एक घर का बना दोहरे चमक luciferase परख का उपयोग उच्च throughput कार्यात्मक स्क्रीनिंग


Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:


Enter your email below to get your free 10 minute trial to JoVE!

We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.



हम उच्च throughput रोबोट transfections और एक घर का बना दोहरे चमक luciferase परख का उपयोग transcriptional नियामकों की पहचान करने के लिए एक तेजी से और सस्ती जांच पद्धति प्रस्तुत करते हैं. इस प्रोटोकॉल तेजी जीनों के हजारों के लिए प्रत्यक्ष पक्ष द्वारा साइड कार्यात्मक डेटा उत्पन्न करता है और ब्याज की किसी भी जीन लक्ष्य को आसानी से परिवर्तनीय है.

Cite this Article

Copy Citation | Download Citations

Baker, J. M., Boyce, F. M. High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay. J. Vis. Exp. (88), e50282, doi:10.3791/50282 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.


हम अल्फा synuclein, पार्किंसंस रोग के साथ जुड़े जीन की transcriptional नियामकों की पहचान करने के लिए एक तेजी से और सस्ती उच्च throughput स्क्रीनिंग प्रोटोकॉल उपस्थित थे. 293T कोशिकाओं transiently एक एक जीन प्रति अच्छी तरह से microplate प्रारूप में, एक साथ luciferase संवाददाता plasmids के साथ, एक arrayed ओआरएफ अभिव्यक्ति पुस्तकालय से plasmids के साथ ट्रांसफ़ेक्ट हैं. जुगनू luciferase गतिविधि एक आंतरिक नियंत्रण निर्माण (Renilla luciferase निर्देशन एक एचसीएम्वी प्रमोटर) से अभिव्यक्ति के लिए सामान्यीकृत अल्फा synuclein प्रतिलेखन, पर प्रत्येक पुस्तकालय जीन के प्रभाव को निर्धारित करने के लिए 48 घंटे के बाद assayed है. इस प्रोटोकॉल 96 अच्छी तरह प्रारूप में सड़न रोकनेवाला तरल से निपटने से करता है जो एक जैव सुरक्षा कैबिनेट में संलग्न एक पीठ टॉप रोबोट, से मदद की है. हमारी स्वचालित अभिकर्मक प्रोटोकॉल उच्च throughput lentiviral पुस्तकालय उत्पादन या conju में अद्वितीय पुस्तकालय plasmids के बड़ी संख्या में ट्रिपल transfections की आवश्यकता के अन्य कार्यात्मक प्रदर्शन के प्रोटोकॉल के लिए आसानी से अनुकूलनीय हैसहायक plasmids के एक आम सेट के साथ nction. हम यह भी एक सस्ता और मान्य विकल्प मौजूद PTC124, EDTA, और पूर्व Renilla luciferase की माप के लिए जुगनू luciferase गतिविधि को दबाने के लिए पायरोफास्फेट रोजगार जो व्यावसायिक रूप से उपलब्ध, दोहरी luciferase अभिकर्मकों के लिए. इन विधियों का प्रयोग, हम 7670 मानव जीन की जांच की और अल्फा synuclein के 68 नियामकों की पहचान की. इस प्रोटोकॉल हित के अन्य जीन लक्ष्य को आसानी से परिवर्तनीय है.


प्रमुख आनुवंशिक नियामक तत्वों और उन पर कार्रवाई के कारकों की पहचान करने की क्षमता कई जैविक प्रक्रियाओं के अन्वेषण के लिए मौलिक है. हालांकि, इस तरह के विशिष्ट neuronal आबादी के रूप में दुर्लभ प्रकार की कोशिकाओं में जीन की अभिव्यक्ति को नियंत्रित करने वाले कारकों की पहचान करने, चुनौतीपूर्ण हो सकता है. यहाँ, हम अल्फा synuclein (SNCA) के उपन्यास transcriptional नियामकों की पहचान करने के लिए एक प्रोटोकॉल पेश, पार्किंसंस रोग के साथ जुड़े और substantianigra में डोपामिनर्जिक न्यूरॉन्स में व्यक्त एक जीन मध्यमस्तिष्क के कॉम्पेक्टा क्षेत्र pars. हम 293T कोशिकाओं में अल्फा synuclein अभिव्यक्ति deconstruct करने के लिए एक उच्च throughput, दोहरे luciferase, इन विट्रो संवाददाता स्क्रीन का प्रयोग करके यह पूरा. अल्फा synuclein प्रमोटर पहले जुगनू luciferase जीन से युक्त एक संवाददाता प्लाज्मिड में क्लोन है. एक अनिवार्यता से सक्रिय प्रमोटर के नियंत्रण में Renilla luciferase युक्त एक व्यावसायिक रूप से उपलब्ध प्लाज्मिड एक आंतरिक नियंत्रण के रूप में कार्य करता है. थेसई संवाददाता निर्माणों प्रत्येक अच्छी तरह से एक भी पुस्तकालय प्लाज्मिड के साथ ट्रांसफ़ेक्ट है कि इस तरह, एक डीएनए अभिव्यक्ति पुस्तकालय से plasmids के साथ microplates में 293T कोशिकाओं में सह ट्रांसफ़ेक्ट हैं. 48 घंटा, हर पत्रकार के लिए luciferase गतिविधि एक दोहरे चमक परख का उपयोग क्रमिक रूप से मापा जाता है. प्लेट के आधार पर सामान्य बनाने के बाद: (नि. अनुपात एफ) प्रत्येक कुएं में Renilla luciferase गतिविधि: प्रत्येक पुस्तकालय जीन के जवाब में अल्फा synuclein के रिश्तेदार अभिव्यक्ति जुगनू के अनुपात से inferred है.

इस प्रोटोकॉल न्यूनतम जनशक्ति (1-2 लोगों) और न्यूनतम लागत (microplate परख प्रति बारे में $ 3 अभिकर्मक लागत) का उपयोग करते हुए एक पत्रकार जीन transactivate करने की क्षमता के लिए जीन की एक बड़ी संख्या (~ प्रति सप्ताह 2,500) स्क्रीन करने की क्षमता प्रदान करता है. आनुवंशिक हेरफेर करने के लिए आग रोक सभ्य न्यूरॉन्स में अध्ययन करने के लिए मुश्किल हो जाता है जो neuronal जीन के transcriptional नियामकों (जैसे, अल्फा synuclein),, यह प्रत्यक्ष कार्यात्मक परख में पक्ष द्वारा साइड तुलना की जा सकती. हम में शामिल हमारेप्रोटोकॉल हम पारंपरिक प्रक्रियाओं (चर्चा देखने के लिए) के साथ हो गई जब इस क्षेत्र युक्त plasmids अस्थिर हो पाया क्योंकि क्लोनिंग और अल्फा synuclein प्रमोटर युक्त plasmids के विकास के लिए एक विस्तृत विधि,. हम भी उच्च throughput assays के लिए व्यावसायिक रूप से उपलब्ध दोहरे luciferase अभिकर्मकों के लिए एक सस्ता विकल्प शामिल हैं. इस प्रोटोकॉल आसानी हित के अन्य नियामक तत्वों, या उच्च throughput क्षणिक transfections की आवश्यकता होती है किसी भी प्रक्रिया को लक्षित करने के लिए अनुकूलित किया जा सकता.

Subscription Required. Please recommend JoVE to your librarian.


एक प्रयोगात्मक अवलोकन के लिए, चित्रा 1 देखें.

1. अल्फा synuclein प्रमोटर युक्त रिपोर्टर प्लास्मिड तैयार करें

अल्फा synuclein जीन (चित्रा 2) के नियामक तत्वों Intron 2 से 3 अपस्ट्रीम एनएसीपी (amyloid पेप्टाइड की गैर एक बीटा घटक) dinucleotide दोहराने अनुक्रम 1,2 से लगभग 10 केबी, अवधि. हम में इस क्षेत्र के एक हिस्से में शामिल हमारे संवाददाता का निर्माण. हम विकास के लिए 2 आवश्यक विशेष प्रक्रियाओं Intron युक्त plasmids, नीचे दिए गए के रूप में पाया गया कि. luciferase plasmids, pGL4.10 और pGL4.75 (चित्रा 3), Promega से व्यावसायिक रूप से उपलब्ध हैं और पारंपरिक आणविक जीव विज्ञान प्रोटोकॉल का उपयोग कर प्रचारित किया जा सकता है.

  1. तालिका 1 में नुस्खा और 2 तालिका में प्राइमरों का उपयोग अलग PCRs में अल्फा synuclein प्रमोटर के 2 घटकों बढ़ाना.
  2. वेरिवित्तीय वर्ष पीसीआर ते (Tris-EDTA) का 50 μl में eluting, Qiaquick पीसीआर शोधन किट (Qiagen) का उपयोग एक agarose जेल और स्वच्छ उत्पादों पर. भविष्य में उपयोग के लिए -20 डिग्री सेल्सियस पर eluted 0.9 केबी टुकड़ा स्टोर.
  3. Saci और XhoI के साथ, पूरे 3.4 केबी पीसीआर टुकड़ा की मात्रा, साथ ही pGL4.10 की 5 ग्राम डाइजेस्ट. बछड़ा आंत alkaline फॉस्फेट (रॉश) के साथ वेक्टर समझो और जेल PureLink त्वरित जेल निकालना किट (Invitrogen) का उपयोग कर शुद्ध.
  4. टी -4 डीएनए ligase (चंचु) का उपयोग टुकड़ा और वेक्टर ligate. 10 μl ते बफर में eluting, PureLink पीसीआर माइक्रो किट (Invitrogen) का उपयोग कर पूरा प्रतिक्रिया से साफ करें.
  5. ElectroMAX Stbl4 सक्षम कोशिकाओं (Invitrogen) के 20 μl में साफ किया, बंधाव प्रतिक्रिया के 2 μl रूपांतरण और निर्माता के निर्देशों के अनुसार electroporate. 90 मिनट के लिए 225 rpm पर एक 30 डिग्री सेल्सियस इनक्यूबेटर में मिलाते हैं. 100 मिलीग्राम / एमएल एम्पीसिलीन युक्त लेग प्लेटों पर 2 संस्करणों बिखरा हुआ है और 2 दिनों के लिए 30 डिग्री सेल्सियस पर सेते हैं.
  6. एक दन्तखुदनी का उपयोग करना, टीबी के 2 मिलीलीटर (भयानक शोरबा) में टीका के लिए 4-6 छोटी कालोनियों का चयन करें. एक 30 डिग्री सेल्सियस प्रकार के बरतन हे / एन में इन Miniprep संस्कृतियों आगे बढ़ें
  7. PureLink HiPure प्लास्मिड Miniprep किट (Invitrogen) का उपयोग कर प्रत्येक Miniprep संस्कृति के 1.5 मिलीलीटर से प्लाज्मिड डीएनए शुद्ध.
  8. BamHI साथ minipreps पचाने और एक agarose जेल पर Electrophorese. सही क्लोन 2.8 केबी और 4.9 केबी के टुकड़े का उत्पादन करना चाहिए.
  9. एक ताजा पौंड (Luria शोरबा) प्लेट पर सही क्लोन से शेष Miniprep संस्कृति Restreak और 2 दिनों के लिए 30 डिग्री सेल्सियस पर बढ़ता है.
  10. एक छोटी सी कॉलोनी का चयन करें और एक 1.5 मिलीलीटर टीबी स्टार्टर संस्कृति टीका लगाना. 30 डिग्री सेल्सियस पर ओ / एन शेक स्टार्टर संस्कृति संतृप्ति को बढ़ने मत देना.
  11. Prewarmed टीबी के 150 मिलीलीटर में पूरे स्टार्टर संस्कृति पतला और 2 दिनों के लिए 30 डिग्री सेल्सियस पर हिला. अगले कदम के लिए आगे बढ़ने से पहले, क्लोन replicati दौरान रूप बदलना नहीं था कि पुष्टि करने के लिए एक अतिरिक्त Miniprep और पाचन के लिए इस संस्कृति के 1.5 मिलीलीटर का उपयोग पर.
  12. PureLink HiPure प्लास्मिड Maxiprep किट (Invitrogen) का उपयोग शेष संस्कृति से प्लास्मिड डीएनए शुद्ध. इस मध्यवर्ती प्लाज्मिड की उम्मीद पैदावार संस्कृति की 150 मिलीलीटर प्रति 50-150 माइक्रोग्राम हैं.
  13. 1.2 चरण में जमे हुए 0.9 केबी टुकड़ा पिघलना. 1.3-1.12 KpnI और Saci साथ बजाय पचा, मध्यवर्ती प्लाज्मिड में 0.9 केबी टुकड़ा क्लोन करने के लिए चरणों को दोहराएँ. Ligate, का चयन करें, बदलना, और ऊपर के रूप में maxipreps के लिए बढ़ता है. BamHI साथ पाचन 5.8 केबी और 2.8 केबी के टुकड़े उपज चाहिए. इस स्क्रीन के लिए उपयोग किया जाएगा जो प्लाज्मिड है.

2. स्क्रीनिंग के लिए 293T कोशिकाओं, रिपोर्टर plasmids, और पुस्तकालय डीएनए तैयार

293T कोशिकाओं पहले 96 अच्छी तरह प्लेटें में वरीयता प्राप्त और अगले दिन ट्रांसफ़ेक्ट हैं. रिपोर्टर प्लास्मिड और पुस्तकालय DNAs 96 अच्छी तरह प्लेटें में पतला कर रहे हैं. हम मैसाचुसेट्स जनरल अस्पताल (कम से डीएनए कोर से अभिकर्मक ग्रेड पुस्तकालय डीएनए की प्लेटें प्राप्त= "_blank" मिल> dnacore.mgh.harvard.edu). इस प्रोटोकॉल 293T कोशिकाओं के 2 समान प्लेट (चित्रा 1) में एक पुस्तकालय थाली transfects, कोशिकाओं के इस प्रकार 2 प्लेटें जांच की प्रत्येक पुस्तकालय प्लेट के लिए वरीयता प्राप्त किया जाना चाहिए.

नोट: इन luciferase assays के साथ हस्तक्षेप और क्रमशः, अभिकर्मक दौरान विषाक्तता में वृद्धि के रूप में, लाल या एंटीबायोटिक दवाओं फिनोल के बिना मीडिया में कोशिकाओं को विकसित.

  1. प्रत्येक पुस्तकालय प्लेट 14% FBS युक्त DMEM में 1.5 x 10 5 कोशिकाओं / एमएल के एक एकाग्रता के लिए, resuspend trypsinized 293T कोशिकाओं जांच की जा करने के लिए. एक बाँझ जलाशय (Axygen) में डालो.
  2. रोबोट डेक पर जलाशय, 2 स्पष्ट तली, 96 अच्छी तरह प्लेटें (Corning), और फिल्टर pipet सुझावों की एक बॉक्स (Agilent) रखें. अच्छी तरह से प्रति 1.5 x 10 4 कोशिकाओं के घनत्व के लिए, दोनों प्लेटों के प्रत्येक कुएं में कोशिकाओं के 100 μl बांटना.
  3. बराबर सुनिश्चित करने के लिए कम रैंप गति का उपयोग कर, 2 मिनट के लिए 50 XG पर सेल प्लेटें अपकेंद्रित्रप्रत्येक अच्छी तरह से भर में सेल घनत्व. 37 में सेते डिग्री सेल्सियस और 10% सीओ 2 हे / एन
  4. सीरम मुक्त मीडिया में 5 एनजी / μl को जुगनू और Renilla संवाददाता प्लास्मिड पतला. एक 15 मिलीलीटर शंक्वाकार ट्यूब में (मात्रा) द्वारा जुगनू Renilla प्लाज्मिड को 05:03 के अनुपात में dilutions जुडा है.
  5. प्रत्येक कुएं में, पुस्तकालय प्लेट प्रति 17 μl, प्लस 2-10 μl अतिरिक्त वितरण एक 96 अच्छी तरह से थाली के प्रत्येक कुएं में pipet संयुक्त plasmids,.
  6. ऊपर के रूप में अभिकर्मक ग्रेड डीएनए पुस्तकालय प्लेटें प्राप्त करें और endotoxin मुक्त पानी के साथ 13.3 एनजी / μl को पतला. अच्छी तरह से प्रति न्यूनतम मात्रा 28 μl होना चाहिए.

3. Transfections प्रदर्शन करना

स्क्रीन के 2 दिन, संवाददाता plasmids और पुस्तकालय DNAs 293T कोशिकाओं में ट्रांसफ़ेक्ट हैं.

  1. प्रत्येक पुस्तकालय प्लेट के लिए, एक polystyrene ट्यूब में 4.3 मिलीलीटर सीरम मुक्त मीडिया (1:40 कमजोर पड़ने) के साथ आर टी Optifect (Invitrogen) के 107.5 μl मिश्रण. 5 आरटी पर मिनट, और के लिए सेतेn एक 96 अच्छी तरह से, polystyrene वी तली प्लेट (Greiner) के प्रत्येक कुएं में (पुस्तकालय प्रति प्लेट) 44 μl बांटना.
  2. पतला Optifect की थाली, संवाददाता प्लास्मिड (2.5 कदम), पुस्तकालय DNAs (चरण 2.6), और रोबोट डेक पर pipet सुझावों की एक बॉक्स रखें.
  3. प्रत्येक आकांक्षा के बीच एक 5 μl हवा खाई डालने संवाददाता plasmids, पतला Optifect के 43 μl, और पुस्तकालय डीएनए के 26 μl के महाप्राण 17 μl. पुस्तकालय डीएनए पार संदूषण को रोकने के लिए पिछले aspirated किया जाना चाहिए. , एक नया polystyrene वी तली थाली में सुझावों की सामग्री बांटना, कवर मिश्रण, और लिपिड / डीएनए परिसरों फार्म को अनुमति देने के लिए 20 मिनट के लिए अलग सेट. कई पुस्तकालय प्लेटें transfecting हैं, pipet सुझावों और पुस्तकालय प्लेट की जगह है, और दोहराएँ.
  4. Optifect / डीएनए मिश्रण थाली को उजागर करने और 293T कोशिकाओं के 2 प्लेटों के साथ रोबोट डेक पर जगह है. Pipet सुझावों का एक भी बॉक्स, महाप्राण Optifect के 80 μl का प्रयोग: डीएनए मिश्रण और धीरे धीरे कोशिकाओं की प्रत्येक थाली पर 40 μl बांटना. ट्रांस हैंकई पुस्तकालय प्लेटें fecting, सभी Optifect के लिए दोहराने: डीएनए प्लेटें. कोशिकाओं को कवर.
  5. 30 मिनट के लिए 1200 XG पर सेल प्लेटें अपकेंद्रित्र. कवर और इनक्यूबेटर पर लौटें.
  6. 4-6 घंटे के लिए कोशिकाओं को सेते हैं. इस ऊष्मायन के दौरान, प्रत्येक ट्रांसफ़ेक्ट पुस्तकालय प्लेट के लिए 10% FBS और 10 माइक्रोग्राम / एमएल ciprofloxacin (CellGro) युक्त 12 मिलीलीटर DMEM मिश्रण से ताजा मीडिया तैयार करते हैं. एक बाँझ जलाशय में ताजा मीडिया डालो.
  7. रोबोट सुझावों के 2 बक्से जगह, कोशिकाओं की एक थाली, रोबोट डेक पर ताजा मीडिया, और बर्बादी जलाशय युक्त जलाशय. महाप्राण 100 कोशिकाओं से मीडिया के μl और आंशिक रूप से 70% इथेनॉल के साथ भरा बेकार जलाशय में बांटना. ताजा टिप्स, ताजा मीडिया के महाप्राण 100 μl का उपयोग करना है और धीरे धीरे कोशिकाओं पर बांटना. कोशिकाओं के सभी प्लेटों के लिए दोहराएँ.
  8. 48 घंटे के लिए इनक्यूबेटर प्लेटें लौटें.

4. दोहरे luciferase assays के प्रदर्शन

स्क्रीन के 4 दिन पर,जुगनू और Renilla luciferase assays के प्रदर्शन कर रहे हैं.

नोट:. 3 तालिका में वर्णित के रूप में दोहरे luciferase परख जुगनू और Renilla luciferases इस प्रकार की कोशिकाओं से पहले luciferase गतिविधि को मापने के लिए lysed किया जाना चाहिए, स्रावित नहीं कर रहे हैं, 2 परख बफ़र्स, 3X जुगनू परख बफर और 3X Renilla परख बफर की अनुक्रमिक अलावा की आवश्यकता . जुगनू परख बफर कोशिकाओं lyses और जुगनू luciferase के लिए सब्सट्रेट प्रदान करता है, Renilla परख बफर जुगनू संकेत quenches और Renilla luciferase के लिए सब्सट्रेट प्रदान करता है.

  1. तालिका 3 में वर्णित के रूप में प्रत्येक पुस्तकालय प्लेट के लिए, शेयर समाधान से 3X जुगनू परख बफर के 8 एमएल तैयार करते हैं, और एक 96 अच्छी तरह से वि तली थाली के प्रत्येक अच्छी तरह से में 82 μl बांटना.
  2. प्रत्येक पुस्तकालय प्लेट के लिए, यह भी 3X Renilla परख बफर के 12 एमएल तैयार है और एक 96 अच्छी तरह से वि तली थाली के प्रत्येक कुएं में 122 μl बांटना. दोनों अलग निर्धारित करेंजुगनू और Renilla परख बफ़र्स.
  3. रोबोट डेक पर (एक ही पुस्तकालय की थाली से ट्रांसफ़ेक्ट) pipet सुझावों का एक डिब्बा, एक बेकार जलाशय, और कोशिकाओं के 2 प्लेटें प्लेस.
  4. महाप्राण 60 प्रत्येक थाली से मीडिया के μl और आंशिक रूप से 70% इथेनॉल के साथ भरा बेकार जलाशय में त्यागें. एक तरफ कवर प्लेटें और निर्धारित किया है. कई पुस्तकालय प्लेटें transfecting है, प्लेट के सभी सेट के लिए दोहराएँ.
  5. 2 pipet सुझावों के बक्से, 3X जुगनू परख बफर की थाली, और रोबोट डेक पर सेल प्लेटों का एक सेट रखें.
  6. महाप्राण 40 3X जुगनू परख बफर के μl और अच्छी तरह से मिश्रण, कोशिकाओं की पहली थाली में जोड़ें. नई pipet सुझावों को स्विच करना, दूसरा सेल प्लेट के लिए दोहराएँ. सेल को पूरा करने के लिए 10 मिनट के लिए आरटी पर कोशिकाओं रखें. कई पुस्तकालय प्लेटें transfecting हैं, सुझाव और सेल प्लेटों के बक्से की जगह, और दोहराएँ.
  7. प्रत्येक कोशिका 1 सेकंड के लिए रिकॉर्डिंग एक luminometer पर थाली, प्रति अच्छी तरह से प्रत्येक अच्छी तरह से रिकॉर्ड luminescence. रोबोट के लिए प्लेटें लौटेंडेक.
  8. 2 pipet सुझावों के बक्से, 3X Renilla परख बफर की थाली, और रोबोट डेक पर सेल प्लेटों का एक सेट रखें.
  9. महाप्राण 60 3X Renilla परख बफर के μl, और अच्छी तरह से मिश्रण, कोशिकाओं की पहली थाली में जोड़ें. Pipet सुझावों की एक नई बॉक्स में बदली करना, दूसरा सेल प्लेट के लिए दोहराएँ. कई पुस्तकालय प्लेटें transfecting, तो सेल प्लेटों के सभी सेट के लिए दोहराएँ.
  10. ऊपर के रूप में 1 मिनट के लिए प्रत्येक अच्छी तरह से रिकॉर्डिंग एक luminometer पर सभी प्लेटों से रिकॉर्ड luminescence,. प्लेटों त्यागें.

5. डेटा विश्लेषण

  1. जुगनू की गणना: Renilla luminescence अनुपात ('एफ: A अनुपात ") Renilla संकेत की गणना से जुगनू संकेत की गिनती विभाजित करके प्रत्येक के लिए अच्छी तरह.
  2. एफ विभाजित करके प्रेरण मूल्य की गणना: अच्छी तरह से औसत एफ से प्रत्येक के आर अनुपात: थाली के आर अनुपात, कुओं के उच्चतम और निम्नतम 25% को छोड़कर.
  3. Replicates भर प्रेरण मूल्यों औसतएक एकल ट्रांसफ़ेक्ट पुस्तकालय की थाली के लिए. तीन परतों से अल्फा synuclein अधिक उत्प्रेरण या दमन जीन इस स्क्रीन में 'हिट' माना जाता है और आगे की मान्यता और माध्यमिक स्क्रीन के अधीन हैं.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ठेठ luciferase मूल्यों, एफ: आर अनुपात और एक भी आधा प्लेट के लिए प्रेरण मूल्यों चित्रा 4 में दिखाया गया है अच्छी तरह से एच 2, एक 32 गुना inducer में हिट ध्यान दें.. अत्यधिक विषाक्तता (उदाहरण के लिए, अच्छी तरह से E3), या खराब ट्रांसफ़ेक्ट गया कि कुओं जीन के कारण, दोनों जुगनू और Renilla luciferases के लिए कम मूल्यों का उत्पादन, लेकिन एक औसत प्रेरण मूल्य होगा. PGL4 रीढ़ की हड्डी के साथ बातचीत के माध्यम से शायद luciferase गतिविधि की गैर विशिष्ट प्रेरण कारण जीन, एक औसत प्रेरण मूल्य में जिसके परिणामस्वरूप, उतना ही जुगनू और Renilla luciferases प्रेरित करेगा. प्रतिकृति के बीच प्रेरण मूल्यों में बड़ी विसंगतियों निष्पादन त्रुटियों के लिए संदेह उठाना चाहिए. यह वृद्धि की अभिव्यक्ति का कारण है कि क्लोन वृद्धि हुई luciferase गतिविधि के रूप में मापा जाएगा इतना है कि स्क्रीन संवाददाता assays के रैखिक सीमा के भीतर किया गया है सत्यापित करने के लिए महत्वपूर्ण है. हम linearity मान्य करने के लिए प्रत्येक पत्रकार जीन की बढ़ती मात्रा ट्रांसफ़ेक्टहमारे प्रयोगात्मक परिस्थितियों में संवाददाता परख के (5 चित्रा). यह ऊष्मायन कदम के कारण सब्सट्रेट कमी को गैर linearity से बचने के बाद तुरंत assays के प्रदर्शन करने के लिए भी महत्वपूर्ण है. हम अभिकर्मकों के अलावा चित्रा (6) के बाद 1 घंटा के लिए महत्वपूर्ण जुगनू luciferase गतिविधि मनाया.

चित्रा 1
चित्रा 1. प्रायोगिक सिंहावलोकन. पुस्तकालय डीएनए से प्रत्येक एकल थाली 2 संवाददाता निर्माणों के साथ संयुक्त और कोशिकाओं की डुप्लिकेट प्लेटों transfect करने के लिए प्रयोग किया जाता है. 48 घंटे के बाद, प्रत्येक luciferase संवाददाता की गतिविधि क्रमिक रूप से मापा जाता है. प्रत्येक पुस्तकालय प्लाज्मिड द्वारा SNCA प्रमोटर प्लाज्मिड के विशिष्ट प्रेरण थाली आधारित normalizatio बाद Renilla luciferase को जुगनू के अनुपात से गणना की हैएन.

चित्रा 2
चित्रा 2. जुगनू संवाददाता प्लाज्मिड में इस्तेमाल गुणसूत्र 4 पर स्थित अल्फा synuclein के 5 'क्षेत्र (SNCA), योजनाबद्ध. प्राइमर नामों तालिका 2 में दृश्यों के अनुरूप हैं. हैच के निशान से संकेत मिलता है चित्रा से सफाया लगभग 8 केबी खंड , अन्यथा पैमाने पर करने की. SNCA के लिए ATG शुरू कोडोन एक्सॉन 3 में स्थित है.

चित्रा 3
इस स्क्रीनिंग प्रोटोकॉल में इस्तेमाल किया चित्रा 3. Luciferase संवाददाता प्लास्मिड. SNCA जीनोमिक क्षेत्रों पीजी के कई क्लोनिंग साइट में क्लोन कर रहे हैंजुगनू luciferase के तुरंत नदी के ऊपर L4.10. एचसीएम्वी-IE1 Renilla luciferase की (मानव cytomegalovirus तत्काल जल्दी 1) प्रमोटर निर्देशन अभिव्यक्ति के साथ एक प्लाज्मिड एक आंतरिक नियंत्रण के रूप में इस्तेमाल किया गया था. दोनों प्लास्मिड Promega से व्यावसायिक रूप से उपलब्ध हैं.

चित्रा 4
चित्रा 4. एक एकल 96 अच्छी तरह से थाली के आधे के लिए प्रतिनिधि परिणाम है. ए कच्चा जुगनू luciferase मायने रखता बी कच्चा Renilla luciferase मायने रखता सी. एफ.:. प्रत्येक एफ विभाजित करके प्रत्येक अच्छी तरह से, की गणना के लिए बी डी प्रेरण मूल्यों में मूल्य से एक में मूल्य विभाजित करके गणना आर अनुपात,: आर अनुपात औसत एफ द्वारा:. कुओं के ऊपर और नीचे 25% छोड़कर थाली के आर अनुपात, ई. ग्राफिकल प्रेरण मूल्यों का प्रतिनिधित्व के लिए अच्छी तरह से एच 2, एक सकारात्मक हिट के साथ एक ही थाली, पर प्रकाश डाला. एच 2 पहले से SNCA अभिव्यक्ति के साथ जुड़ा नहीं एक neuronal प्रतिलेखन कारक है मारो. बड़ा आंकड़ा देखने के लिए यहां क्लिक करें .

चित्रा 5
चित्रा 5. Linearity assays. प्रकोष्ठों मजबूत एचसीएम्वी-IE1 प्रमोटर के नियंत्रण में जुगनू और Renilla luciferase plasmids की बढ़ती मात्रा के साथ ट्रांसफ़ेक्ट और ऊपर प्रोटोकॉल के साथ assayed गया. (ट्रांसफ़ेक्ट डीएनए की कुल राशि एक तटस्थ balancer प्लाज्मिड के उपयोग के द्वारा स्थिर रखा गया था). जुगनू linearity परख. जुगनू गतिविधि मूल्यों. बी Renilla linearity परख की एक व्यापक श्रृंखला के माध्यम से रेखीय रहता है ध्यान दें. 15 एनजी / अच्छी तरह से ऊपर की अवस्था के सपाट नोट.

ntent "के लिए: रखने together.within पृष्ठ =" हमेशा "> चित्रा 6
.. चित्रा 6 जुगनू luciferase परख के लिए क्षय संकेत के समय के पाठ्यक्रम luciferase अभिकर्मकों एक सीएमवी luciferase 0 समय पर निर्माण के साथ ट्रांसफ़ेक्ट एक ही थाली के लिए जोड़ा गया था; धारावाहिक माप आगे अभिकर्मकों के अलावा बिना किए गए थे.

घटक खंड अंतिम एकाग्रता
5 एनजी / μl में बीएसी 2002-D6 4 μl -
5X Phusion जीसी बफर 20 μl 1X
DMSO 6 μl 6%
dNTPs (10 मिमी) 2 μl 200 माइक्रोन
आगे प्राइमर (100 माइक्रोन) 1 μl 10 माइक्रोन
आरeverse प्राइमर (100 माइक्रोन) 1 μl 10 माइक्रोन
DDH 2 हे 65 μl -
Phusion डीएनए पोलीमरेज़ 1 μl -
कुल: 100 μl

तालिका 1. पीसीआर अल्फा synuclein प्रमोटर amplifying के लिए सेट अप.

नाम अनुक्रम प्रतिबंध साइट
SNCA7 5'-जीटीसी ggtacc tgaagttaacctcccctcaatacc -3 ' KpnI
SNCA8 5'-TGC gagctc aagaagacagccatctgcaagcc -3 ' Saci
SNCA1 5'-TCT gagctc tctgagcatttccctaggtg -3 ' Saci
SNCA2 5'-टैग ctcgag ggctaatgaattcctttaca -3 ' XhoI

.. तालिका 2 अल्फा synuclein प्रमोटर amplifying के लिए प्राइमर एनएसीपी दोहराएँ amplicon एक 0.9 केबी टुकड़ा का उत्पादन करना चाहिए; अन्य amplicon लंबाई 3.4 केबी है. प्राइमर स्थानों के लिए, चित्रा 2 देखें.

एक: 3X जुगनू परख बफर
शेयर समाधान (-80 डिग्री सेल्सियस पर स्टोर) 100 मिलीलीटर 3X जुगनू परख बफर प्रति वॉल्यूम अंतिम एकाग्रता (3X)
500 मिमी डीटीटी 3.0 मिलीलीटर 15 मिमी
10 मिमी coenzyme एक 6.0 मिलीलीटर 0.6 मिमी
100 मिमी एटीपी 0.45 मिलीलीटर 0.45 मिमी
80 मिलीग्राम / mlluciferin 0.525 मिलीग्राम </ P> 4.2 मिलीग्राम / मिलीलीटर
ट्राइटन lysis बफर 90.025 मिलीलीटर -
बी ट्राइटन lysis बफर
घटक (आरटी पर दुकान) 100 मिलीलीटर ट्राइटन lysis बफर प्रति वॉल्यूम अंतिम एकाग्रता
Tris-एचसीएल पाउडर 1.705 ग्राम 0.1082 एम
Tris आधार पाउडर 0.508 ग्राम 0.0419 एम
5 एम NaCl 1.50 मिलीलीटर 75 मिमी
1 एम 2 MgCl 0.30 मिलीलीटर 3 मिमी
ट्राइटन X-100 शुद्ध तरल 0.75 मिलीलीटर 0.25%
पानी 100 मिलीलीटर कुल मात्रा -
सी. 3X Renilla परख बफर
~ 100 मिलीलीटर 3X Renilla परख बफर प्रति वॉल्यूम अंतिम एकाग्रता (3X)
DMSO में 10 मिमी PTC124 0.6 मिलीलीटर 0.06 मिमी
इथेनॉल में 2 मिमी एच CTZ 0.5 मिलीलीटर 0.01 मिमी
Renilla साल्ट 100 मिलीलीटर -
डी. Renilla साल्ट
घटक (आरटी पर दुकान) 100 मिलीलीटर Renilla साल्ट प्रति वॉल्यूम अंतिम एकाग्रता
0.5 एम ना 2 EDTA 9.0 मिलीलीटर 45 मिमी
ना पाइरोफॉस्फेट 1.34 जी 30 मिमी
NaCl 8.33 जी 1.425 एम
पानी 100 मिलीलीटर कुल मात्रा -

तालिका 3. स्टॉक समाधान और जुगनू और Renilla luciferase assays के लिए परख बफ़र्स. ए 3X जुगनू परख बफर नुस्खा. डीटीटी, dithiothreitol. नोट किए जाने तक, सभी घटकों पानी में घुलनशील हैं. बी ट्राइटन. सी. 3X Renilla परख बफर नुस्खा बफर नुस्खा lysis. एच CTZ, एच coelenterazine. 100% EtOH के 12.2 मिलीग्राम और केंद्रित एचसीएल के 120 μl के लिए 10 मिलीग्राम एच CTZ जोड़कर 2 मिमी एच CTZ बनाओ. PTC124 DMSO. डी. Renilla लवण नुस्खा में घुलनशील है. ट्राइटन बफर lysis और Renilla लवण क्रमश: 4 डिग्री सेल्सियस और आरटी पर कई सप्ताह के लिए स्थिर रहे हैं. 3X जुगनू परख बफर और 3X Renilla परख बफर luciferase परख प्रदर्शन करने में 3-4 घंटे के भीतर मिलाया जाना चाहिए.

Subscription Required. Please recommend JoVE to your librarian.


अल्फा synuclein Lewy निकायों 4, रोग के लिए pathognomonic माना intracellular समावेशन के एक घटक के रूप में पार्किंसंस रोग (पीडी) में शामिल किया गया है. कई जीनोम चौड़ा संघ अध्ययन छिटपुट पीडी 5,6,7 के लिए बढ़ा जोखिम के साथ अल्फा synuclein में एकल nucleotide बहुरूपताओं जुड़ा हुआ है. छिटपुट पीडी से कम आम हालांकि, पारिवारिक पीडी भी रूप में अच्छी तरह दोहराव और अल्फा synuclein ठिकाना 9,10,11 के तीन प्रतीया बनाना के रूप में, अल्फा synuclein 8 में परिवर्तन की वजह से हो सकता है, एक घटना भी छिटपुट पीडी 12 में देखा. साथ में ले ली, इन अध्ययनों पीडी के रोगजनन के लिए अल्फा synuclein की केन्द्रीयता को सुदृढ़. इस स्क्रीन के उद्देश्य अल्फा synuclein कि विनियमित जीन की पहचान करने और इसलिए पार्किंसंस रोग के रोगजनन में एक भूमिका निभा सकते था. इस प्रोटोकॉल का उपयोग करना, हम 7670 मानव जीन की जांच की और 140 का प्रतिनिधित्व, 154 प्रारंभिक हिट्स (कम से कम inducers 3 गुना) की पहचान कीअद्वितीय जीन. ये हिट हिट reproducibility निर्धारित करने के लिए नए डीएनए तैयारी का उपयोग माध्यमिक assays के अधीन थे. 3 गुना रेंज में हिट्स बाद luciferase assays के 28% में reproduced. क्रमशः,, और 5 गुना inducers -, 5 - reproducibility 4 में 59%, 69%, और 78% की वृद्धि हुई. 7 गुना से अधिक inductions के साथ हिट समय की 100% reproduced. हम अंततः अल्फा synuclein प्रतिलेखन के 68 उपन्यास नियामकों की पहचान की.

सबूत की कई लाइनों हम प्राप्त 68 हिट अल्फा synuclein की असली नियामकों का सुझाव है कि. पहचान हिट की हमारी सूची में GATA3, पहले से SNCA अभिव्यक्ति 3 को विनियमित करने के लिए दिखाया प्रतिलेखन कारक के GATA परिवार का एक सदस्य भी शामिल है. कुछ ज्ञात SNCA नियामकों से एक स्कोरिंग हमारे स्क्रीन की विश्वसनीयता में महान आत्मविश्वास देता है. इसके अलावा, हम स्वतंत्र रूप से neuronal प्रतिलेखन कारकों में से एक ही परिवार के कई सदस्यों को मारता है, के रूप में रन बनाए स्क्रीन प्रतिलिपि प्रस्तुत करने योग्य और जीनों की पहचान नहीं है कि सुझावयादृच्छिक पर. सबसे महत्वपूर्ण बात, अतिरिक्त अनुवर्ती assays में, हमारे ऊपर की क्षमता overexpression और पछाड़ना assays में मान्य किया गया था neuronal कोशिकाओं में अंतर्जात SNCA अभिव्यक्ति को विनियमित करने के लिए पूरी करता है. हम BacMamvectors SY5Y डोपामिनर्जिक कोशिकाओं में 3 का उपयोग हिट शीर्ष के कुछ overexpressed और इन हिट फिल्मों का shRNA पछाड़ना कमी आई SNCA mRNA स्तर में हुई है, जबकि अंतर्जात SNCA स्तरों 2-8 गुना वृद्धि करने में सक्षम थे. इन अध्ययनों निर्णायक हमारे शीर्ष हिट अंतर्जात SNCA स्तरों के नियामकों हैं और deconstructed luciferase प्रणाली की बस कलाकृतियों नहीं कर रहे हैं कि प्रदर्शित करता है. अन्य सफल फिल्मों के लिए अतिरिक्त अनुवर्ती अध्ययन हमारे स्क्रीन में हिट की पूरी सूची के लिए सच झूठी सकारात्मक और नकारात्मक झूठी दरों का निर्धारण करने की आवश्यकता होगी. हिट और पार्किंसंस रोग के लिए उनके रिश्ते की एक पूर्ण विवरण तैयारी 14 में है.

यह हमारी स्क्रीनिंग पद्धति की सीमाओं पर विचार करने के लिए महत्वपूर्ण है. यह obv किया जाना चाहिएस्क्रीन किसी भी नियामक की पहचान नहीं होगा कि ious स्क्रीनिंग पुस्तकालय में मौजूद नहीं. हमारे स्क्रीनिंग पुस्तकालय मानव जीनोम के बारे में एक चौथाई से युक्त, पर्याप्त था, यह व्यापक नहीं था. हमारे परख की सादगी को देखते हुए अतिरिक्त पुस्तकालयों आसानी से जांच की जा सकती है. हम अपने माध्यमिक assays में, हिट की paralogs, जब उपलब्ध शामिल करके एक लक्षित तरीके से जांच की जीन की संख्या में वृद्धि हुई है. हम भी हमारे संवाददाता निर्माण में शामिल उन लोगों के बाहर जीनोमिक क्षेत्रों के लिए बाध्य है, जो किसी भी फिल्म के हिट स्कोर नहीं होगा. उचित क्षेत्र को शामिल करने की संभावना को अधिकतम करने के लिए, हमारे संवाददाता SNCA प्रमोटर में पाया कई प्रतिलेखन शुरू साइटों के लिए तत्काल flanking दृश्यों निहित. यह अतिरिक्त कारकों SNCA अभिव्यक्ति को विनियमित करने के लिए अब तक तत्काल प्रमोटर क्षेत्र के बाहर के क्षेत्रों के लिए है कि बाँध की संभावना है. अगर वांछित ये अतिरिक्त अपस्ट्रीम और डाउनस्ट्रीम क्षेत्रों के साथ स्क्रीन प्रदर्शन से पता लगाया जा सकता है, एक समय में केवल ~ 10 केबी एक हो सकता है, हालांकिकारण कुशल प्लाज्मिड वैक्टर में क्लोनिंग और उच्च प्रतिलिपि संख्या pGL4 वैक्टर की स्थिरता पर सीमाओं को इस ढंग से ssessed. वैकल्पिक रूप से, luciferase निर्माण SNCA ठिकाना युक्त बीएसी DNAs में लगाया जा सकता है. उत्तरार्द्ध दृष्टिकोण के लिए एक दोष यह भी आदर्श परिस्थितियों में BACS के अभिकर्मक तो> 100 गुना कम कुशल है 15 plasmids है. एक और दृष्टिकोण "दस्तक" के लिए luciferase संवाददाता अंतर्जात SNCA लोकस में, तो हमारे दृष्टिकोण में कहीं अधिक श्रमसाध्य है कि एक तरीका होगा. हम भी पहले से ही overexpression वृद्धि हुई luciferase गतिविधि में परिणाम नहीं करता है, ताकि स्तरों saturating में व्यक्त किया जाता है जो किसी भी हिट स्कोर नहीं होगा. इस कारण से हम SNCA विनियमित करने neuronal कारकों की कमी हो सकती है, और वास्तव में हम neuronal transcriptional कारकों की एक संख्या स्कोर था जो गैर neuronal 293T कोशिकाओं, रोजगार के लिए चुना है. 293T कोशिकाओं का एक संभावित नुकसान, तथापि, यह एक आवश्यक अगर हम एक हिट के रूप में किसी भी जीन स्कोर नहीं हो सकता हैdditional neuronal कारकों ठीक ढंग से काम करने के लिए. इस प्रकार, सभी स्क्रीन की तरह, हमारे अध्ययन संभावित SNCA नियामकों के एक नंबर याद सकता है. हालांकि, व्यावहारिक दृष्टि से, 68 हिट हम वृद्धि और अधिक से अधिक 10 गुना से SNCA के ज्ञात नियामकों की संख्या प्राप्त की और, ऊपर का पालन करने के लिए तो अतिरिक्त हिट हमारे मामले में आवश्यक नहीं हो सकता है काम के वर्षों की आवश्यकता होगी.

यह इस पद्धति का उपयोग हो सकता है कि संभावित कलाकृतियों का एहसास करने के लिए भी महत्वपूर्ण है. रासायनिक स्क्रीन में, luciferase बल्कि प्रतिलेखन के शामिल होने से से luciferase प्रोटीन का स्थिरीकरण द्वारा artifactually स्कोरिंग यौगिकों के लिए कुख्यात है. प्रोटीन स्थिरीकरण कलाकृतियों बाहर शासन करने के लिए, हम कई अन्य प्रमोटर-luciferase निर्माणों के खिलाफ हमारे हिट जांच की और विधान प्रमोटरों से अभिव्यक्ति को ऊपर उठाने के द्वारा बाद transcriptionally कार्य करने के लिए दिखाई दिया जो किसी भी हिट नहीं मिला. एक अन्य संभावित विरूपण साक्ष्य pGL4 वेक्टर रीढ़ की हड्डी को बांध के बजाय जो एक transactivating कारक हो सकता हैSNCA प्रमोटर. हम बड़े पैमाने पर इस समस्या से बचने के लिए बाध्यकारी साइटों प्रतिलेखन कारक को दूर करने के mutagenized किया गया है जो pGL4 वेक्टर कार्यरत हैं. हमारे हिट के किसी भी शामिल होने के लिए वेक्टर रीढ़ की आवश्यकता का आकलन है कि, हम किसी भी रीढ़ विहीन SNCA-luciferase वेक्टर क्षेत्र बढ़ाना पीसीआर इस्तेमाल किया और माध्यमिक assays के लिए एक पत्रकार के रूप में इस रैखिक टुकड़ा इस्तेमाल किया. हम अपनी पूरी प्लाज्मिड रिपोर्टर और एक अपवाद के साथ रैखिक रीढ़ मुक्त निर्माण के बीच प्रेरण मूल्यों में कोई महत्वपूर्ण अंतर पाया गया. GATA2 प्लाज्मिड रिपोर्टर के साथ ~ 15 गुना प्रेरण दिखाया, लेकिन GATA2 प्रेरण के कुछ कारण रीढ़ की हड्डी के घटकों के लिए बाध्य करने के लिए हो सकता है, सुझाव है कि रैखिक पत्रकार के साथ ही ~ 2.7 गुना,.

Transcriptional नियामकों की पहचान करने के लिए अन्य तरीकों का एक नंबर का वर्णन किया गया है. लगभग 30 साल पहले, ट्रांसफ़ेक्ट रिपोर्टर जीन की अभिव्यक्ति के माध्यम से मजबूत वायरल प्रमोटरों में सीआईएस से अभिनय transcriptional नियंत्रण तत्वों की मैपिंग स्था था16 ablished. इस विधि, कभी कभी यह उपयुक्त प्राथमिक सेल लाइनों प्राप्त और transfect करने के लिए मुश्किल है क्योंकि "प्रमोटर कोसने," सेल प्रकार विशिष्ट प्रमोटरों की मैपिंग के लिए एहसान से बाहर गिर गया है कहा जाता है, और इस तरह लाइनों को सही मूल के उनके ऊतकों का प्रतिनिधित्व नहीं कर सकते हैं. संलयन जीन का एक पुस्तकालय और एक विशिष्ट सीआईएस से अभिनय तत्व के बीच बातचीत का पता लगाने के लिए एक deconstructed संवाददाता प्रणाली प्रदान करके खमीर एक संकर प्रणाली 17 में गतिरोध उत्पन्न इस समस्या को. हमारा दृष्टिकोण अपने deconstructed डिजाइन में खमीर एक संकर प्रणाली के समान है, लेकिन हमारी प्रणाली में हम हम नहीं बल्कि खमीर से स्तनधारी कोशिकाओं को रोजगार, सामान्य अभिव्यक्ति क्लोन के बजाय जीन fusions रोजगार, और हम पक्ष द्वारा साइड मात्रात्मक अनुमति देता है जो रोबोटिक्स रोजगार प्रत्येक परीक्षा जीन के लिए कार्यात्मक readouts. एक होनहार विधि विशिष्ट जीनोम क्षेत्रों के लिए बाध्य प्रोटीन की पहचान 18 में वर्णित किया गया है की अनुमति देता है जो अलग chromatin क्षेत्रों (पिच) के प्रोटिओमिक्स करार दिया है, लेकिन अब तक नहींसफलतापूर्वक एकल प्रतिलिपि मानव जीन को लागू किया गया. जीनोम चौड़ा chromatin immunoprecipitation (चिप seq और चिप चिप) के अध्ययन के एक बड़े पैमाने पर 19 सीआईएस से अभिनय क्षेत्रों की पहचान करने के लिए इस्तेमाल किया गया है. इस विधि संभावित शक्तिशाली है, लेकिन, पिच की तरह, इस तरह आसानी से समरूप संस्कृति में प्राप्त नहीं कर रहे हैं जो विशिष्ट neuronal आबादी के रूप में सेल प्रकार के लिए कम उपयोगी हो सकता है. हम हमारे मान्य हिट के लिए चिप डेटाबेस की जाँच की है इसके अलावा, जब वे SNCA प्रमोटर के लिए इन हिट फिल्मों का बंधन नहीं दिखाया है. हम परंपरागत चिप 14 से SNCA प्रमोटर के लिए इन कारकों के बंधन को प्रदर्शित करने में सक्षम है के बाद से इस का कारण स्पष्ट नहीं है; लेकिन यह माइक्रोएरे readouts (चिप चिप) का उपयोग कर चिप पढ़ाई में नियोजित किया जा रहा है पूरे SNCA प्रमोटर क्षेत्र की कमी के कारण हो सकता है. हमारे विधि उत्पन्न करता है कि प्रत्यक्ष कार्यात्मक readouts के लिए युग्मित जब पिच, चिप seq, और अन्य प्रोटिओमिक दृष्टिकोण इसलिए सबसे अधिक उपयोगी हो सकता है.

दोहरे luciferaseassays जुगनू को रोजगार और Renilla luciferases उच्च throughput प्रारूप 20 में कई intracellular प्रक्रियाओं के अध्ययन के लिए एक संवेदनशील तरीका प्रदान करते हैं. जुगनू luciferase के लिए एक लक्ष्य प्रमोटर के संलयन अल्फा synuclein 1,2 सहित इन विट्रो में कई लक्ष्यों के transcriptional विनियमन और प्रमोटर संरचना का अध्ययन करने के लिए इस्तेमाल किया गया है. हम एक सस्ता विकल्प विकसित मजबूत संकेत प्रदान की है और हमारे परख की सीमा (चित्रा 6) में रैखिक था कि व्यावसायिक रूप से उपलब्ध दोहरे luciferase अभिकर्मकों के लिए. हमारे विधि उदारता एनआईएच और एक पहले से वर्णित गैर वाणिज्यिक दोहरे luciferase परख 21 में रॉन जॉनसन द्वारा प्रदान की एक प्रोटोकॉल से अनुकूलित है. जुगनू परख बफर कोशिकाओं lyses और एटीपी और luciferin प्रदान करता है, जुगनू luciferase की substrates. यह परख लगभग 1 घंटे की एक आधा जीवन (चित्रा 7) के साथ एक चमक प्रतिक्रिया पैदावार. Renilla परख बफर firefl quenchesY संकेत और उपयुक्त सब्सट्रेट (coelenterazine) प्रदान करता है. Renilla परख बफर ही कोशिकाओं lyse नहीं होगा और ट्राइटन lysis बफर या जुगनू परख बफर या तो साथ संयोजन में इस्तेमाल किया जाना आवश्यक है. हम आसानी से आरटी पर उपजी पहले वर्णित Renilla परख बफ़र्स, इस प्रकार हम सोडियम सल्फेट का सफाया कर दिया है और 60% से सोडियम पाइरोफॉस्फेट की राशि कमी हुई. हमारी परख भी PTC124, परख में अतिरिक्त शमन योगदान देता है कि जुगनू luciferase 22 की एक शक्तिशाली अवरोध करनेवाला भी शामिल है. शमन गतिविधि भी EDTA, NaCl, और Renilla बफर में पायरोफास्फेट द्वारा प्रदान की जाती है. इन नए योगों के साथ, जुगनू गतिविधि का लगभग 99.5% Renilla बफर से बुझती है. दोनों जुगनू और Renilla luciferase संकेत की तीव्रता और reproducibility थोड़ा (4.6 और 4.10 कदम) बफ़र्स के बाद इसके अलावा मिश्रण से सुधार किया गया.

हमारे अनुभव, पूरा एक मेंpGL4.10 में lpha-synuclein प्रमोटर शायद क्योंकि Intron 2 में जीसी अमीर क्षेत्रों और जटिल माध्यमिक संरचना की, बढ़ाना और क्लोन करने के लिए विशिष्ट मुश्किल है. हम अस्थिर आवेषण की क्लोनिंग के लिए अनुकूलित कर रहे हैं जो STBL4 सक्षम कोशिकाओं, के साथ सबसे सफल रहे थे. यहां तक कि इन सावधानियों का पालन, हम अक्सर एक उत्परिवर्ती बरामद जिसमें ई. कोली जीनोमिक डीएनए का निर्माण के 3 'अंत में डाला गया था. इस उत्परिवर्ती BamHI (सही क्लोन में 5.8 केबी और 2.8 केबी बनाम) के साथ पचा जब लगभग 5.8 केबी और 4 केबी के बैंड बनाता है और चयनात्मक प्लेटों पर बड़ा कालोनियों के रूप में प्रकट होता है. 30 डिग्री सेल्सियस और में सक्षम कोशिकाओं की सावधानी से विकास संतृप्ति घटने पहुंचने से संस्कृतियों को रोकने, लेकिन, उत्परिवर्ती उबरने की संभावना को खत्म नहीं करता. हम सभी प्रतिबंध डाइजेस्ट द्वारा डीएनए तैयारी और पूर्व अभिकर्मक को जेल वैद्युतकणसंचलन की शुद्धता की पुष्टि करने की सलाह देते हैं.

इस स्क्रीनिंग प्रोटोकॉल आसानी से एक, अन्य प्रमोटरों के लिए अनुकूल हैडी पहले से ही लक्ष्य प्रमोटर को विनियमित करने के लिए जाना जाता है के रूप में सकारात्मक और नकारात्मक नियंत्रण जीन का उपयोग कर, उसके अनुसार अनुकूलित किया जाना चाहिए. कई कारणों से रिपोर्टर plasmids के क्लोनिंग और अभिकर्मक के लिए लागू होते हैं. जुगनू luciferase संवाददाता प्लाज्मिड में लक्ष्य प्रमोटर क्लोन करने के दौरान, luciferase साइट के शुरू लक्ष्य जीन में translational शुरू साइट अनुमानित चाहिए. दोहरे luciferase स्क्रीन आमतौर पर प्लाज्मिड रीढ़ की हड्डी के प्रभाव को कम करने के लिए, ऐसे एचएसवी टी प्रवर्तक के रूप में, एक न्यूनतम प्रमोटर के नियंत्रण में Renilla प्लाज्मिड जगह है. हालांकि, हम इस प्रमोटर प्रेरित हमारे सकारात्मक नियंत्रणों में से एक है, इस प्रकार हम सीएमवी प्रमोटर के लिए चुना पाया. प्रत्येक संवाददाता प्लाज्मिड के रिश्तेदार राशि अनुभव से निर्धारित किया जाना चाहिए और प्रत्येक प्रमोटर के विधान गतिविधि से प्रभावित है. आदर्श आधारभूत (ट्रांसफ़ेक्ट, लेकिन uninduced) luciferase मायने रखता librar का पता लगाने की अनुमति, कम से कम दस गुना पांच को untransfected कोशिकाओं से पृष्ठभूमि पर होना चाहिएY दबाने जीन है कि या कम संकेत में परिणाम होगा जो कि कारण विषाक्तता,. पिछले स्क्रीनिंग के लिए, luminometers के बीच भिन्न हो सकते हैं, जो उम्मीद luciferase मायने रखता प्रत्येक परख के रैखिक सीमा के भीतर गिर सत्यापित करें कि. (हमारे Renilla हमारे परख में रैखिक सीमा के ऊपरी छोर पर आम तौर पर गिरावट मायने रखता है कि ध्यान दें.) हम इस प्रकार हम इस संवाददाता की कम से कम राशि का इस्तेमाल किया, जुगनू संवाददाता प्लाज्मिड पुस्तकालय डीएनए के अनुपात में वृद्धि उच्च inductions के परिणामस्वरूप.

अभिकर्मक प्रोटोकॉल के रूप में अच्छी तरह से अनुकूलित किया जाना चाहिए. हम अभिकर्मक की उनके रिश्तेदार आसानी के लिए 293T कोशिकाओं चुना है, जो की क्षमता एक centrifugation कदम (3.5 कदम) के अलावा के साथ 50 गुना वृद्धि हुई है. डोपामिनर्जिक लाइन SY5Y पर हमारे हाथ में कम transfectable 100 गुना, और, ऊपर चर्चा की, overexpression स्क्रीनिंग प्रदर्शन के लिए इष्टतम नहीं हो सकता है. हमारे इष्टतम परख समय अनुभवतः 48 घंटा होने के लिए निर्धारित किया गया था, इस प्रकार हमारी कोशिकाओं एक कम प्रारंभिक घनत्व पर चढ़ाया गया, 10-70% confluency पर कोशिकाओं transfect करने के लिए बनाया गया है जो Optifect, का उपयोग जरूरत महसूस. अन्य सेल लाइनों अलग प्रारंभिक घनत्व और अलग अभिकर्मक अभिकर्मकों आवश्यकता हो सकती है. हम (वर्तमान अगर अभिकर्मक दौरान विषाक्तता का कारण बन सकता है) एंटीबायोटिक दवाओं जोड़ने के लिए अभिकर्मक के बाद सेल मीडिया को बदलने के लिए चुना है. इस जीवाणु संक्रमण की संभावना कम हो जाती है, यह अन्य प्रणालियों के लिए इस प्रोटोकॉल आदत डाल जब इस प्रकार इस कदम की आवश्यकता मूल्यांकन किया जाना चाहिए, सामग्री (विशेष रूप से रोबोट pipet सुझावों) में लागत बढ़ जाती है. luciferase assays न्यूनतम अनुकूलन के साथ प्रयोग किया है, लेकिन एक अलग सेल प्रकार के साथ उच्च throughput में इस परख प्रदर्शन से पहले, कोशिकाओं उचित ट्राइटन lysis बफर द्वारा lysed हैं यह पुष्टि की जा सकती है. ट्राइटन X-100 coelenterazine autofluorescence का कारण बनता है कि ध्यान दें. हमारे परख में Renilla संकेत इस आशय तुच्छ काफी मजबूत था, लेकिन अन्य प्रकार की कोशिकाओं के लिए इस परख जब अनुकूलन, एमआई को ट्राइटन X-100 खंडों की सीमासेल के लिए आवश्यक निमल राशि.

हम क्षणिक एक दोहरे luciferase संवाददाता प्रणाली के साथ ट्रांसफ़ेक्ट कोशिकाओं का उपयोग अल्फा synuclein के उपन्यास transcriptional नियामकों की पहचान करने के लिए एक तेजी से और अपेक्षाकृत सस्ती स्क्रीनिंग विधि प्रस्तुत किया है. इस प्रोटोकॉल हित के अन्य जीन लक्ष्य को आसानी से परिवर्तनीय है और भी ऐसे lentivirus उत्पादन के रूप में 23 उच्च throughput transfections, की आवश्यकता होती है किसी भी आवेदन के लिए अनुकूलित किया जा सकता है.

Subscription Required. Please recommend JoVE to your librarian.


इस काम के लाइसेंस BacMamreagents (अमेरिकी पेटेंट 5731182) से प्राप्त रॉयल्टी द्वारा समर्थित किया गया.


हम डीएनए जांच पुस्तकालय की तैयारी के लिए MGH डीएनए कोर के जॉन दरगाह धन्यवाद. Perkin एल्मर के क्रिस्टोफर Chigas हमारे Wallac 1420 luminometer के लिए अमूल्य सहायता प्रदान की. स्टीवन Ciacco और Agilent के मार्टिन Thomae ब्रावो रोबोट के लिए सहायता प्रदान की. हम उदारता से उनके दोहरे चमक luciferase परख प्रोटोकॉल प्रदान करने के लिए एनआईएच पर रॉन जॉनसन और स्टीव टाइटस धन्यवाद.


Name Company Catalog Number Comments
QIAQuick PCR Purification Kit Qiagen 28106
PureLink Quick Gel Extraction Kit Invitrogen K2100-12
PureLink PCR Micro Kit Invitrogen K310250
PureLinkHiPure Plasmid Miniprep Kit Invitrogen K2100-03
PureLinkHiPure Plasmid Maxiprep Kit Invitrogen K2100-07
Bravo Robot Agilent -
Robot Pipet Tips with Filter Agilent 19477-022
Robot Pipet Tips without Filter Agilent 19477-002
Clear-bottomed 96-well Plates Corning 3610
Reservoirs Axygen RES-SW96-HP-SI
Polystyrene V-bottomed 96-well Plate Greiner 651101
Polypropylene V-bottomed 96-well Plate Greiner 651201
Adhesive Plate Covers CryoStuff #FS100
Phusion DNA Polymerase New England Biolabs M0530L
BAC 2002-D6 Invitrogen 2002-D6
Calf Intestine Alkaline Phosphatase Roche 10713023001
T4 DNA Ligase New England Biolabs M0202L
pGL4.10 Promega E6651
pGL4.74 Promega E6931
ElectroMAX Stbl4 Competent Cells Invitrogen 11635-018
Subcloning Efficiency DH5α Competent Cells Invitrogen 18265-017
DMEM without Phenol Red Invitrogen 31053-028
Optifect Invitrogen 12579017
Ciprofloxacin CellGro 61-277-RF
Tris-Hydrochloride Powder Sigma 93287
Tris-Base Powder Sigma 93286
Triton X-100 Pure Liquid Fisher BP151-100
DTT Invitrogen 15508-013
C–nzyme A Nanolight 309
ATP Sigma A6419
Luciferin Invitrogen L2912
h-CTZ Nanolight 301
PTC124 SelleckBiochemicals S6003



  1. Chiba-Falek, O., Nussbaum, R. L. Effect of allelic variation at the NACP-Rep1 repeat upstream of the α-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system. Hum. Mol. Genet. 10, (26), 3101-3109 (2001).
  2. Chiba-Falek, O., Touchman, J. W., Nussbaum, R. L. Functional analysis of intra-allelic variation at NACP-Rep1 in the alpha-synuclein gene. 113, (5), 426-431 (2003).
  3. Scherzer, C. R., et al. GATA transcription factors directly regulate the Parkinson's disease-linked gene α-synuclein. Proc. Natl. Acad. Sci. USA. 105, (31), 10907-10912 (2008).
  4. Spillantini, M. G., Schmidt, M. L., Lee, V. M. Y., Trojanowski, J. Q., Jakes, R., Goedert, M. α-Synuclein in Lewy Bodies. Nature. 388, (6645), 839-840 (1997).
  5. Pankratz, N., et al. Meta-analysis of Parkinson's disease: identification of a novel locus, RIT2. Ann. Neurol. 71, (3), 370-384 (2012).
  6. Satake, W., et al. Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat. Genet. 41, (12), 1303-1307 (2009).
  7. Simón-Sánchez, J., et al. Genome-wide association study reveals genetic risk underlying Parkinson's disease. Nat. Genet. 41, (12), 1308-1312 (2009).
  8. Polymeropoulos, M. H., et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science. 276, (5321), 2045-2047 (1997).
  9. Ibáñez, P., et al. Causal relationship between a-synuclein gene duplication and familial Parkinson's disease. Lancet. 364, (9440), 1169-1171 (2004).
  10. Chartier-Harlin, M. -C., et al. a-Synuclein locus duplication as a cause of familial Parkinson's disease. Lancet. 364, (9440), 1167-1169 (2004).
  11. Singleton, A. B., et al. a-Synuclein locus triplication causes Parkinson's disease. Science. 302, (5646), 841 (2003).
  12. Ahn, T. -B., et al. a-Synuclein gene duplication is present in sporadic Parkinson disease. Neurology. 70, (1), 43-49 (2008).
  13. Boyce, F. M., Bucher, N. L. Baculovirus-mediated gene transfer into mammalian cells. Proc. Nat. Acad. USA. 93, (6), 2348-2352 (1996).
  14. Montigny, W. J., et al. Parameters influencing high-efficiency transfection of bacterial artificial chromosomes into cultured mammalian cells. Biotechniques. 35, 796-807 (2003).
  15. Gorman, C. M., Moffat, L. F., Howard, B. H. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, (9), 1044-1051 (1982).
  16. Li, J. J., Herskowitz, I. Isolation of ORC6, a Component of the Yeast Origin Recognition Complex by a One-Hybrid System. Science. 262, 1870-1874 (1993).
  17. Dejardin, J., Kingston, R. E. Purification of Proteins Associated with Specific Genomic Loci. Cell. 136, 175-186 (2009).
  18. Shen, Y., et al. A map of the cis-regulatory sequences in the mouseGenome. Nature. 488, 116-120 (2012).
  19. Fan, F., Wood, K. Bioluminescent assays for high-throughput screening. Assay Drug Dev. Technol. 5, (1), 127-136 (2007).
  20. Hampf, M., Gossen, M. A protocol for combined Photinus and Renilla luciferase quantification compatible with protein assays. Anal. Biochem. 356, (1), 94-99 (2006).
  21. Auld, D. S., Thorne, N., Maguire, W. F., Inglese, J. Mechanism of PTC124 activity in cell-based luciferase assays of nonsense codon suppression. Proc. Natl. Acad. Sci. USA. 106, (9), 3585-3590 (2009).
  22. Pearlberg, J., et al. Screens using RNAi and cDNA expression as surrogates for genetics in mammalian tissue culture cells. Cold Spring Harb.Symp. Quant. Biol. 70, 449-459 (2005).



    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics