Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

Summary

The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data.

Abstract

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for application. Due to the drastic differences between the aptamer and small molecules, scientists need to put much effort into characterizing their binding properties. Isothermal Titration Calorimetry (ITC) is a powerful approach for this purpose. ITC goes beyond determining disassociation constants (K_d) and can provide the enthalpy changes and binding stoichiometry of the interaction between two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration, so the process can sensitively measure the binding between macromolecules and their small targets. Herein, the article introduces a step-by-step procedure of the ITC measurement of a selected aptamer with a small target, tetracycline. This example proves the versatility of the technique and its potential for other applications.

Introduction

Aptamers are ssDNA or RNA fragments selected through an evolution process with high binding affinity and specificity to the desired targets^1,2, which can work as advanced recognition elements or chemical antibodies^3,4,5. Thus, the binding affinity and specificity of aptamers to their targets play a crucial role in the selection and application of an aptamer, and Isothermal Titration Calorimetry (ITC) has been widely used for these characterization purposes. Many approaches have been used to determine the affinity of a....

Protocol

NOTE: Figure 2 shows the main steps of the ITC experiment for determining the thermodynamic and kinetic association of a DNA aptamer and tetracycline.

1. Preparation of samples

NOTE: Samples for ITC need to be prepared in the same buffer for both the aptamer and ligand to avoid heat release caused by mixing different buffers from the sample cell and syringe. This is typically achieved through dialysis of all materials into the same buffer. The buffer is exchanged using a protocol adapted from the protocol of a 3 kDa molecular weight cutoff (MWC) concentrator with some ....

Results

ITC provides an accurate disassociation constant (K_d), the binding stoichiometry, and the thermodynamic parameters of two-molecule interactions⁶. In this example, the aptamer selected by Kim et al.^9,11 binds to tetracycline with binding affinities of K_d 1 = 13 µM, K_d 2 = 53 nM. Interestingly, this binding was determined using the equilibrium filtration method and a reported K<.......

Discussion

The method presented here was modified according to instruction from TA Instruments and is sufficient to determine the binding affinity and thermodynamics of many selected aptamers and targets at our center. Crucial steps from this procedure include exchanging the buffer to have a target matching the ligand, running samples with proper parameters, and finding the appropriate binding fitting model to analyze the data. Continuous recording of heat release requires eliminating all noise heat, such as from mismatch of the bu.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
5'-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG C TTGGGTTGGTCCCACTGCGCG TGGATCCGAGCTCCAC GTG-3'	Integrated DNA Technologies, Inc		The sequence is adopted from Gu's research, which has not identified Kd using ITC (refer references 8 and 9)
Affinity ITC Auto Low Volume (190 µL) System Complete–Gold Cells	TA Instruments	61000.901	Isothermal titration calorimetry system
CaCl2	Avantor (VWR)	E506-100ML	Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile
Centrifuge	Eppendorf	5417R	The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.
Complete Degassing Station (110/230V)	TA Instruments	6326	This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.
EDTA	TekNova	E0375	EDTA 500 mM, pH 7.5
NanoDrop One Microvolume UV-Vis Spectrophotometer	ThermoFisher	ND-ONE-W	UV-Vis Spectrophotometer
Nanosep, Nanosep MF and NAB Centrifugal Devices	Pall Laboratory	OD030C34	3 kDa molecular weight cutoff concentrator
PBS pH 7.4	IBI Scientific	IB70165	Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 µm filter. Autoclaved at 121 °C for greater than 20 min.
Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes	labForce (a Thomas Scientific Brand)	1149K01
Tetracycline, Hydrochoride	EMD Millipore Corperation	CAS64-75-5