस रख दिया. 500 उल आईपी बफर एक समय के साथ धोने दोहराएँ.
    16. पिछले धोने से सतह पर तैरनेवाला हटाने के बाद, पाचन बफर के 400 μl में मोती resuspend.
    17. Proteinase कश्मीर के 100 μg के साथ प्रतिक्रिया समझो और 50 पर रातोंरात सेते डिग्री सेल्सियस

    IMMUNOPRECIPITATED डीएनए की शुद्धि

    1. 500 μl 01:01 phenol / क्लोरोफॉर्म 7 पीएच और अच्छी तरह भंवर जोड़ें.
    2. कमरे के तापमान पर 10 मिनट के लिए 13 000 जी में स्पिन.
    3. एक नया ट्यूब पर जलीय अंश (ऊपर) निकालें.
    4. चरण 1 से 3 दोहराएँ अगर जलीय और जैविक परतों के बीच interphase बादल दिखाई देता है.
    5. 1 / 10 वें मात्रा एम 3 सोडियम (40 μl) एसीटेट और भंवर जोड़ें.
    6. 1 glycogen के μl (20 μg / μl) और भंवर जोड़ें.
    7. 100% इथेनॉल, भंवर, और -20 डिग्री सेल्सियस पर 20 मिनट के लिए जगह की 2 मात्रा (1000 μl) जोड़ें.
    8. 4 में 20 मिनट के लिए 13 000 जी में स्पिन डिग्री सेल्सियस
    9. इथेनॉल निकालें, नाड़ी स्पिन, और अवशिष्ट इथेनॉल हटायें.
    10. 500 μl ठंड 70% इथेनॉल धोने जोड़ें. भंवर, संक्षेप में, और 13 000 जी में स्पिन 4 बजे 20 मिनट के लिए डिग्री सेल्सियस
    11. 70% इथेनॉल निकालें, नाड़ी, स्पिन और pipetting द्वारा अवशिष्ट इथेनॉल हटायें.
    12. एयर कमरे के तापमान पर 10 मिनट के लिए अवशिष्ट इथेनॉल के सभी निशान हटाने के लिए खुला टोपी के साथ गोली सूखी.
    13. 10 μl में Resuspend डीएनए गोली 2 DH 0 निष्फल.

    पीसीआर द्वारा सत्यापन

    1. आप करने के लिए सुनिश्चित करें कि आपके MeDIP प्रक्रिया MeDIP प्रोटोकॉल प्रदर्शन सामान्य मानव डीएनए (पुरुष या महिला) का उपयोग करके काम कर रहा है, और बाद में एक मेथिलिकरण के लिए समृद्ध हो जाता क्षेत्र परख करने की क्रिया का परीक्षण कर सकते हैं.
    2. MeDIP उत्पाद का 30% पीसीआर ट्यूब, और MeDIP उत्पाद के एक और 30% एक और पीसीआर ट्यूब के लिए निकालें.
    3. डीएनए में एक पीसीआर ट्यूब में 10 एनजी, और एक और पीसीआर ट्यूब में डीएनए में 10 एनजी रखो. अब तुम चार अलग प्रतिक्रियाओं पीसीआर स्थापित करने के लिए होनी चाहिए.
    4. पीसीआर H19 और CTRL प्राइमरों का उपयोग प्रदर्शन के रूप में तालिका 1 में संकेत दिया.
    5. 12.5 μl कुल मात्रा के साथ पीसीआर प्रतिक्रियाओं के रूप में तालिका 2 में उल्लिखित के लिए दो mastermixes (एक प्रत्येक प्राइमर सेट के लिए) तैयार करें.
    6. Thermocycle पीसीआर तालिका 3 में उल्लिखित शर्तों का उपयोग कर.
    7. दृश्य के लिए एक 2% agarose जेल पर पीसीआर के उत्पादों के 5 μl चलाएँ.
    8. सफल MeDIP के लिए उम्मीद परिणाम तालिका 4 में दिखाया गया है.

    टेबल्स

    तालिका 1: H19 और पीसीआर सत्यापन के लिए CTRL प्राइमरों.

    प्राइमर सेट फॉरवर्ड प्राइमर रिवर्स प्राइमर पूर्वानुमानित उत्पाद का आकार
    H19 5'-cgagtgtgcgtgagtgtgag H19_F 5'-ggcgtaatggaatgcttgaa H19_R 174 बीपी
    CTRL (नियंत्रण) CTRL_F5' - gagagcattagggcagacaaa 5'-gttcctcagacagccacattt CTRL_R 139 बीपी

    तालिका 2. पीसीआर प्रतिक्रियाओं के लिए Mastermixes.

    2 हे
    H19 मिक्स (Rxn प्रति) CTRL मिक्स (Rxn प्रति)
    6.875 6.875
    10X बफर 1.25 1.25
    dNTP मिश्रण (10 मिमी प्रत्येक) 0.25 0.25
    2 MgCl (50 मिमी) 0.25 0.25
    प्राइमर्स (H19_F / आर या CTRL_F / आर) (10 सुक्ष्ममापी प्रत्येक एफ आर /) 0.625 0.625
    प्लेटिनम Taq 0.25 0.25

    तालिका 3. पीसीआर thermocyling शर्तों.

    95 ° C 5:00
    40x
    95 ° C 0:30
    56 ° C 0:30
    72 ° C 0:15

    तालिका 4. सफल MeDIP के लिए पीसीआर परिणाम की उम्मीद.

    टेम्पलेट डीएनए
    प्राइमर इस्तेमाल किया में आईपी
    H19 सकारात्मक सकारात्मक
    CTRL सकारात्मक नकारात्मक

Subscription Required. Please recommend JoVE to your librarian.

Discussion

रोग में महत्वपूर्ण भूमिका डीएनए मेथिलिकरण नाटकों का एक बढ़ती जागरूकता है, इसलिए assays के विकास के लिए इस संशोधन को मापने के तेजी से महत्वपूर्ण होते जा रहे हैं 3, 12, 13. MeDIP तकनीक दोनों जीनोम और पूरे ठिकाना विशिष्ट स्तर 6, 7 में एक स्क्रीनिंग के लिए उत्तरदायी उपकरण है. इस तकनीक डीएनए मेथिलिकरण डीएनए शुरू करने की सीमित मात्रा में प्रयोग के स्तर की एक तेजी से दृश्य प्रदान करता है और विभिन्न स्रोतों के बीच आसानी से तुलना के लिए अनुमति देता है. डाउनस्ट्रीम MeDIP उत्पाद अनुप्रयोगों का उपयोग पूरे जीनोम और CPG द्वीप oligonucleotide सरणियों, ब्याज की loci के लिए प्रत्यक्ष पीसीआर assays, के रूप में के रूप में अच्छी तरह से अनुक्रमण के रूप में प्रोटीन की एक किस्म शामिल हैं.

MeDIP डीएनए मेथिलिकरण का पता लगाने कि methylated भेद और 6 डीएनए unmethylated एंटीबॉडी पर निर्भर करता है के लिए एक अलग दृष्टिकोण प्रदान करता है. जबकि MeDIP पारंपरिक bisulfite अनुक्रमण दृष्टिकोण की तुलना में तेजी है और यह प्रतिबंध एंजाइम विश्लेषण की तरह विशिष्ट दृश्यों का विश्लेषण करने के लिए सीमित नहीं है, immunoprecipitation CPG घनत्व, दोहराए तत्व की उपस्थिति और संरचना सहित डीएनए अनुक्रम पर निर्भर हो जाएगा. इस प्रकार, उचित नियंत्रण, के रूप में हर प्रयोग के साथ, विश्लेषण और MeDIP परिणामों की व्याख्या करने के लिए महत्वपूर्ण हैं.

MeDIP तकनीक जहां अतिरिक्त ध्यान रखा जाना चाहिए भर में कई कदम उठाए हैं. ये शामिल हैं:, sonication के बाद डीएनए की पर्याप्त विखंडन सुनिश्चित करने, और है कि डीएनए सुनिश्चित करने के पूरी तरह से विकृत है siliconized ट्यूबों के प्रयोग के गैर विशिष्ट डीएनए की ट्यूब दीवारों के लिए बाध्य को रोकने के. इसके अतिरिक्त, कृपया ध्यान दें कि एकल असहाय MeDIP उत्पाद की मात्रा का ठहराव के लिए मुश्किल हो सकता है क्योंकि वहाँ spectrophotometry जैसे डीएनए मात्रा का आकलन करने के लिए सामग्री और कई आम तकनीकों का एक सीमित मात्रा में हो सकता है, डबल असहाय डीएनए के साथ सबसे अच्छा काम करते हैं. इसके अतिरिक्त, यह महत्वपूर्ण है कि सभी समय पर उचित प्रयोगशाला सुरक्षा प्रथाओं का पालन करते हैं, खासकर जब phenol के रूप में दाहक पदार्थ इस्तेमाल किया जाता है.

MeDIP तकनीक भी कई कदम पर संशोधित किया जा सकता है. महत्वपूर्ण बात प्रोटोकॉल को बढ़ाया जा सकता है या नीचे करने के लिए सीमित नमूना आकार के साथ वृद्धि हुई पैदावार, या काम की अनुमति. प्रतिबंध एंजाइमों का उपयोग (जैसे Alu मैं पाचन) के रूप में एक वैकल्पिक विखंडन दृष्टिकोण, उपकरणों की आवश्यकताओं को कम कर देता है, लेकिन यह भी संभावित सीमित डीएनए कुछ क्षेत्रों में नीचे खींच biases लागू कर सकते हैं. किसी भी दृष्टिकोण के साथ के रूप में, सबसे अच्छा परिणाम डीएनए मेथिलिकरण 1 का पता लगाने, 14 के लिए एक वैकल्पिक दृष्टिकोण का उपयोग कर पुष्टि की हैं.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

हम इस वीडियो और लेख critiquing में उनकी भागीदारी के लिए ब्राउन और लैम प्रयोगशालाओं के सदस्यों का धन्यवाद करना चाहते हैं. इस काम के स्वास्थ्य अनुसंधान और स्वास्थ्य अनुसंधान के लिए माइकल स्मिथ फाउंडेशन संस्थान कनाडा के लिए से धन के द्वारा समर्थित किया गया था.

Materials

Name Type Company Catalog Number Comments
Biorupter sonicator Tool Diagenode UCD-200 TM
1.7ml SafeSeal Microcentrifuge Tubes Other Sorenson BioScience 11510
ND 3300 Spectrophotometer Tool NanoDrop
Primary Antibody: Anti-5’-methylcytosine mouse mAb Reagent Calbiochem 162 33 D3
Secondary Antibody: Dynabeads M-280 Sheep anti-mouse IgG Reagent Invitrogen 112-01D
Magnetic Tube Rack Tool Invitrogen CS15000
Mini LabRoller Tool Labnet International H5500
IP Buffer 10 mM NaPO4 pH 7.0, 140 mM NaCl, 0.05% Triton X-100. Stored at room temperature
Digestion Buffer 10 mM Tris pH8.0, 100 mM EDTA, 0.5% SDS, 50 mM NaCl

DOWNLOAD MATERIALS LIST

References

  1. Beck, S., Rakyan, V. K. The methylome: approaches for global DNA methylation profiling. Trends Genet. 24, 231-237 (2008).
  2. Lu, Q., et al. Epigenetics, disease, and therapeutic interventions. Ageing research reviews. 5, 449-467 (2006).
  3. Zilberman, D., Henikoff, S. Genome-wide analysis of DNA methylation patterns. Development. 134, 3959-3965 (2007).
  4. Feinberg, A. P., Tycko, B. The history of cancer epigenetics. Nature reviews. 4, 143-153 (2004).
  5. Weber, M., et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet. 39, 457-466 (2007).
  6. Weber, M., et al. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet. 37, 853-862 (2005).
  7. Wilson, I. M., et al. Epigenomics: mapping the methylome. Cell Cycle. 5, 155-158 (2006).
  8. Gazin, C., Wajapeyee, N., Gobeil, S., Virbasius, C. M., Green, M. R. An elaborate pathway required for Ras-mediated epigenetic silencing. Nature. 449, 1073-1077 (2007).
  9. Karpinski, P., Sasiadek, M. M., Blin, N. Aberrant epigenetic patterns in the etiology of gastrointestinal cancers. Journal of applied. 49, 1-10 (2008).
  10. Maekawa, M., Watanabe, Y. Epigenetics: relations to disease and laboratory findings. Current medicinal chemistry. 14, 2642-2653 (2007).
  11. Vucic, E. A., Brown, C. J., Lam, W. L. Epigenetics of cancer progression. Pharmacogenomics. 9, 215-234 (2008).
  12. Egger, G., Liang, G., Aparicio, A., Jones, P. A. Epigenetics in human disease and prospects for epigenetic therapy. Nature. 429, 457-463 (2004).
  13. Jones, P. A., Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 3, 415-428 (2002).
  14. Fraga, M. F., Esteller, M. DNA methylation: a profile of methods and applications. Biotechniques. 33, 632-649 (2002).

Comments

7 Comments

  1. The instrument you are using is a NanoDrop 1000 Spectrophotometer, not a NanoDrop 3300 Fluorospectrometer.

    Reply
    Posted by: Anonymous
    January 26, 2009 - 3:40 PM
  2. Dear Madams and Sirs, in the protocol you say that you sonicate 1 µg of genomic DNA and that you therefrom use 800 ng for MeDIP but I can' t find an information about the enrichment in percent.
    I would be obliged if you could give me this information because I want to try MeDIP with low amounts of DNA and so I' m very interested in your protocol. Thank very much for your efforts!!! best regards
    Sabrina Pichler

    Reply
    Posted by: Anonymous
    March 6, 2009 - 10:11 AM
  3. Hi Sabrina,
    We do not quantitate the enrichment of methylated DNA recovered after MeDIP in terms of a percentage. We just check for the presence of known methylated sequences and the absence of non-methylated sequences in our MeDIP product. It is possible to roughly estimate MeDIP yield using agarose gel electrophoresis and a DNA stain that will visualize single stranded DNA, such as SYBR Gold.

    Thank you for your interest.

    Reply
    Posted by: Anonymous
    May 27, 2009 - 2:41 PM
  4. Thank you very much.

    Reply
    Posted by: Lyudmyla S.
    October 5, 2009 - 10:10 AM
  5. We noticed that DNA directly bound to magnetic bead_protein A even without 5 mc Ab and could be eluted by simply heating. I wonder if you have this problem in your experiment. Thanks.

    Reply
    Posted by: Anonymous
    November 17, 2010 - 5:31 PM
  6. Hello!
    I am trying watch the video on meDIP experiment but only sound is available from the title as DNA preparation and immunoprecipitation. Would you please let me know how I can watch the video perfectly?

    Thank you in advance for your cooperation.

    Best regards,
    Raj Bose

    Reply
    Posted by: Raj B.
    May 19, 2011 - 7:07 AM
  7. Hi Raj,

    For trouble viewing the video, the JoVE troubleshooting link says to install/uninstall Flash.

    http://www.jove.com/Page.php?name=Troubleshooting

    If that dŒsn't work, contact support@jove.com and they should be able to help you.

    Good luck!

    Emily

    Reply
    Posted by: Anonymous
    May 24, 2011 - 2:07 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics