Efficiente Nucleic Acid Estrazione e 16S rRNA sequenziamento del gene per batterica Comunità Caratterizzazione

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

Descriviamo un metodo efficiente, robusto e redditizio per l'estrazione degli acidi nucleici da tamponi per la caratterizzazione delle comunità batteriche che utilizzano 16S rRNA gene amplicone sequenziamento. Il metodo consente un approccio di elaborazione comune per diversi tipi di campioni ed accoglie una serie di processi analitici valle.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi è un crescente apprezzamento per il ruolo delle comunità microbiche, come modulatori critici della salute e della malattia. tecnologie di sequenziamento ad alto rendimento hanno consentito per la caratterizzazione rapida ed efficiente delle comunità batteriche che utilizzano 16S rRNA gene sequenziamento da una varietà di fonti. Anche se gli strumenti disponibili per 16S rRNA analisi di sequenza hanno flussi di lavoro di calcolo standardizzati, campione di trasformazione per l'estrazione del DNA rimane una costante fonte di variabilità tra gli studi. Qui si descrive un metodo efficiente, robusto e redditizio per l'estrazione degli acidi nucleici da tamponi. Abbiamo anche delineare i metodi a valle per 16S rRNA gene sequenziamento, tra cui la generazione di librerie di sequenziamento, il controllo della qualità di dati e analisi di sequenza. Il flusso di lavoro in grado di ospitare diversi tipi di campioni, tra cui feci e tamponi raccolti da una varietà di luoghi anatomici e specie ospiti. Inoltre, recuperato DNA e RNA può essere separato e usatoper altre applicazioni, tra cui tutto il sequenziamento del genoma o RNA-Seq. Il metodo descritto consente un approccio di elaborazione comune per molteplici tipi di campioni e può ospitare analisi valle di informazioni genomiche, metagenomica e trascrizionale.

Introduction

Il tratto umano inferiore riproduttivo, sistema gastrointestinale, le vie respiratorie e la pelle sono colonizzate da comunità batteriche complesse che sono fondamentali per il mantenimento della omeostasi tissutale e sostenere la salute dell'ospite 1. Per esempio, alcuni lattobacilli creare un ambiente inospitale per gli agenti patogeni per acidificazione della volta vaginale, producendo effettori antimicrobici e modulando l'immunità host locale 2-4. Il crescente apprezzamento per l'importanza del microbiome batterica è aumentato anche l'interesse nel caratterizzare comunità batteriche in molti contesti clinici. Qui si descrive un metodo per determinare la composizione del microbioma batterica tamponi genitali. Il protocollo può essere facilmente modificato per campioni di feci e tamponi raccolti da altre sedi anatomiche e di altre specie ospiti.

A causa delle limitazioni inerenti il ​​numero di campioni che possono essere raccolti e conservati da un dato pernoy partecipante, questo protocollo è stato progettato per estrarre il DNA, RNA, e potenzialmente anche proteine ​​da un singolo tampone utilizzando un adeguato fenolo-cloroformio basato tallone-pestaggio metodo 5,6. La combinazione di interruzione fisica delle pareti delle cellule batteriche con bead-battitura e la rottura chimica con detergenti permette una rapida lisi dei batteri Gram-positivi, Gram-negativi, e l'acido-veloce senza ulteriori passaggi digestione enzimatica. Per ottenere l'RNA di alta qualità, si consiglia di utilizzare tamponi a secco che sono stati tenuti pari o inferiore a 4 ° C subito dopo la raccolta e durante il trasporto al laboratorio (se applicabile), e conservato a lungo termine a -80 ° C.

Per determinare la microbiome batterica all'interno di un dato campione, questa procedura utilizza rRNA 16S gene amplicone sequenziamento, che è attualmente il mezzo più conveniente per assegnare completo tassonomia batterica ed eseguire quantificazione relativa. Metodi alternativi comprendono mirati qPCR 7, microarr personalizzatoAYS 8, e tutto il sequenziamento del genoma 9. Il gene 16S rRNA contiene nove regioni ipervariabili, e non c'è consenso per quanto riguarda la regione ottimale V di sequenziare per gli studi microbiome vaginali. Qui usiamo il set di primer 515F / 806R e costruire sul gasdotto progettato da Caporaso et al. 10-12. Caporaso s 'et al. 515F / 806R Primer set permette il multiplexing di centinaia di campioni in una sola corsa di sequenziamento a causa della disponibilità di migliaia di codici a barre primer convalidati e la compatibilità con le piattaforme di sequenziamento Illumina. A differenza del progetto microbioma umano 27F / 338R Primer set 13, 515F / 806R anche amplifica efficacemente Bifidobacteriaceae e cattura così accuratamente Gardnerella vaginalis, un membro importante della comunità microbica vaginale in alcune donne. In alternativa, una coppia di primer 338F / 806R è stato utilizzato con successo per pyrosequencing di campioni vaginali 14 e una coppia di primer 515F / 926R ha recente resi disponibili per il sequenziamento di prossima generazione 12.

Infine, questo protocollo fornisce le istruzioni base per eseguire analisi 16S amplicone utilizzando Insights quantitativi nel Ecologia microbica (QIIME) pacchetto software 15. Il successo dell'attuazione dei comandi QIIME qui descritte si ottiene una tabella contenente abbondanze batteriche tassonomiche per ogni campione. Molte operazioni aggiuntive di controllo di qualità, i metodi di classificazione tassonomica, e fasi di analisi possono essere incorporati in analisi, come descritto in dettaglio sul sito QIIME (http://qiime.org/index.html). Se l'analisi viene eseguita su un computer Apple, il pacchetto MacQIIME 16 fornisce una facile installazione di QIIME e le sue dipendenze. Pacchetti software alternativi per 16S rRNA analisi della sequenza del gene sono Mothur 17 e 18 UPARSE.

Protocol

Il protocollo di studio è stato approvato dal e ha seguito le linee guida del Comitato di Ricerca Biomedica Ethics dell'Università di KwaZulu-Natal (Durban, Sudafrica) e il Massachusetts General Hospital Institutional Review Board (2012P001812 / MGH, Boston).

1. Estrazione di acidi nucleici totali da cervicovaginali tamponi

Nota: eseguire estrazioni di acidi nucleici in gruppi di 16 campioni o meno. Il protocollo, come scritto sotto assume campioni vengono trattati in gruppi di 12. Se l'esecuzione di vari cicli di estrazioni, in serie numerare le partite di estrazione e registrare il numero di lotto estrazione di ogni campione, così come altre informazioni campione (includere metadati quali il partecipante numero ID, età data / ora della raccolta tampone, tipo contraccettivo ormonale, risultati dei test infezioni a trasmissione sessuale, ecc) nella Tabella 1.

  1. Preparazione dei reagenti e cappa
    1. Regolare il pH del fenolo: cloroformio: alcool isoamilico (IAA) (25: 24: 1) a pH 7,9 aggiungendo 65 ml di tampone alcalino Tris per 1 ml di fenolo, agitando la miscela per 2 minuti, e consentendo ai due fasi di separata naturalmente o per centrifugazione a 10.000 xg per 5 minuti a temperatura ambiente.
      Attenzione: Fenolo è tossico per ingestione, inalazione o contatto con la pelle e gli occhi. Non respirare i fumi. Indossare guanti impermeabili, occhiali di protezione con schermi laterali, e un camice da laboratorio.
    2. Filtro-sterilizzare i 25 ml di 20% di solfato di sodio dodecil (SDS) attraverso un filtro di 0,22 micron. Fare 5 ml della SDS sterilizzati.
    3. Raffreddare un'aliquota di 10 ml di isopropanolo a -20 ° C.
    4. Preparare un tubo tallone battito per ogni swab da elaborare pesando 0,3 g di perle di vetro in una sterile 2 ml di tubo che è adatto per la frusta tallone.
    5. Ottenere tamponi campionando la portio un tampone assorbente con sterili. Subito dopo la raccolta, posizionare il tampone a una esageratamente e vuota sterile conservare a 4 C per 1-4 ore durante il trasporto al laboratorio, e conservare per diversi mesi a 80 ° c. Trasferire i tamponi (contenuti in singoli tubi) da elaborare per ghiaccio umido.
    6. Preparare la cappa di sicurezza biologica (BSC). Utilizzare un BSC con un "ditale" collegato allo scarico dell'edificio per garantire la corretta rimozione di sostanze chimiche volatili.
      1. Rimuovere tutti i materiali dalla cappa.
      2. Pulire tutte le superfici della cappa con la candeggina, seguito da un decontaminante che rimuove RNasi, DNasi e DNA da superfici. Pulire tutti gli oggetti successivi portarono nella cappa con candeggina seguito da un decontaminante acido nucleico, compresi i guanti. Utilizzare RNasi / reattivi freschi senza DNasi, come ppunte ipette, quando possibile.
      3. Nastro un sacchetto di rischio biologico chimico sterilizzato verso la parte posteriore del cofano. Tutti i rifiuti secchi contenenti fenolo e cloroformio deve essere collocato in questa borsa per il corretto smaltimento.
      4. Posizionare una bottiglia sterile nella cappa per la raccolta rifiuti liquidi contenenti fenolo o cloroformio.
  2. estrazione con fenolo-cloroformio.
    1. Nel cofano, ad ogni provetta pestaggio tallone, aggiungere 500 ml di tampone (dal punto 1.1.1), 210 ml di 20% dodecil solfato di sodio, e 500 ml di fenolo: cloroformio: IAA (25: 24: 1, pH 7.9 ).
    2. Trasferire il tampone dal flacone trasporti nel tubo tallone pestaggio con un nuova coppia di pinze sterili. Accuratamente strofinare la testa del tampone contro le pareti interne del tubo tallone battito per almeno 30 sec. Re-cap del campione quando fatto. Se eseguire estrazioni da più tamponi, cambiare i guanti tra ogni campione.
    3. Raffreddare il campione in ghiaccio per almeno 10 min. Togliere il bastoncino deltallone battendo tubo tenendo il manico tampone con una pinzetta sterili mentre si preme il testa del tampone contro la parete del tubo interno con una punta P200 pulito. Gettare i tamponi nel sacchetto rifiuti chimici a secco. Nota: L'azione "seccatoio" (premendo il testa del tampone) libererà il liquido dal tampone assorbente e aumentare il recupero degli acidi nucleici.
    4. Posizionare il tubo tallone pestaggio nel battitore tallone e omogeneizzare per 2 minuti a 4 ° C.
    5. Centrifugare la provetta battitura tallone per 3 minuti a 6000 xg e 4 ° C per sedimentare i detriti e separare le fasi acquosa e fenolo.
    6. Trasferire la fase acquosa (~ 500 - 600 microlitri) in una provetta sterile da 1,5 ml. Aggiungere un uguale volume fenolo: cloroformio: IAA. Mescolare per inversione e breve vortex.
    7. Centrifugare la provetta per 5 minuti a 16.000 xg e 4 ° C.
    8. Trasferire la fase acquosa in una nuova provetta sterile da 1,5 ml. Siate prudenti e non trasferire il materiale dallo strato interfase o fenolo sottostantefase. Nota il volume della fase acquosa trasferito. Salvare la fase di fenolo per il futuro isolamento delle proteine.
    9. Aggiungere 0,8 volume di isopropanolo e 0,1 volumi di acetato di sodio 3 M (pH 5,5). Mescolare bene per capovolgimento e vortex brevemente.
    10. Precipitare l'acido nucleico raffreddando il tubo a 20 ° C per almeno 2 ore (fino a O / N).
  3. Isopropanolo precipitazioni e lavaggio etanolo
    1. Centrifugare la provetta per 30 minuti a circa 16.000 xg e 4 ° C. utilizzare con cautela una pipetta per rimuovere il surnatante, lasciando intatto il pellet.
    2. Aggiungere 500 ml di etanolo al 100%. Rimuovere il pellet con vortex delicato o pipettaggio senza toccare il pellet. Centrifugare per 5 min a 16.000 xg e 4 ° C.
    3. Eliminare attentamente il surnatante etanolo. Utilizzare una pipetta P10 per rimuovere quanto più etanolo possibile senza disturbare il pellet.
    4. Asciugare il pellet a temperatura ambiente per 15 min.
    5. Risospendere il pellet in 20 ml di ultra-puro 0.1x tampone Tris-EDTA. Lasciare che il campione per rilassarsi in ghiaccio per 10 min e pipetta più volte per garantire la piena risospensione. Se il pellet non si scioglie, trasferire il tubo ad un blocco C di calore di 40 ° per un massimo di 10 minuti per aiutare la dissoluzione.
    6. Misurare la concentrazione di acido nucleico utilizzando uno spettrofotometro 19.
    7. Se lo si desidera, DNA separata da RNA usando una colonna kit di pulizia, seguendo il protocollo 20 del produttore.
    8. Conservare l'acido nucleico a -80 ° C o continuare.

2. PCR amplificazione del gene V4 ipervariabile Regione 16S rRNA

Nota: eseguire l'amplificazione PCR in set di 12 campioni o meno per minimizzare il rischio di contaminazione e di errore umano. Se l'esecuzione di vari cicli di amplificazione, in serie numerare le partite di amplificazione e registrare il numero di amplificazione lotto di ogni campione nella Tabella 1.

  1. preparazione of i reagenti e cappuccio PCR
    1. Aggiungere il impostare le informazioni di amplificazione PCR alla Tabella 1, che servirà come base per il file di mapping in fase di analisi di sequenza.
    2. Rimuovere tutti i materiali da un cappuccio PCR e pulire accuratamente le superfici interne con candeggina seguito da un decontaminante che rimuove RNasi DNasi, e il DNA. Assicurati di decontaminare ogni reagenti e pezzo di materiale (per esempio, pipette) prima di metterli in cappa. Indossare guanti puliti freschi con un decontaminante acido nucleico prima di lavorare nella cappa.
    3. Se necessario, diluire il modello di acido nucleico di 50 - 100 ng / ml con acqua-DNA gratuita e priva di nucleasi.
    4. aliquote disgelo dei 5x ad alta fedeltà (HF) tampone, dNTP, e primer nel cofano PCR clean. Delicatamente vortex e centrifugare tutte le soluzioni dopo lo scongelamento. Per ridurre al minimo i cicli di gelo-disgelo e il rischio di magazzino contaminazioni, preparare aliquote delle 5x HF tampone, dNTP, e primer.
    5. Posizionare unbanco pulito cooler rastrelliera per provette da microcentrifuga e un dispositivo di raffreddamento piastra di PCR nella cappa.
  2. Per reazione di PCR, preparare il master mix combinando 15,5 ml di acqua ultra-puro 5 ml di tampone 5x HF, 0,5 ml di dNTP, 0,5 ml di 515F primer forward, 0,75 ml di 3% DMSO, e 0,25 ml di polimerasi per ogni reazione. Montare tutti i componenti di reazione al fresco e aggiungere la polimerasi scorso. Mescolare accuratamente pipettando. Aggiungere due campioni in più per il conteggio reazione durante la preparazione del master mix, per tenere conto di errori di pipettamento.
  3. installazione di reazione PCR:
    Nota: eseguire amplificazioni in triplice copia, il che significa ogni campione viene amplificato in tre separati 25 reazioni microlitri. Eseguire un controllo dell'acqua non-modello con ciascuna coppia di primer. Lavorare velocemente ma con attenzione, evitando l'introduzione di qualsiasi contaminazione.
    1. Etichettare una strip 8 pozzetti con i singoli tappi e posto in un dispositivo di raffreddamento PCR.
    2. Pipettare 90 ml di master mix in primobene.
    3. Aggiungere 2 ml di primer reverse (Supplemental File 1). Assicurarsi di prendere nota attentamente il codice a barre primer reverse utilizzato con ogni campione nella Tabella 1.
    4. Mescolare bene e trasferire 23 ml di master mix alla quarta bene (il controllo non-modello).
    5. Aggiungere 2 ml di acqua alla quarta bene.
    6. Aggiungere 6 ml di campione appropriato al primo pozzetto. Mescolare bene e trasferire 25 ml al secondo pozzo. Cambiare suggerimenti e trasferire altri 25 microlitri dal primo bene al terzo pozzo. Saldamente coronare ogni bene, facendo attenzione a non toccare la parte interna dei pozzi o motivi nel processo.
    7. Ripetere l'operazione per ogni campione.
  4. Eseguire la PCR
    1. Trasferire i tubi striscia ad un termociclatore ed eseguire il seguente programma: 30 sec a 98 ° C, seguita da 30 cicli di 10 secondi a 98 ° C, 30 sec a 57 ° C e 12 secondi a 72 ° C, seguita da una 10 min mantengono a 72 ° C e finale hold unt 4 ° C.
    2. Effettuare le seguenti operazioni su un banco di laboratorio pulito. girare rapidamente i tubi per raccogliere il liquido dalle pareti. Combinare reazioni triplicate di PCR da ogni campione, con un volume totale di 75 microlitri, in una provetta etichettata sterile. Anche trasferire 25 ml di ogni controllo non-modello in una provetta sterile separata. Non combinare ancora amplificati da campioni diversi.
  5. Validazione di successo di amplificazione PCR dei campioni mediante elettroforesi su gel.
    1. Preparare un gel 1,5% (1,5 g di agarosio polvere in 100 ml di tampone 1x TAE) con pozzi abbastanza per contenere ogni amplicone, controllo delle acque, e scaletta 21.
    2. Mentre i indurisce gel (circa 30 min), preparare il campione per elettroforesi: Aggiungere 1 ml di tintura 6x carico di un nuovo tubo etichettati. Per quel tubo, aggiungere 5 ml di amplicone e mescolare pipettando.
    3. Quando il gel ha fissato, rimuovere i pettini, inserire il gel nel serbatoio elettroforesi, e riempire il serbatoio con il tampone 1x TAE. Per il primo bene, aggiungere 5 ml di scala del DNA.
    4. Carico 5 microlitri del campione amplicone all'altro così. Carico 5 ml di no-modello amplicone ad un ben distinto. Continuare come necessario per ciascun campione.
    5. Quando tutti i campioni sono stati caricati, far scorrere il coperchio del serbatoio in posizione e accendere la sorgente di alimentazione a 120 V. Lasciare che il gel di correre per il 30 - 60 min.
    6. Visualizza il gel ai raggi UV.
      1. Verificare l'amplificazione di successo di ogni campione notando una singola banda forte circa 380 bp. Se c'è una doppia banda, ri-amplificare il campione con un diverso codice a barre inversa (passo 2.3). Se non vi è alcuna banda affatto, ri-amplificare il campione utilizzando lo stesso codice a barre inversa o un nuovo codice a barre inversa (passo 2.3). Se ri-amplificazione è successo, inibitori della PCR possono essere presenti nel campione, nel qual caso, eseguire una pulizia del DNA basato su colonne per rimuovere inibitori della PCR.
        Nota: amplificazione di successo può non essere possibile se la concentrazione di DNA batterico nel ocampione iginal è insufficiente (<5 ng / ml).
      2. Verificare l'assenza di contaminazioni da rilevando l'assenza di una banda nel controllo non-template.
    7. Conservare le rimanenti 70 ml di amplicone a -20 ° C. Eliminare i restanti 20 ml di controllo non-modello, ammesso che non ha dato una band.

3. Biblioteca Pooling e High-Throughput Sequencing

  1. Creare la piscina amplicone combinando un volume uguale (2 - 5 microlitri) di ciascun amplicone in un singolo tubo sterile. Se la banda da un campione sembrava particolarmente debole, aggiungere doppio del volume rispetto al resto dei campioni.
  2. Rimuovere i primer PCR dalla piscina amplicone utilizzando un kit PCR Clean-up, seguendo le istruzioni del produttore 22. Eseguire la pulizia con più colonne se il volume del lotto amplicone è di oltre 100 ml. Nota: Ogni colonna ha una capacità di 100 microlitri.
    1. Conservare la biblioteca a -20 & #176; C o procedere al passo successivo.
  3. Se del caso, combinare le piscine ampliconi senza primer per creare la libreria finale. Determinare la concentrazione di DNA della libreria utilizzando uno spettrofotometro o un sistema fluorimetrico 23. Un rapporto 260/280 tra 1,8-2,0 è indicativo del DNA puro.
  4. Diluire la libreria a 20 Nm. Conferma la qualità della biblioteca visualizzando una singola banda di circa 400 bp con uno strumento elettroforesi. Conferma la concentrazione della biblioteca utilizzando un sistema fluorimetrico 23.
  5. Eseguire una diluizione 1:10 finale in acqua per diluire la libreria di 2 nm. Quindi, conservare la libreria a 20 ° C indeterminato.
  6. Invia una aliquota della biblioteca finale con i tre primer di sequenziamento richiesti (Leggi 1, Read 2, e Index, vedere Tabelle dei Materiali / Equipment) deve essere sequenziato su un sequencer Illumina. Se meno di 300 campioni sono stati multiplexing per il sequenziamento, utilizzare un unico end-run 300 bp e con un indice di 12 bp leggere ona MiSeq, con una concentrazione libreria finale di 5 pm e 10% denaturato Phix picco-in. Vedere i materiali supplementari di Caporaso et al. J ISME 2012 10 per le istruzioni dettagliate sequenziamento.

4. Analisi Sequenza

Nota: qui delineato è un gasdotto di base per l'analisi di sequenza utilizzando il pacchetto software QIIME 1.8.0. Per semplicità, i comandi forniti presuppongono che il file di mapping si chiama mapping.txt, l'indice di 12 bp leggere file si chiama index.fastq, e la sequenza di 300 bp leggere file si chiama sequences.fastq. Installare QIIME o MacQIIME 16 e familiarizzare con le nozioni di base di UNIX per eseguire questi comandi. Leggi la guida completa per QIIME a:

  1. Completare il file di mapping per l'esperimento (Tabella 1). Includere il maggior numero di metadati come possibile. Nota che i campioni sono stati estratti o amplificati nella stessa partita, per determinare se ci sono effetti batch.
  2. ad esempio, mapping.txt. Convalida la formattazione del file di mapping eseguendo il comando seguente: validate_mapping_file.py -m mapping.txt -o mapping_output
    Nota: Questo comando utilizza lo script QIIME built-in "validate_mapping_file.py" che rende una nuova cartella, chiamata "mapping_output", che contiene un file .html indicando gli errori di file di mapping, se presente.
  3. Controllare la qualità del sequenziamento legge utilizzando una qualità dei dati di sequenza high-throughput programma di controllo, come ad esempio FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figura 5 dimostra la qualità per ogni sequenza di basi che ci si può aspettare da una corsa di successo.
    Nota: Il sequencer assegna ogni base nucleotide un punteggio di qualità Phred, che corrisponde alla probabilità che la base è stato chiamato erroneamente. Un punteggio di qualità Phred di 10 indica che c'è una probabilità del 10% che il nucleotide è stato erroneamente assegnareEd, 20 indica un 1% di possibilità, 30 indica una probabilità dello 0,1%, e 40 (il più alto punteggio possibile) indica una probabilità 0,01% 24.
  4. Utilizzando il file di mapping come una chiave, demultiplexare, filtrare la qualità dei dati di sequenziamento, e salvare i risultati in una cartella (in questo caso, chiamato "sl_out") eseguendo il comando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt q 29
    Nota: La bandiera q indica il punteggio massimo inaccettabile qualità Phred, ad esempio, "-q 29" filtri eventuali sequenze con punteggi Phred inferiori a 30, garantendo il 99,9% di precisione delle chiamate di base.
  5. Utilizzando la banca dati operativa Greengenes 16S unità tassonomica (OTU) di riferimento 26 (http://qiime.org/home_static/dataFiles.html), procedere a cielo aperto di riferimento OTU raccolta eseguendo il comando 27: pick_open_reference_otus.py -i sl_out / seguenti del regolamento provvisorio. fna -r 97_otus.fasta -o ucrss / -s 0.1
    Nota: Il flag -s indicala frazione di sequenze che non è riuscito ad allineare la base dati di riferimento che sarà incluso nel de novo clustering. "-s 0,1" include il 10% di sequenze trattati nel de novo di clustering. Utilizzare il flag -a per parallelizzare il processo di raccolta OTU e di ridurre il tempo di elaborazione da giorni a ore se più core sono disponibili.
  6. Creare una tabella abbondanza tassonomica user-friendly dalla fusione OTU a livello di specie eseguendo il comando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Nota: La tabella risultante può essere visualizzato facilmente in qualsiasi foglio elettronico. Si noti che 16S rRNA sequencing non fornisce in modo affidabile la risoluzione livello di specie.
  7. Determinare la diversità ecologica all'interno di ogni campione calcolando diverse metriche alfa diversità con la alpha_diversity.py sceneggiatura QIIME. Quindi, determinare la diversità tra coppie di campioni utilizzando il beta_diversity.py sceneggiatura QIIME.
  8. Visualize i dati, ad esempio, utilizzando un principio Imperatore 29 coordina trama o heatmap.
  9. Eseguire confronti statistici formali di mappatura categorie di file, ad esempio, con lo script compare_catagories.py di QIIME 30.

Representative Results

Il quadro generale del protocollo, che consente la determinazione delle abbondanze batteriche relativi da un tampone utilizzando 16S rRNA sequenziamento del gene, è illustrato nella figura protocollo 1 .Il è stato ottimizzato per tamponi vaginali umane, ma può essere facilmente adattato per la maggior parte dei siti di campionamento della mucosa e altri host. figura 2 illustra il DNA di alta qualità e RNA che possono essere isolato utilizzando il protocollo tallone-battito. la figura 3 illustra un l'amplificazione PCR di 12 campioni, dove ogni amplificazione con un campione ha prodotto una singola banda forte della corretta dimensioni e ciascun controllo dell'acqua non ha dato una banda. figura 4 illustra la quantificazione della piscina finale biblioteca prima sequenziamento. la Figura 5 mostra un tipico profilo di qualità sequenza dopo una singola fascia 300 bp run MiSeq.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Figura 1. Schema panoramica del protocollo. Primo, l'acido nucleico è estratto da un tampone dal tallone-battito in una soluzione tamponata contenente fenolo, cloroformio e alcool isoamilico. regione variabile 4 del gene 16S rRNA viene poi amplificato dall'acido nucleico risultante utilizzando PCR. PCR ampliconi da fino a centinaia di campioni vengono quindi combinati e sequenziati su una singola corsa. Le sequenze risultanti sono abbinati ad un database di riferimento per determinare le abbondanze batteriche relativi. L'intero protocollo può essere eseguita in circa tre giorni. Si prega di cliccare qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. di alta qualità Nucleic Acid estratto utilizzando il fenolo: cloroformio Bead Battere Metodo. (A) qualità del DNA, come valutato utilizzando uno spettrofotometro. Un rapporto A260 / A280 tra 1,8 e 2,0 indica acido nucleico puro che non è contaminato con fenolo o proteine. (B) Dopo una colonna clean-up, questo protocollo può produrre RNA alta qualità, indicato da forti picchi 16S e 23S rRNA. (C) la degradazione dell'RNA può verificarsi se il campione non è tenuto a freddo dopo la raccolta (durante il trasporto e lo stoccaggio), o se RNasi sono presenti durante la lavorazione. cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. La conferma del successo 16S rRNA gene amplificazione Utilizzando la 515F e codice a barre 806R Primer Set. Top) Gel elettroforesi viene utilizzata per confermare la presenza di una sola banda circa 380 coppie di basi in ogni campione è stato amplificato con template. L'assenza di una banda indica l'amplificazione senza successo; questo è di solito a causa di un errore umano e la reazione di PCR da quel campione deve essere ripetuto. inferiore) Nessun modello (acqua) i controlli eseguiti in parallelo con la stessa coppia di primer non dovrebbe avere una banda presente. La presenza di una banda nel controllo dell'acqua indica reagenti contaminati; scartare i reagenti che possono essere contaminati e ri-fare le amplificazioni PCR sia del controllo del modello e l'acqua per quella coppia di primer. Cliccate qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. Quantificazione della concentrazione finale Biblioteca Pool e convalida della Biblioteca dimensioni. Dopo mettendo in comune le singole ampliconi campione, the la concentrazione della piscina biblioteca finale deve essere determinata. La piscina libreria deve quindi essere ulteriormente diluito per raggiungere una concentrazione di 2 nm. Clicca qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. Rappresentante Bar Trama della qualità sequenza punteggi in ogni posizione della lettura. È normale che la qualità sequenza per cadere dopo 200 coppie di basi, ma il punteggio medio di qualità deve rimanere al di sopra 30. Si prega di cliccare qui per vedere una versione più grande di questa figura.

#SampleID Codice a barre
LinkerPrimer
Sequenza
rcbcPrimer SampleType Estrazione
partita
Amplificazione
Piatto
Descrizione
# Un esempio di file di mapping sono disponibili all'indirizzo: http://qiime.org/_static/Examples/File_
formati /
Esempio_
Mappatura_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervicale
Tampone
1 UN

Tabella 1. Mappatura file modello. Creazione di un file di mapping accurata e approfondita è fondamentale per l'esecuzione con successo il protocollo. Il file di mappatura non è necessario solo per l'esecuzione QIIME, ma consente anche al ricercatore di mantenere il collegamento tra il codice a barre del campione e metadati, per analizzare i dati per eventuali distorsioni sistematiche (per esempio, da lotto a lotto variazione), e di determinare correlazioni interessanti tra i metadati e le popolazioni batteriche. Un file di mapping bare-bones è previsto, ma gli utenti sono incoraggiati a aggiungere il numero di colonne che contengono metadati possibile. Esempi di metadati aggiuntivi per un tampone vaginale include del partecipante età, data / ora del prelievo tampone, ormonali tipo contraccettivo (se applicabile), infezione risultati dei test a trasmissione sessuale, etc.

suppliment 1
Supplemental File 1. Elenco delle Barcoded Reverse Primer Sequenze 10 Clicca qui per scaricare questo file.

Discussion

Qui si descrive un protocollo per l'identificazione e la caratterizzazione delle abbondanze batteriche relativi all'interno di un tampone vaginale umana. Questo protocollo può essere facilmente adattato per altri tipi di campioni, come feci e tamponi di altri siti del corpo, e per campioni raccolti da un'ampia varietà di fonti. L'estrazione degli acidi nucleici da stallonatore battitura in una soluzione tamponata del fenolo e cloroformio consente l'isolamento sia del DNA e RNA, che particolarmente importante quando è lavora con campioni preziose raccolte tramite studi clinici. Il DNA batterico isolato è eccellente per batterica identificazione tassonomica e l'assemblaggio del genoma, mentre la raccolta simultanea di RNA offre l'opportunità di determinare batterica funzionale, host e contributi virali attraverso RNA-Seq. Il protocollo descritto utilizza un insieme convalidato uno stadio di primer che è stato implementato su una vasta gamma di campioni, compresi gli esseri umani, canino, e campioni ambientali 10

La porzione di estrazione degli acidi nucleici di questo protocollo è limitata dalle misure di sicurezza necessarie quando si lavora con fenolo e cloroformio, e le sfide della automatizzando la pipeline per un alto rendimento, formato a 96 pozzetti. Inoltre, il tallone battito vigoroso utilizzato per cesoie lisi meccanica del DNA batterico di circa 6 frammenti kilobase; se sono necessari frammenti di DNA più lunghi per le applicazioni a valle, la durata del tallone battito should essere abbreviato. Le limitazioni della porzione identificazione batterica di questo protocollo sono inerenti a qualsiasi metodo che si basa su 16S rRNA sequenziamento del gene. 16S rRNA sequencing è ideale per l'identificazione batterica al livello di genere e anche di specie, ma raramente fornisce l'identificazione livello di deformazione. Mentre la regione variabile V4 del gene 16S rRNA fornisce discriminazione robusto tra la maggior parte delle specie batteriche 11, possono avere bisogno di essere utilizzato per identificare con precisione alcune specie, come Lactobacillus crispatus metodi computazionali aggiuntivi come Oligotyping 31. Infine, le informazioni sulle capacità funzionali batteriche precise all'interno di un campione particolare, non può essere determinata 16S rRNA gene sequenziamento solo, anche se questo protocollo consente l'estrazione di DNA intero genoma e RNA che possono essere utilizzati verso questo scopo.

La fase più critica per garantire il successo con questo protocollo sta prendendo molta cura per evitare contaminazione During raccolta del campione, estrazione degli acidi nucleici, e l'amplificazione PCR. Assicurarsi che la sterilità al momento della raccolta dei campioni indossando guanti puliti ed utilizzando tamponi sterili tubi, e forbici. Per valutare la contaminazione dei materiali di raccolta, raccogliere tamponi di controllo negativo mettendo tamponi inutilizzati aggiuntivi direttamente in provette di trasporto al momento del campionamento. Nel laboratorio, eseguire tutte le fasi di pre-amplificazione in una cappa sterile contenente forniture solo decontaminati e utilizzando solo grado molecolare, reagenti privi di DNA. Durante l'estrazione degli acidi nucleici, evitare la contaminazione incrociata utilizzando nuove pinze sterili e guanti fresche con ogni campione, e mantenendo tutti i tubi chiusi se non in uso. Elaborazione di tamponi non utilizzati in parallelo garantisce la sterilità sia della raccolta dei campioni e l'estrazione degli acidi nucleici; i tamponi inutilizzati non devono produrre un pellet dopo isopropanolo precipitazioni e lavaggio etanolo. Se si visualizza un pellet, eseguire 16S rRNA amplificazione genica per determinare una possibile fonte dila contaminazione (ad esempio, la presenza di Streptococcus o Staphylococcus indicherebbe la contaminazione della pelle). Inoltre, eseguire amplificazioni PCR senza reazioni di controllo modello in parallelo per garantire che i reagenti PCR e reazioni non sono stati contaminati. Se una band appare in un controllo alcun modello, eliminare i reagenti e ripetere l'amplificazione con i reagenti freschi. Prendendo queste precauzioni assicurerà sequenziamento successo dei batteri di interesse.

La fase di amplificazione PCR tende a richiedere più la risoluzione dei problemi. Amplificando in gruppi di dodici campioni fornisce un equilibrio tra efficienza e la coerenza. La totale assenza di bande in tutti i campioni in un dato insieme di amplificazione indica un errore sistematico, ad esempio, dimenticando di aggiungere un reagente o programmare in modo errato il termociclatore. L'assenza di una banda da alcuni campioni di solito è causa di errore umano e le amplificazioni dovrebbe essere ri-rONU con lo stesso abbinamento di campione e primer reverse. Nel caso della assenza continua di una banda, il campione può essere nuovamente amplificato utilizzando un primer inverso con un codice a barre diverso. fallimenti ripetuti di amplificazione con più primer inverso possono indicare un inibitore presente nel campione. In tal caso, la pulizia del DNA con una colonna spesso rimuovere inibitori senza alterare significativamente abbondanze batteriche relativi. Se più bande risultato dopo l'amplificazione, ri-amplificare il campione con un diverso codice a barre primer reverse.

Oltre a prevenire la contaminazione ambientale e garantendo amplificazione di un singolo prodotto specifico, sequenziamento successo deduce attenzione durante la preparazione della piscina libreria. L'obiettivo è di combinare quantità equimolari di ampliconi di ciascun campione per accertarsi circa lo stesso numero di sequenza letture per campione. Se le concentrazioni di acido nucleico prima dell'amplificazione sono comparabili, aggiungendo semplicemente volumi uguali di ciascuna saampliconi di Mple sono sufficienti quando si crea il pool biblioteca. Tuttavia, se le concentrazioni di acido nucleico sono molto diversi e aggiunto in un volume uguale, il campione con la bassa concentrazione di acido nucleico sarà poco rappresentato con un basso numero di letture. In questo caso, è possibile aggiungere un volume maggiore di ampliconi dal campione bassa concentrazione basato sulla relativa intensità della banda gel. In alternativa, è possibile rimuovere più rigoroso primers dai singoli ampliconi, quantificare la concentrazione di ampliconi singolo campione utilizzando un kit dsDNA quantificazione fluorimetrico, e precisamente combinare quantità equimolari di ciascun campione.

Una volta che una piscina amplicone ben bilanciata è generato, diventa fondamentale per misurare accuratamente la concentrazione della piscina. La successiva accurata diluizione e spike-in con Phix per aumentare la complessità di lettura è fondamentale per ottenere risultati ottimali di sequenziamento. sequencer high-throughput che utilizzano Sequencing per sintesi sono molto sensibili alla densità del cluster sulla cella di flusso. Caricamento di un pool di libreria che è troppo concentrato si tradurrà in Overclustering, con punteggi più bassi di qualità, l'uscita dei dati più bassi, e imprecisa demultiplexing 32. Caricamento di un pool di libreria che viene troppo diluito sarà anche tradursi in uscita dati bassa. Attenzione quantificare la piscina libreria prima del sequenziamento garantirà risultati ottimali.

16S rRNA sequenziamento del gene fornisce una valutazione completa dei batteri presenti in un dato campione ed è un primo passo assolutamente cruciale nella generazione di ipotesi. La presenza di un ricco set di metadati ulteriormente permette al ricercatore di testare le associazioni tra particolari specie batteriche e di importanti fattori biologici. Inoltre, lo stesso 16S informazioni possono essere usate per dedurre le funzioni batteriche utilizzando strumenti come PICRUSt 33. L'obiettivo finale è quello di utilizzare 16S caratterizzazione per individuare nuove associazioni che possono essereulteriormente testato e convalidato in sistemi modello, aggiungendo alla nostra crescente comprensione dell'impatto del microbioma batterica sulla salute umana e le malattie.

Acknowledgements

Vorremmo ringraziare Elizabeth Byrne, David Gootenberg, e Christina Gosmann per un feedback critico sul protocollo; Megan Baldridge, Scott Handley, Cindy Monaco, e Jason Norman per l'orientamento preparazione del campione e manifestazioni; Wendy Garrett, Curtis Huttenhower, Skip Virgin, e Bruce Walker per la consulenza di protocollo e fruttuose discussioni; e Jessica Hoisington-Lopez per il supporto sequenziamento. Questo lavoro è stato sostenuto dalla Fondazione Bill e Melinda e il NIAID (1R01AI111918). DSK ha ricevuto un ulteriore sostegno da parte del Fondo Burroughs Wellcome. MNA è stato sostenuto dal numero di riconoscimento T32GM007753 dal NIGMS, e la Paul e Daisy Soros Fellowship. Il contenuto è di esclusiva responsabilità degli autori e non rappresentano necessariamente il punto di vista ufficiale della NIGMS o NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics