הפקת חומצות גרעין יעיל 16S rRNA ג'ין רצף עבור בקטריאלי קהילת אפיון

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

אנחנו מתארים שיטה יעילה, איתנה, וחסכונית לחילוץ חומצות גרעין מן מטליות לאפיון של קהילות חיידקי באמצעות רצף amplicon הגן 16S rRNA. השיטה מאפשרת גישה עיבוד משותף סוגי מדגם מרובים ויכול להכיל מספר תהליכים טיפוליים במורד הזרם.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ישנה הערכה גוברת לתפקיד של קהילות חיידקים כמו מאפננים חשובים לבריאות אדם ומחלות. טכנולוגיות רצף תפוקה גבוהה אפשרו לאפיון מהיר ויעיל של קהילות חיידקי באמצעות רצפי גנים 16S rRNA ממגוון מקורות. למרות כלים זמינים עבור ניתוח רצף 16S rRNA יש זרימות עבודה חישובית סטנדרטיות, עיבוד מדגם להפקת DNA נשאר מקור המשך של השתנות בין מחקרים שונים. כאן אנו מתארים שיטה יעילה, איתנה, וחסכונית לחילוץ חומצות גרעין מ מטליות. אנחנו גם להתוות שיטות במורד הזרם עבור סידור הגן 16S rRNA, כולל דור של ספריות רצף, בקרת איכות נתונים, וניתוח רצף. זרימת העבודה יכולה להכיל סוגי דגימות מרובים, כוללים שרפרף מטליות שנאספו במגוון מיקומים אנטומיים של פונדקאי. בנוסף, התאושש DNA ו- RNA ניתן להפריד ומשומשיםעבור יישומים אחרים, כולל רצף הגנום כולו או-seq RNA. השיטה המתוארת מאפשרת גישת עיבוד משותפת סוגי מדגם מרובים להכיל ניתוח במורד זרם של מידע גנומי, metagenomic ו תעתיק.

Introduction

האדם נמוך במערכת הרבייה, מערכת העיכול, מערכת הנשימה, העור הם יישבו על ידי קהילות חיידקי מורכבות שאינן קריטית לשמירה על הומאוסטזיס רקמות ותמיכה הבריאות של המארח 1. למשל, לקטובצילוס מסוימים ליצור סביבה עוינת עבור פתוגנים על ידי acidifying בכספת הנרתיק, ייצור effectors מיקרוביאלית ויסות חסינות המארח המקומי 2-4. האהדה הגוברת לחשיבות של Microbiome החיידקים גם גדלה עניין באפיון קהילות חיידקים בהקשרים קליניים רבים. כאן נתאר שיטה כדי לקבוע את ההרכב של Microbiome חיידקי מטליות איברי המין. הפרוטוקול ניתן לשנות בקלות עבור דגימות צואה מטליות שנאספו ממקומות אנטומיים אחרים ומינים מארחים אחרים.

בשל המגבלות המובנות במספר הדגימות שניתן נאספות ונשמרו מן הרבעה נתונהמשתתף y, פרוטוקול זה נועד לחלץ DNA, RNA, ואפשרות אפילו חלבון מן ספוגית יחידה באמצעות 5,6 שיטת הכאת חרוז המבוססת מותאמת פנול, כלורופורם. השילוב של הפרעה הפיסית של קירות תא חיידק עם הכאת חרוז ושיבוש כימי עם דטרגנטים מאפשר תמוגה מהירה של גראם חיובי, גראם שלילי, וחומצה-מהר חיידקים ללא צעדי עיכול אנזימטי נוספים. כדי להשיג RNA באיכות גבוהה, מומלץ להשתמש מטליות יבשות כי הוחזקו בבית או מתחת ל -4 מעלות צלזיוס מיד לאחר איסוף במהלך ההובלה למעבדה (אם רלוונטי), לטווח ארוך מאוחסן ב -80 מעלות צלזיוס.

כדי לקבוע את Microbiome החיידקים בתוך מדגם נתון, הליך זה מנצל רצף amplicon גן 16S rRNA, אשר נמצא כעת את האמצעים הכי חסכוני להקצות הטקסונומיה של חיידקים מקיפים ולבצע כימות יחסיות. שיטות חלופיות כוללות ממוקד 7 qPCR, מנהג microarrays 8, ו-הגנום כולו רצף 9. גן 16S rRNA מכיל תשעה אזורי hypervariable, ואין הסכמה לגבי אזור V האופטימלי שממפה ללימודי Microbiome בנרתיק. כאן אנו משתמשים סט פריימר 515F / 806R ולבנות על צינור שעיצב Caporaso et al. 10-12. Caporaso et al. 'S 515F / 806R סט פריימר מאפשר ריבוב של מאות דגימות על ריצה רצף יחיד בשל הזמינות של אלפי פריימרים המינימרקטים תוקף ותאימות עם פלטפורמות רצף Illumina. בניגוד פריימר 27 ו / 338R של הפרויקט Microbiome האדם להגדיר 13, 515F / 806R גם ביעילות מגביר Bifidobacteriaceae ובכך במדויק לוכדת Gardnerella vaginalis, חבר חשוב של הקהילה חיידקים בנרתיק אצל חלק מהנשים. לחלופין, זוג פריימר 338F / 806R שמש בהצלחה עבור pyrosequencing של דגימות מנרתיק 14 וזוג פריימר 515F / 926R יש recently מתפרסם עבור סידור הדור הבא 12.

לבסוף, פרוטוקול זה מספק הוראות בסיסיות לבצע 16S ניתוח amplicon באמצעות תובנות כמותי לתוך אקולוגיה מיקרוביאלית (QIIME) תוכנה חבילה 15. יישום מוצלח של פקודות QIIME המתוארות כאן מניב טבלה המכילה שכיחותם טקסונומיות חיידקים עבור כל דגימה. רבים צעדים נוספים בקרת איכות, שיטות הסיווג הטקסונומי, וצעדים ניתוח ניתן לשלב ניתוח, כמתואר בפירוט באתר QIIME (http://qiime.org/index.html). אם הניתוח יבוצע על מחשב אפל, חבילת MacQIIME 16 מספקת התקנה קלה של QIIME ויחסי התלות שלה. חבילות תוכנה אלטרנטיביות לניתוח רצף גן 16S rRNA כוללות Mothur 17 UPARSE 18.

Protocol

פרוטוקול המחקר אושר על ידי ועקב אחר ההנחיות של ועדת האתיקה למחקר ביו-רפואי מאוניברסיטת קוואזולו נטאל (דרבן, דרום אפריקה) ו הדירקטוריון סקירה מוסדיים החולים הכללי של מסצ'וסטס (2012P001812 / MGH; בוסטון, MA).

1. הפקת חומצות גרעין סך מטליות הצרויקו

הערה: בצע עקירות חומצות גרעין בסטים של 16 דגימות או פחות. הפרוטוקול כפי שנכתב להלן מניח דגימות מעובדי סטים של 12. אם ביצוע סבבים רבים של עקירות, סדר למספר את קבוצות החילוץ ולהקליט כל מספר אצווה החילוץ של מדגם וכן מידע מדגם אחר (כולל metadata כגון מספר תעודת זהות של המשתתף, גיל , תאריך / שעה של אוסף ספוגי, סוג מניעה הורמונליים, תוצאות בדיקות זיהום המועברות במגע מיני, וכו ') בלוח 1.

  1. הכנת ריאגנטים במנדף
    1. התאם את ה- pH של פנול: כלורופורם: אלכוהול isoamyl (רש"ת) (25: 24: 1) ל -7.9 pH על ידי הוספת 65 μl של חיץ אלקליין טריס לכל 1 מ"ל פנול, לוחץ את התערובת במשך 2 דקות, ומאפשר שני שלבים נפרד באופן טבעי או על ידי צנטריפוגה ב XG 10,000 במשך 5 דקות ב RT.
      זהירות: פנול הוא רעיל בבליעה, אם נשאף, או במגע עם עור ועיניים. לא לנשום אדי. יש להשתמש בכפפות אטומות, משקפי מגן עם מגן בצד, וחלוק מעבדה.
    2. מסנן לעקר 25 מ"ל של סולפט dodecyl נתרן 20% (SDS) דרך פילטר 0.22 מיקרומטר. הפוך 5 מ"ל aliquots של SDS מעוקרים.
    3. צ'יל aliquot 10 מ"ל של isopropanol ב -20 ° C.
    4. להכין צינור מכות חרוז לכל זהwab להיות מעובד על ידי שקילה מתוך 0.3 גרם של חרוזי זכוכית לתוך צינור מ"ל 2 סטרילי כי הוא מתאים מקצף חרוז.
    5. השג דגימות באמצעות דגימת ectocervix בספוגית סופגת סטרילית. מיד לאחר איסוף, למקם את ספוגית לתוך cryovial ריק וסטרילי, ולאחסן ב 4 מעלות צלזיוס במשך 1 עד 4 שעות במהלך ההובלה למעבדה, ולאחסן במשך מספר חודשים ב -80 ° C. מעביר את המטליות (המוקפת צינורות בודדים) להיות מעובד לקרח רטוב.
    6. הכן את ארון הבטיחות הביולוגי (BSC). השתמש BSC עם "אצבעון" מחובר פליטת הבניין על מנת להבטיח הסרה תקינה של כימיקלים נדיפים.
      1. הסר את כל החומרים ממכסת המנוע.
      2. נקו את כל המשטחים של מכסה המנוע עם אקונומיקה, ואחריו decontaminant שמסיר RNases, DNases, ו- DNA ממשטחים. הפריטים יש לנקות את כל הבאים הביאו בתוך הברדס באמצעות אקונומיקה ואחריו decontaminant חומצות גרעין, כוללים כפפות. השתמש ריאגנטים RNase / DNase ללא טריים, כגון pטיפים ipette, בכל הזדמנות אפשרית.
      3. קלטת שקית Biohazard כימי מעוקרת לחלק האחורי של מכסה המנוע. כל פסולת היבשה המכילה פנול או כלורופורם צריכה להיות ממוקמת בתוך שקית זו לסילוק נאות.
      4. מניחים בקבוק סטרילי לתוך מכסה המנוע כדי לאסוף פסולת נוזלית המכילה פנול או כלורופורם.
  2. חילוץ פנולים, כלורופורם.
    1. ב למכסה המנוע, צינור אחד מכות חרוז, להוסיף 500 μl של חיץ (משלב 1.1.1), 210 μl של סולפט dodecyl נתרן 20%, ו -500 μl של פנול: כלורופורם: רשות העתיקות (25: 24: 1, pH 7.9 ).
    2. מעביר את הספוגית מבקבוקון התחבורה לתוך הצינור הפועם חרוז באמצעות זוג חדש של מלקחיים סטריליות. ביסודיות לשפשף את הראש מקלון נגד הקירות הפנימיים של הצינור מכות חרוז עבור 30 שניות לפחות. Re-כובע המדגם בסיום. אם ביצוע עקירות מן המטליות מרובות, לשנות כפפות בין כל דגימה.
    3. צ'יל המדגם על קרח במשך לפחות 10 דקות. הסר את הספוגית מןחרוז פועם צינור ידי החזקת הידית הספוגית עם פינצטה סטרילית תוך כדי הלחיצה על הראש הספוגי בקיר הצינור הפנימי באמצעות קצה P200 נקי. מחק את המטליות בשקית הפסולת כימי היבשה. הערה: פעולת "המגב" (לחיצה על הראש הספוגי) תשחרר נוזלי מהמקלון סופג ולהגדיל את התאוששות חומצות הגרעין.
    4. מניחים את הצינור מכות חרוז נכנס למחבט חרוז homogenize עבור 2 דקות ב 4 ° C.
    5. צנטריפוגה הצינור הפועם חרוז 3 דקות ב 6000 XG ו -4 ° C עד הגלולה פסולה ולהפריד את השלבים מימיית פנול.
    6. מעביר את השלב המימי (~ 500 - 600 μl) לצינור 1.5 מיליליטר סטרילי. הוסף נפח שווה של פנול: כלורופורם: רשות העתיקות. מערבבים על ידי היפוך vortexing קצר.
    7. צנטריפוגה הצינור במשך 5 דקות ב XG 16,000 ו -4 מעלות צלזיוס.
    8. מעביר את השלב המימי כדי צינור 1.5 מיליליטר סטרילית חדש. להיות שמרני לא להעביר חומר משכבת ​​הביניים או פנול שבבסיסשלב. הערת היקף השלב המימי העבירה. שמור את השלב פנול לבידוד חלבון בעתיד.
    9. להוסיף 0.8 נפח isopropanol ו -0.1 היקף נתרן אצטט 3M (pH 5.5). מערבבים היטב על ידי היפוך vortexing בקצרה.
    10. לזרז את חומצות גרעין על ידי מצמרר את הצינור ב -20 מעלות צלזיוס במשך שעה לפחות 2 (עד O / N).
  3. ממטרים ואתנול Isopropanol לשטוף
    1. צנטריפוגה הצינור במשך 30 דקות ב כ XG 16,000 ו -4 מעלות צלזיוס. בזהירות להשתמש פיפטה להסיר את supernatant, עוזב את הגלולה ללא פגע.
    2. הוסף 500 μl של 100% אתנול. לעקור את הגלולה עם vortexing או pipetting העדינים בלי לגעת הגלולה. צנטריפוגות במשך 5 דקות ב XG 16,000 ו -4 מעלות צלזיוס.
    3. בזהירות להתעלמות supernatant אתנול. השתמש pipet P10 להסיר אתנול ככל האפשר מבלי להפריע גלולה.
    4. האוויר יבש גלולה ב RT במשך 15 דקות.
    5. Resuspend גלולה ב 20 μl מבנים תת-קרקעltra-טהור 0.1x חיץ טריס-EDTA. אפשר המדגם לצנן על קרח למשך 10 דקות ו פיפטה מספר פעמים כדי להבטיח resuspension מלא. אם הגלולה אינה מתמוססת, להעביר את הצינור כדי לחסום חום C 40 ° עד 10 דקות כדי לסייע פירוק.
    6. למדוד את ריכוז חומצות גרעין באמצעות ספקטרופוטומטר 19.
    7. אם תרצה, DNA נפרד מ- RNA באמצעות ערכת ניקוי טור, בעקבות של פרוטוקול היצרן 20.
    8. אחסן את חומצות גרעין ב -80 ° C או להמשיך.

2. הגברת PCR של אזור 16S rRNA ג'ין V4 Hypervariable

הערה: בצע את הגברת PCR בסטים של 12 דגימות או פחות כדי להקטין את הסיכון של זיהום וטעויות אנושות. אם ביצוע סבבים רבים של הגברה, סדר למספר את אצוות ההגברה ולהקליט כל המספר יצווה הגברה של מדגם בטבלה 1.

  1. להכנת מי שתייהf ריאגנטים ברדס PCR
    1. הוסף את המידע להגדיר הגברת PCR טבלת 1, אשר ישמש כבסיס של קובץ המיפוי בשלב ניתוח רצף.
    2. הסר את כל החומרים מתוך מכסה מנוע PCR ו לנקות את המשטחים הפנימיים ביסודיות עם אקונומיקה ואחריו decontaminant מסיר RNases, DNases, ו- DNA. הקפד לטהר כל מגיב פיסת הציוד (למשל, טפטפות) לפני הצבת בתוך הכובע. יש להשתמש בכפפות טריות לנקות עם decontaminant חומצות גרעין לפני העבודה בתוך הכובע.
    3. במידת הצורך, לדלל את תבנית חומצות גרעין כדי 50 - 100 ng / μl באמצעות מים DNA חופשי nuclease חינם.
    4. aliquots הפשרה של באיכות הגבוהה 5x (HF) החיץ, dNTPs, ו פריימרים בשכונת PCR הנקיה. בעדינות מערבולת ו צנטריפוגות כל פתרונות לאחר ההפשרה. כדי למזער להקפיא להפשיר מחזורים ואת הסיכון לזיהום המניות, להכין aliquots של חיץ 5x HF, dNTPs, ו פריימרים.
    5. מקוםbenchtop הנקי מתל מצנן צינורות microcentrifuge צידנית צלחת PCR לתוך מכסה המנוע.
  2. לקבלת תגובת PCR, להכין מיקס מאסטר על ידי שילוב 15.5 μl של מים טהורים, 5 μl של חיץ 5x HF, 0.5 μl של dNTPs, 0.5 μl של פריימר 515F קדימה, 0.75 μl של 3% DMSO, ו 0.25 μl של פולימראז עבור כל תגובה. הרכב את כל מרכיבי התגובה בחדר הקירור ולהוסיף פולימראז האחרון. לערבב היטב על ידי pipetting. הוסף שתי דגימות נוספות כדי לספור תגובה בעת הכנת מיקס מאסטר, לתת דין וחשבון על שגיאת pipetting.
  3. הגדרת תגובת PCR:
    הערה: בצע amplifications בשלושה עותקים, כלומר כל דגימה מוגברת בשלוש תגובות μl 25 נפרדות. הפעל שליטת מים ללא תבנית עם כל זוג פריימר. לעבוד מהר אבל בזהירות, הימנעות כניסתה של כל זיהום.
    1. לייבל רצועת 8-גם עם כובעי פרט ומקום לתוך צידנית PCR.
    2. פיפטה 90 μl של תמהיל מאסטר לתוך הראשוןטוֹב.
    3. הוסף 2 μl של פריימר הפוכה (קובץ משלימה 1). הקפד לציין את הברקוד פריימר הפוך בזהירות בשימוש עם כל דגימה בטבלה 1.
    4. מערבבים היטב ומעבירים 23 μl של מיקס מאסטר הבאר הרביעי (הבקרה ללא תבנית).
    5. הוסף 2 μl של מים אל הבאר הרביעית.
    6. הוסף 6 μl של המדגם המתאים הבאר הראשונה. מערבבים היטב ומעבירים 25 μl לבאר השני. טיפי שינוי ולהעביר עוד 25 μl מהבאר הראשונה לשלישי היטב. בתוקף מכסה כל טוב, כדי לוודא שלא לגעת בפנים של בארות או כובע בתהליך.
    7. חזור על הפעולה עבור כל דגימה.
  4. בצע הגברת PCR
    1. העברת צינורות הרצועה על thermocycler ולהפעיל את התכנית הבאה: 30 שניות על 98 מעלות צלזיוס, ואחריו 30 מחזורים של 10 שניות ב 98 מעלות צלזיוס, 30 שניות ב 57 מעלות צלזיוס ו -12 שניות על 72 מעלות צלזיוס, ואחריו 10 דקות להחזיק ב 72 מעלות צלזיוס, אחיזה סופיתt 4 מעלות צלזיוס.
    2. בצע את השלבים הבאים על ספסל מעבדה נקי. במהירות לסובב את הצינורות כדי לאסוף נוזל מהקירות. שלב תגובות PCR בשלושה עותקים מכל מדגם, בהיקף כולל של 75 μl, לתוך צינור שכותרתו סטרילי. כמו כן להעביר 25 μl של כל פקד ללא תבנית לתוך צינור סטרילי נפרד. אין לשלב amplicons ממדגמים שונים עדיין.
  5. אימות של הגברת PCR המוצלחת של דגימות על ידי ג'ל אלקטרופורזה.
    1. הכן ג'ל 1.5% agarose (1.5 גרם אבקת agarose ב 100 מ"ל של חיץ 1x טה) עם בארות מספיק כדי להחזיק בכל amplicon, בקרת מים, סולם 21.
    2. בעוד מתקשה ג'ל (כ -30 דקות), להכין את המדגם עבור אלקטרופורזה: מוסיפים 1 μl של צבע טעינת 6x לצינור חדש, שכותרתו. כדי צינור מכן, להוסיף 5 μl של amplicon ומערבבים ידי pipetting.
    3. כאשר הג'ל קבעה, מסלק את היערה, מניחים את הג'ל במיכל אלקטרופורזה, ולמלא את המיכל עם חיץ 1x טה. כדי הבאר הראשונה, להוסיף 5 μl של סולם ה- DNA.
    4. טען 5 μl על amplicon מדגם למשנהו היטב. טען 5 μl של amplicon ללא תבנית באר נפרד. המשך לפי הצורך עבור כל דגימה.
    5. כאשר כל הדגימות הוטענו, החלק את המכסה טנק במקום ולהדליק את מקור הכוח 120 V. אפשר ג'ל לרוץ 30 - 60 דקות.
    6. הצג את הג'ל תחת אור UV.
      1. אמת הגברה מוצלחת של כל דגימה על ידי וציין להקה חזקה אחת כ -380 נ"ב. אם יש להקה כפולה, מחדש להגביר מדגם עם ברקוד הפוכה שונה (שלב 2.3). אם אין להקה בכלל, מחדש להגביר במדגם או באמצעות אותו ברקוד הפוכה או ברקוד ההפוכה חדשה (שלב 2.3). אם מחדש ההגברה אינה מצליחה, מעכבי PCR רשאיים להיות נוכחים במדגם, ובמקרה זה, לבצע ניקוי DNA מבוסס עמודה כדי להסיר מעכבי PCR.
        הערה: הגברה מוצלחת לא יכולה להיות אפשרית אם ריכוז ה- DNA חיידקים אומדגם iginal אינו מספיק (<5 ng / μl).
      2. בדוק את חוסר זיהום מגיב באמצעות ציון בהיעדר להקה בבקרה ללא תבנית.
    7. אחסן את amplicon 70 μl של הנותרים ב -20 ° C. מחק את הנותרים 20 μl של שליטה ללא תבנית, בהנחה שזה לא הניב הלהקה.

3. איגום ספריית רצף תפוקה גבוהה

  1. צור ברכת amplicon ידי שילוב נפח שווה (2 - 5 μl) של כל amplicon לתוך צינור סטרילי יחיד. אם הלהקה ממדגם נראית חלשה במיוחד, להוסיף כפול ביחס הנפח לשאר הדגימות.
  2. הסר את פריימרים PCR ממאגר amplicon באמצעות ערכת ה- PCR ניקוי, בעקבות הוראות היצרן 22. בצע את לנקות עם מספר עמודות אם נפח ברכת amplicon הוא מעל 100 μl. הערה: כל טור בעל קיבולת 100 μl.
    1. אחסן את הספרייה ב -20 & #176; C או להמשיך לשלב הבא.
  3. במידה והדבר אפשרי, לשלב את בריכות amplicon ללא פריימר כדי ליצור את הספרייה הסופית. קבע את ריכוז DNA של הספרייה באמצעות ספקטרופוטומטר או מערכת fluorometric 23. יחס 260/280 בין 1.8 - 2.0 הוא מעיד על דנ"א טהור.
  4. לדלל את הספרייה עד 20 ננומטר. אשר את האיכות של הספרייה על ידי הדמית להקה אחת כ -400 נ"ב באמצעות מכשיר אלקטרופורזה. אשר את הריכוז של הספרייה באמצעות מערכת fluorometric 23.
  5. בצע דילול 1:10 סופי במים לדלל לספרייה 2 ננומטר. לאחר מכן, לאחסן את הספרייה ב 20 ° C ללא הגבלת זמן.
  6. שלח aliquot של הספרייה הסופית עם פריימרים רצף שלושה נדרש (קרא 1, קרא 2, ואינדקס; ראו לוחות חומרים / ציוד) כדי להיות רצף על ברצף Illumina. אם פחות מ -300 דגימות כבר מרובבים על רצף, השתמש בטווח אחת-סוף -300 נ"ב ועם מדד 12 נ"ב לקרוא oנה MiSeq, עם ריכוז ספרייה סופי 5 בערב, ספייק-ב PhiX מפוגל 10%. עיין חומרים המשלימים של Caporaso et al. IsMe J, 2012 10 לקבלת הוראות רצף מפורטות.

ניתוח רצף 4.

הערה: מתואר כאן היא צינור בסיסי לניתוח רצף באמצעות חבילת תוכנת 1.8.0 QIIME. לשם הפשטות, את הפקודות הניתנים להניח כי קובץ מיפוי נקרא mapping.txt, מדד 12 נ"ב לקרוא קובץ נקרא index.fastq, ואת רצף -300 נ"ב לקרוא קובץ נקרא sequences.fastq. התקן QIIME או MacQIIME 16 וכן היכרות עם היסודות של UNIX כדי לבצע פקודות אלה. קראו את המדריך השלם QIIME ב:

  1. השלם את קובץ מיפוי לצורך הניסוי (טבלה 1). לכלול מטה האפשר. שים לב אילו דגימות הופקו או מוגברות באותו יצווה, כדי לברר אם קיימים תופעות יצוו.
  2. למשל, mapping.txt. אמת את העיצוב של קובץ מיפוי על ידי הפעלת הפקודה הבאה: validate_mapping_file.py -m mapping.txt -o mapping_output
    הערה: פקודה זו משתמשת תסריט QIIME "validate_mapping_file.py" המובנה שגורם תיקייה חדשה, בשם "mapping_output", המכיל קובץ .html המציין את שגיאות קובץ מיפוי, אם בכלל.
  3. בדוק את איכות הרצף קורא באמצעות איכות נתוני רצף תפוקה גבוהה בדיקת תכנית, כגון FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). איור 5 מדגים את רצף לכל בסיס האיכות כי ניתן לצפות מן ריצה מוצלחת.
    הערה: ברצף מקצה לכל בסיס נוקלאוטיד ציון באיכות Phred, אשר תואם ההסתברות כי הבסיס כבר נקרא בטעות. ציון איכות Phred של 10 מצביע על כך שיש סיכוי של 10% כי נוקליאוטידים כבר שגוי להקצותed, 20 מצביע על סיכוי של 1%, 30 מצביעים על סיכוי 0.1%, ו -40 (הציון הגבוה ביותר האפשרי) מצביע על סיכוי של 0.01% 24.
  4. באמצעות קובץ מיפוי כמפתח, demultiplex, איכות לסנן את הנתונים רצף, ולשמור את התוצאות לתיקייה (במקרה הזה, הנקרא "sl_out") על ידי הפעלת פקודה זו 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    הערה: דגל q מציין את ציון Phred איכות מקובלת המרבית, למשל, "-q 29" מסננים רצפים עם ציוני Phred מתחת ל -30, כדי להבטיח דיוק 99.9% מהפניות הבסיס.
  5. שימוש ביחידת טקסונומיות מבצעית Greengenes 16S הנתונים להפניה (OTU) 26 (http://qiime.org/home_static/dataFiles.html), לבצע OTU פתוח הפניה לקטוף שהרצתו בפקודה זו 27: pick_open_reference_otus.py -i sl_out / seqs. Fna -r 97_otus.fasta -o ucrss / -s 0.1
    הערה: דגל -s מצייןאת החלק היחסי של רצפים שלא הצליח ליישר נתונים להפניה כי ייכללו התקבצות דה נובו. "-s 0.1" כולל 10% של רצפים נכשל התקבצות דה נובו. השתמש דגל -a כדי למקבל התהליך לקטוף OTU ולהפחית את זמן עיבוד מימים לשעות אם ליבות מרובות זמינות.
  6. צור טבלה שפע טקסונומיות ידידותי למשתמש על ידי מיזוג OTUs ברמת המין שהרצתו בפקודה זו 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    הערה: הטבלה וכתוצאה מכך ניתן לצפות בקלות בכל תוכנת גיליון אלקטרוני. שים לב רצף 16S rRNA אינו מהימן לספק רזולוצית מיני רמה.
  7. קבע את הגיוון האקולוגי בתוך כל דגימה באמצעות חישוב מדדי המגוון אלפא כמה עם alpha_diversity.py סקריפט QIIME. לאחר מכן, לקבוע את המגוון בין זוגות של דגימות בעזרת beta_diversity.py סקריפט QIIME.
  8. Visualize הנתונים, למשל, באמצעות קרן 29 קיסר קואורדינטות עלילה או מפת חום.
  9. לבצע השוואות סטטיסטיות רשמיות של קטגוריות קובץ מיפוי, למשל, עם תסריט compare_catagories.py של QIIME 30.

Representative Results

הסקירה הכללית של הפרוטוקול המאפשר קביעת שכיחותם חיידקי יחסים מן ספוגית באמצעות רצף גן 16S rRNA, מוצגת באיור 1 .the פרוטוקול כבר מותאמת למשטח מנרתיק אדם, אך ניתן להתאים בקלות עבור אתרי דגימה הרירית ביותר ומארחים אחרים. איור 2 מדגים את ה- DNA באיכות הגבוהה ו- RNA כי ניתן לבודד באמצעות פרוטוקול הכאת חרוז. איור 3 ממחיש הגברת PCR מוצלחת של 12 דגימות, שבו כל הגברה עם מדגם ניב להקה חזקה אחת של הפוליטיקלי גודל כל פקד במים לא ניב להקה. תרשים 4 מתארים את כימות של ברכת הספרייה הסופית לפני הסידור. איור 5 מראה פרופיל איכות רצף טיפוסי אחרי ריצת MiSeq חד סוף -300 נ"ב.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
איור 1. סכמטי סקירה כללית של פרוטוקול. ראשית, חומצות גרעין מופק ספוגית ידי הכאת חרוז בתמיסה שנאגרו המכיל פנול, כלורופורם ולאחר isoamyl אלכוהול. אזור משתנה 4 של הגן 16S rRNA מוגבר אז מן חומצות גרעין וכתוצאה מכך באמצעות PCR. amplicons PCR ממרחק של עד מאות דגימות מצורפות יחד להפיק ולרצף על בטווח אחת. רצפים וכתוצאה מכך מותאמות מסד נתונים התייחסות לקבוע שכיחותם בקטריאלי יחסית. הפרוטוקול כולו יכול להתבצע בעוד כשלושה ימים. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. באיכות גבוהה חומצות גרעין חילוץ באמצעות פנול: חרוז כלורופורם מכות Method. (א) איכות DNA, כפי שהוערך באמצעות ספקטרופוטומטר. יחס A260 / A280 בין 1.8 לבין 2.0 מציין חומצות גרעין טהור שאינו מזוהם עם פנול או חלבון. (ב) לאחר טור לנקות, פרוטוקול זה יכול להניב RNA באיכות גבוהה, שמסומן על ידי 16S ו 23S חזק פסגות rRNA. (C) שפלת RNA יכולה להתרחש אם המדגם אינו נשמר קר לאחר איסוף (במהלך הובלה ואחסון) או אם RNases נוכח במהלך עיבוד. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
אישור איור 3. 16S rRNA מוצלח ג'ין הגברה שימוש 515F ו המינימרקטים 806R פריימר סט. אלקטרופורזה למעלה) ג'ל משמש כדי לאשר את קיומו של להקה אחת כ -380 זוגות בסיסים in כל המדגם היה מוגבר בעזרת תבנית. היעדרם של להקה מציין הגברה מוצלחת; זה בדרך כלל עקב טעויות אנושות תגובת PCR ממדגם כי יש לחזור. תחתי) אין תבנית (מים) שולט לרוץ במקביל עם אותו זוג פריימר לא צריך מתנת להקה. הנוכחות של להקה בבקרת המים מציינת ריאגנטים מזוהמים; להתעלמות ריאגנטים שעשויים להיות מזוהם מחדש לעשות את amplifications PCR היא של חלוקת בקרת התבנית ומים כי זוג פריימר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. כימותים של ריכוז ברכת הספרייה הסופית ותיקוף של גודל הספרייה. לאחר איגום amplicons המדגם הבודד, הריכוז דואר של ברכת הספרייה הסופית חייב להיות נחוש. ברכת הספרייה לאחר מכן יש מדוללת יותר כדי להשיג ריכוז 2 ננומטר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
איור 5. נציגים ברים מגרש של ציוני איכות הרצף במיקום כל של הקריאה. זה נורמלי איכות הרצף לרדת אחרי 200 זוגות בסיסים, אבל תוצאת האיכות הממוצעת צריכה להישאר מעל 30. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של נתון זה.

#SampleID ברקוד
LinkerPrimer
סדר פעולות
rcbcPrimer SampleType הוֹצָאָה
קְבוּצָה
הַגבָּרָה
צַלַחַת
תֵאוּר
ניתן למצוא קובץ מיפוי למשל #An בכתובת: http://qiime.org/_static/Examples/File_
פורמטים /
דוגמא_
Mapping_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 cervical
סְפוֹגִית
1 א

תבנית קובץ מיפוי טבלה 1.. Creaטינג קובץ מיפוי מדויק וממצה הוא קריטי לביצוע הפרוטוקול בהצלחה. קובץ המיפוי אינו נדרש רק לביצוע QIIME, אבל זה גם מאפשר לחוקר לשמור על הקשר בין הברקוד המדגם מטה, כדי לנתח את הנתונים עבור כל הטיות שיטתיות (למשל, יצווה אל תצווה וריאציה), ולקבוע מתאמים מעניינים בין מטה ואוכלוסיות חיידקים. קובץ מיפוי חשוף עצמות סופק, אבל משתמשים מעודדים מוסיפים עמודות רבות בעלי metadata ככל האפשר. דוגמאות של metadata נוסף משטח וגינאלי כולל אוסף הגיל, התאריך / השעה של ספוגית של המשתתף, סוג מניעת הורמונליים (אם רלוונטי), תוצאות בדיקות זיהום המועברות במגע מיני, וכו '

Suppliment 1
רשימה משלימה קובץ 1. של המינימרקטים הפוך פריימר רצפים 10 אנא לחץ כאן כדי להוריד את הקובץ.

Discussion

הנה אנו מתארים פרוטוקול לזיהוי ואפיון של שכיחותם חיידקי יחסיות בתוך משטח וגינאלי האדם. פרוטוקול זה יכול בקלות להיות מותאם עבור סוגי מדגם אחרים, כגון שרפרף מטליות של אתרים אחרים בגוף, ועל דגימות שנאספו ממגוון רחב של גורמים. הפקת חומצות גרעין ממכות חרוז בתמיסה שנאגרה של פנול כלורופורם מאפשרת בידוד של שני DNA ו- RNA, וזה חשוב במיוחד כשעובד עם דגימות יקרות שנאספו באמצעות מחקרים קליניים. ב- DNA של החיידק המבודד מצוין לזיהוי טקסונומי חיידקים והרכבה גנומית, בעוד אוסף סימולטני של רנ"א מספק את ההזדמנות כדי לקבוע חיידקים פונקציונליים, מארח, וכן תרומות ויראלית דרך-seq RNA. הפרוטוקול המתואר משתמש קבוצת פריימר צעד אחד תוקפת כי נפרסה בהצלחה על מגוון רחב של סוגי מדגם, כוללים אדם, כלבים, דגימות סביבתיות 10

חלק מיצוי חומצות הגרעין של פרוטוקול זה הוא מוגבל על ידי אמצעי הבטיחות הנדרש כאשר עובדים עם פנול כלורופורם, ואת האתגרים של מיכון הצינור על תפוקה גבוהה, 96-גם בפורמט צלחת. בנוסף, המכות החרוזות הנמרצות המשמשות מזמרת תמוגה מכאנית ב- DNA של החיידק לכ 6 שברי kilobase; אם כבר קטעי דנ"א נדרשים עבור יישומים במורד זרם, המשך של מכות החרוזותhould להתקצר. המגבלות של חלק זיהוי החיידקים של פרוטוקול זה הן אינהרנטי לכל שיטה המסתמכת על רצף גן 16S rRNA. 16S rRNA הרצף אידיאלי לזיהוי חיידקים מהמין ואפילו מינים ברמה, אבל לעתים רחוקות מספק זיהוי רמת מתח. בעוד האזור משתנה V4 הגן 16S rRNA מספק אפליה חזקים בקרב רוב מינים של חיידקים 11, שיטות חישוביות נוספים כגון Oligotyping 31 ייתכן שיהיה צורך להשתמש בהם כדי לזהות מינים מסוימים דווקא, כגון crispatus לקטובצילוס. לבסוף, מידע על היכולות התפקודיות חיידקים המדויקים בתוך מדגם מסוים לא ניתן לקבוע על ידי רצף גן 16S rRNA לבד, אם כי בפרוטוקול זה מאפשר מיצוי של DNA הגנום כולו ו- RNA שיכול לשמש לקראת מטרה זו.

השלב הקריטי ביותר להבטחת הצלחה עם פרוטוקול זה הוא לוקח בזהירות רבה כדי למנוע זיהום durאוסף מדגם ing, מיצוי חומצות גרעין, הגברת PCR. להבטיח סטריליות בעת איסוף דגימה ידי לבישת כפפות נקיות בעזרת מקלוני סטרילי, צינורות, ומספריים. כדי להעריך עבור זיהום של חומרים האוספים, לאסוף דגימות בקרה שליליות על ידי נחת מטליות ללא שימוש נוספים ישירות לתוך צינורות הובלה בעת הדגימה. במעבדה, לבצע את כל השלבים טרום הגברה במנדף מעוקר המכיל אספקה ​​לחטא רק ושימוש כיתה מולקולרית רק עם ריאגנטים חינם-DNA. במהלך חילוץ חומצות גרעין, למנוע זיהום צולב באמצעות מלקחיים סטריליות חדשים וכפפות טריות עם כל דגימה, ושמירה על כל הצינורות סגורים אלא בשימוש. עיבוד מטליות בשימוש במקביל מבטיח סטריליות של שני אוסף המדגם וסחיט חומצות גרעין; המטליות בשימוש לא אמורות להניב גלולה לאחר ממטרי isopropanol ושטיפת אתנול. אם גלול אכן מופיע, לבצע הגברת גני 16S rRNA לקבוע מקור אפשרי שלהזיהום (למשל, הנוכחות של סטרפטוקוקוס או סטפילוקוקוס יצביע זיהום בעור). בנוסף, לבצע רחבות PCR ללא תגובות שליטת תבנית במקביל על מנת להבטיח כי ריאגנטים PCR והתגובות לא זוהמו. אם להקה מופיעה אין שליטת תבנית, וזורק את ריאגנטים וחזור ההגברה עם ריאגנטים טריים. נקיטת אמצעי זהירות אלה תבטיח רצף מוצלח של החיידקים של עניין.

שלב ההגברה PCR נוטה לחייב את התקלות ביותר. הגברה בקבוצות של שנים עשר דגימות מספק איזון בין יעילות ועקביות. העדר מוחלט של להקות, מעבר לכל הדוגמאות ב סט הגברה נתון מצביע על כשל מערכתי, למשל, שוכח להוסיף מגיב או שגוי תכנות thermocycler. היעדרם של הלהקה מתוך כמה דוגמאות לרוב בשל טעות אנוש, ואת amplifications צריך להיות מחדש run עם אותו הזיווג של מדגם פריימר ההפוך. במקרה של היעדרות המשך להקה, המדגם יכול להיות מחדש מוגבר באמצעות פריימר הפוכה עם ברקוד שונה. כשלי הגברה חוזרים עם פריימרים הפוכים מרובים עשויים להצביע מעכב נוכחי במדגם. במקרה כזה, לנקות את ה- DNA עם טור לעתים קרובות יסיר מעכבים מבלי לשנות שכיחותם בקטריאלי יחסית משמעותי. אם להקות מרובות נובעות לאחר הגברה, מחדש להגביר המדגם עם ברקוד פריימר הפוכה שונים.

בנוסף למניעת זיהום סביבה ועל הבטחת הגברה של מוצר ספציפי אחד, רצף מוצלח מסתמך על טיפול בעת הכנת ברכת הספרייה. המטרה היא לשלב כמויות equimolar של כל amplicons של מדגם על מנת להבטיח כ המספר הזהה של רצף קורא לדגימה. אם ריכוזי חומצת הגרעין לפני ההגברה ניתנות להשוואה, פשוט הוסיף כמויות שווות של כל saamplicons של mple מספיק בעת יצירת ברכת הספרייה. עם זאת, אם ריכוזי חומצת הגרעין שונים במידה רבה והוסיפו נפח שווה, המדגם עם ריכוז חומצות גרעין הנמוך ייוצג גרוע עם מספר נמוך של הקורא. במקרה זה, ניתן להוסיף נפח גבוה יותר של amplicons מן מדגם הריכוז הנמוך בהתבסס על העצמה היחסית של להקת ג'ל. לחלופין, אפשר יותר בקפדנות להסיר פריימרים מן amplicons הפרט, לכמת ריכוז amplicon של מדגם בודד באמצעות ערכת כימות dsDNA fluorometric, ודווקא לשלב כמויות equimolar של כל דגימה.

לאחר ברכת amplicon מאוזנת היטב מופקת, הוא הופך להיות קריטי כדי למדוד את הריכוז של הברכה בזהירות. דילול זהיר לאחר וספייק-in עם PhiX להגדיל את המורכבות הקריאות היא קריטיות להשגת תוצאות רצף אופטימליות. sequencers תפוקה גבוהה המשתמש sequencing בסינתזה רגיש מאוד לצפיפות מצרר על תא הזרימה. טוען בריכת הספריה מרוכזת מדי תגרום overclustering, עם ציוני איכות נמוכים יותר, פלט נתונים נמוך, ו -32 demultiplexing מדויק. טוען בריכת ספרייה שהיא לדלל מדי יביא גם פלט נתונים נמוכים. בזהירות לכימות ברכת הספרייה לפני הרצף יהיה להבטיח תוצאות אופטימליות.

16S rRNA רצף הגן מספק הערכה מקיפה של החיידקים הנוכחיים בתוך מדגם נתון הוא צעד ראשון קריטי בדור שערה. הנוכחות של מערך עשיר של מטה נוסף מאפשרת לחוקר לבחון את קשר בין מיני חיידקים מסוימים וגרם ביולוגיים חשובים. יתר על כן, אותו המידע 16S יכול לשמש כדי להסיק את פונקציות חיידקים באמצעות כלים כגון PICRUSt 33. המטרה הסופית היא להשתמש 16S אפיון לזהות עמותות רומן כי יכול להיותעוד נבדק ומאומת במערכות מודל, מוסיף גוברת ההבנה שלנו של השפעת Microbiome החיידקים על בריאות אדם ועל מחלותיו.

Acknowledgements

ברצוננו להודות אליזבת ביירן, דוד Gootenberg, וקריסטינה Gosmann עבור משוב ביקורתי על הפרוטוקול; מייגן בלדריג, סקוט הנדלי, סינדי מונקו, וג'ייסון נורמן להדרכה מדגם הכנה והפגנות; וונדי Garrett, קרטיס Huttenhower, דלג בתולה, וברוס ווקר לייעוץ פרוטוקול ודיונים פוריים; וג'סיקה Hoisington-לופז לתמיכה רצף. עבודה זו נתמכה על ידי קרן ביל ומלינדה גייטס ואת NIAID (1R01AI111918). DSK קיבל תמיכה נוספת מהקרן Wellcome בורוז. MNA נתמכה על ידי מספר פרס T32GM007753 מן NIGMS, ואת פול ודייזי סורוס המלגה. התוכן הוא באחריות בלעדית של הכותבים ולא בהכרח מייצג את הדעות הרשמיות של NIGMS או NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics