Effiziente Nukleinsäure-Extraktion und 16S rRNA Gen-Sequenzierung für bakterielle Gemeinschaft Charakterisierung

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

Wir beschreiben eine effiziente, robuste und kosteneffektive Methode zur Nukleinsäure von Tupfern zur Charakterisierung von Bakteriengemeinschaften Extraktion unter Verwendung von 16S rRNA-Gen-Amplikons Sequenzierung. Das Verfahren ermöglicht eine gemeinsame Verarbeitungsansatz für mehrere Probenarten und beherbergt eine Reihe von nachgelagerten analytischen Prozessen.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Es gibt eine wachsende Wertschätzung für die Rolle der mikrobiellen Lebensgemeinschaften als kritische Modulatoren der menschlichen Gesundheit und Krankheit. Hochdurchsatz-Sequenzierung Technologien für die schnelle und effiziente Charakterisierung von Bakteriengemeinschaften verwenden 16S rRNA-Gen-Sequenzierung aus einer Vielzahl von Quellen erlaubt. Obwohl leicht verfügbaren Werkzeuge für die 16S rRNA-Analyse-Sequenz standardisierte Rechen Workflows haben, bleibt Probenverarbeitung zur DNA-Extraktion über Studien, die eine Fortsetzung Quelle der Variabilität. Hier beschreiben wir eine effiziente, robuste und kosteneffektive Methode zur Nukleinsäure von Tupfern extrahieren. Wir beschreiben auch Downstream-Methoden für 16S-rRNA-Gen-Sequenzierung, einschließlich der Erzeugung von Sequenzierungsbibliotheken, Datenqualitätskontrolle und Sequenzanalyse. Die Workflow kann mehrere Proben-Typen, einschließlich Stuhl und Tupfer aus einer Vielzahl von anatomischen Stellen und Wirtsarten gesammelt zubringen. Zusätzlich gewonnene DNA und RNA abgetrennt und verwendet werden,für andere Anwendungen, einschließlich vollständige Genomsequenzierung oder RNA-Seq. Das beschriebene Verfahren erlaubt einen gemeinsamen Ansatz bei Verarbeitung für mehrere Probentypen und bietet Platz für Downstream-Analyse genomischer, Metagenom und Transkriptions Informationen.

Introduction

Der menschliche unteren Reproduktionstrakts, des gastrointestinalen Systems, des Atmungstrakts und der Haut werden durch komplexe Bakteriengemeinschaften besiedelt , die für die Aufrechterhaltung der Homöostase von Gewebe und Unterstützung der Gesundheit des Wirtes 1 entscheidend sind. Zum Beispiel eine unwirtliche Umgebung für Pathogene bestimmte Laktobazillen erstellen , indem Sie das Scheidengewölbe Versauerung, die Herstellung von antimikrobiellen Effektoren und Modulation lokalen Host Immunität 2-4. Die wachsende Wertschätzung für die Bedeutung der bakteriellen microbiome hat auch Interesse erhöht bei der Charakterisierung von Bakteriengemeinschaften in vielen klinischen Kontexten. Hier beschreiben wir eine Methode, um die Zusammensetzung der bakteriellen microbiome aus Genitalabstrichen zu bestimmen. Das Protokoll kann leicht für Hocker und Tupferproben aus anderen anatomischen Stellen und anderen Wirtsarten gesammelt modifiziert werden.

Aufgrund der inhärenten Einschränkungen bei der Anzahl der Proben, die von einem gegebenen Bolzen gesammelt und gespeichert werden können,y Teilnehmer wurde dieses Protokoll zu extrahieren , DNA, RNA, entworfen und möglicherweise sogar Protein aus einem einzigen Tupfer eine angepasste Phenol-Chloroform basierend sicken Schlagen Verfahren 5,6. Die Kombination der physikalischen Störung der bakteriellen Zellwände mit sicken Schlagen und chemische Störung mit Detergenzien ermöglicht eine schnelle Lyse von Gram-positive, Gram-negative und säurefeste Bakterien ohne zusätzliche enzymatische Verdauung Schritte. Um eine hohe Qualität RNA zu erhalten, wird empfohlen, trockenen Tupfer zu verwenden, die bei oder unter 4 ° gehalten wurden C unmittelbar nach der Entnahme und beim Transport in das Labor (falls zutreffend) und gespeicherte Langzeit bei -80 ° C.

Um die bakterielle microbiome innerhalb einer gegebenen Probe zu bestimmen, ist dieses Verfahren nutzt 16S rRNA-Gen-Amplikon-Sequenzierung, die derzeit die kostengünstigste Mittel zur umfassenden bakteriellen Taxonomie zuordnen und relative Quantifizierung durchzuführen. Alternative Verfahren umfassen qPCR gezielte 7, kundenspezifische microarrays 8 und Vollgenomsequenzierung 9. Das 16S-rRNA-Gen enthält neun hypervariablen Regionen, und es gibt keinen Konsens über die optimale V-Region in Bezug auf die für die vaginale microbiome Studien zu sequenzieren. Hier verwenden wir die 515F / 806R Primer - Set und bauen auf die Pipeline entworfen von Caporaso et al. 10-12. Caporaso et al. 'S 515F / 806R Primer - Set ermöglicht Multiplexing von Hunderten von Proben auf einer einzigen Sequenzierungslauf aufgrund der Verfügbarkeit von Tausenden von validierten barcodierte Primer und die Kompatibilität mit Illumina - Sequenzierung Plattformen. Im Gegensatz zu den 27F / 338R Primer Human Microbiome Projekt 13 gesetzt, 515F / 806R verstärkt auch Bifidobacteriaceae effektiv und damit fängt genau Gardnerella vaginalis, ein wichtiges Mitglied der vaginalen mikrobiellen Gemeinschaft in einigen Frauen. Alternativ ist seit Pyrosequenzierung der vaginalen Proben 14 und ein 515F / 926R Primerpaar ein 338F / 806R Primerpaar erfolgreich hat rece verwendetntly verfügbar werden für die nächste Generation - Sequenzierung 12.

Schließlich bietet dieses Protokoll grundlegende Anweisungen 16S Amplikon - Analyse durchzuführen , die quantitativen Insights mit in Microbial Ecology (QIIME) Software - Paket 15. Die erfolgreiche Umsetzung der QIIME Befehle beschrieben hier ergibt sich eine Tabelle für jede Probe Bakterien taxonomischen Abundanzen enthält. Viele zusätzliche Qualitätskontrollschritte, taxonomische Klassifizierung Methoden und Analyseschritte können in die Analyse einbezogen werden, wie es im Detail auf der QIIME Website beschrieben (http://qiime.org/index.html). Wenn die Analyse auf einem Apple - Computer ausgeführt werden, 16 das MacQIIME - Paket bietet eine einfache Installation von QIIME und ihre Abhängigkeiten. Alternative Software - Pakete für die 16S rRNA - Gen - Sequenzanalyse umfassen Mothur 17 und UPARSE 18.

Protocol

Das Studienprotokoll wurde genehmigt durch und folgte den Richtlinien des Biomedical Research Ethikkommission der Universität von KwaZulu-Natal (Durban, Südafrika) und dem Massachusetts General Hospital Institutional Review Board (2012P001812 / MGH, Boston, MA).

1. Extraktion von Gesamt-Nukleinsäure von zervikovaginalen Tupfer

Hinweis: Durchführen Nukleinsäure-Extraktionen in Sätzen von 16 Samples oder weniger. Das Protokoll wie unten geschrieben wird davon ausgegangen Proben in Gruppen von 12 verarbeitet Wenn mehrere Runden von Extraktionen durchgeführt wird, seriell die Extraktion Chargen Nummer und jede Probe der Extraktion Chargennummer sowie andere Probeninformationen (einschließlich Metadaten wie der Teilnehmer-ID-Nummer, Alter aufzeichnen , Datum / Uhrzeit der Abstrichentnahme, hormonelles Kontrazeptivum Typ, sexuell übertragbare Infektion Testergebnisse, etc.) in der Tabelle 1.

  1. Vorbereitung der Reagenzien und Dunstabzug
    1. Der pH-Wert des Phenol: Chloroform: Isoamylalkohol (IAA) (25: 24: 1) auf pH 7,9 durch Zugabe von 65 ul Tris alkalischen Puffer pro 1 ml Phenol, Schütteln der Mischung für 2 min, und man die zwei Phasen getrennte entweder natürlich oder durch Zentrifugieren bei 10.000 xg für 5 min bei RT.
      Vorsicht: Phenol ist giftig beim Verschlucken, Einatmen oder bei Berührung mit der Haut und Augen. Rauch nicht einatmen. Undurchlässige Handschuhe tragen, Schutzbrille mit Seitenschutz und einen Laborkittel.
    2. Filter sterilisieren 25 ml 20% Natriumdodecylsulfat (SDS) durch ein 0,22 um-Filter. Machen Sie 5 ml Aliquots der sterilisierten SDS.
    3. Chill ein 10 ml Aliquot von Isopropanol bei -20 ° C.
    4. Bereiten Sie eine Perle zu schlagen Rohr für jedes sWAB durch Auswiegen von 0,3 g Glaskugeln in ein steriles 2-ml-Röhrchen verarbeitet werden, die für den Wulst beater geeignet ist.
    5. Erhalten Tupfer durch Abtasten des ectocervix mit einem sterilen Tupfer absorbierenden. Unmittelbar nach der Entnahme, legen Sie den Tupfer in einen leeren und steril Kryoröhrchen, lagern bei 4 ° C für 1 bis 4 Stunden während des Transports ins Labor, und speichern Sie für mehrere Monate bei -80 ° C. Übertragen Sie die Tupfer (enthalten in einzelnen Rohren) zu nassem Eis verarbeitet werden.
    6. Bereiten Sie die biologischen Sicherheitsschrank (BSC). Verwenden Sie einen BSC mit einem "Fingerhut" mit dem Gebäude Abgas ordnungsgemäße Beseitigung von flüchtigen Chemikalien zu gewährleisten.
      1. Entfernen Sie alle Materialien aus der Haube.
      2. Reinigen Sie alle Oberflächen der Haube mit Bleichmittel, die von einem Dekontaminations gefolgt, die RNasen, DNasen und DNA von den Oberflächen entfernt. Reinigen Sie alle nachfolgenden Elemente gebracht in die Haube Bleichmittel durch eine Nukleinsäure Dekontaminationsmittel unter Verwendung von, einschließlich der Handschuhe. Verwenden Sie frische RNase / DNase-freie Reagenzien wie pipette Tipps, wann immer möglich.
      3. Band mit einer sterilisierten chemischen biohazard Tasche auf der Rückseite der Motorhaube. Alle trockenen Abfällen Phenol oder Chloroform enthalten, sollten in diese Tasche für die ordnungsgemäße Entsorgung gelegt werden.
      4. Platzieren Sie eine sterile Flasche in die Haube flüssige Abfälle zu sammeln, das Phenol oder Chloroform.
  2. Phenol-Chloroformextraktion.
    1. In der Haube zu jedem Röhrchen bead Schlagen, 500 ul Puffer (aus Schritt 1.1.1), 210 ul 20% Natriumdodecylsulfat und 500 ul Phenol: Chloroform: IAA (25: 24: 1, pH 7,9 ).
    2. Bringen Sie den Tupfer aus dem Transport Fläschchen in den Wulst zu schlagen Rohr ein neues Paar sterile Pinzette. Tragen Sie die Tupfer gegen die Innenwände des Wulst zu schlagen Rohr für mindestens 30 Sekunden. Re-Kappe die Probe, wenn Sie fertig. Wenn Extraktionen von mehreren Tupfer durchführen, die Handschuhe wechseln, zwischen jeder Probe.
    3. Kühlen Sie die Probe auf Eis für mindestens 10 min. Entfernen Sie den Tupfer aus derWulst Rohr schlagen durch den Tupfer Griff mit einer sterilen Pinzette zu halten, während Sie den Tupfer Kopf gegen die Rohrinnenwand mit einem sauberen P200 Spitze drücken. Entsorgen Sie die Tupfer in der trockenen chemischen Abfallbeutel. Hinweis: Die "Rakel" Aktion (die Tupfer drücken) wird Flüssigkeit von dem absorbierenden Tupfer befreien und die Nukleinsäure Erholung erhöhen.
    4. Platzieren Sie den Wulst zu schlagen Rohr in den Wulst Rührbesen und homogenisieren für 2 min bei 4 ° C.
    5. Zentrifuge der Wulst Schlagen Rohr für 3 min bei 6000 xg und 4 ° C Trümmer zu pelletieren , und die wässrige und Phenol Phasen trennen.
    6. Übertragen Sie die wässrige Phase (~ 500-600 ul) in eine sterile 1,5 ml-Tube. Fügen Sie ein gleiches Volumen an Phenol: Chloroform: IAA. Mischen durch Umdrehen und kurze Verwirbelung.
    7. Zentrifugieren Sie die Röhrchen für 5 min bei 16.000 xg und 4 ° C.
    8. Übertragen Sie die wässrige Phase in ein neues steriles 1,5-ml-Röhrchen. Seien Sie konservativ und nicht übertragen Material aus der Zwischenphase Schicht oder der zugrunde liegenden PhenolPhase. Beachten Sie das Volumen der wässrigen Phase überführt. Speichern Sie die Phenolphase für zukünftige Proteinisolierung.
    9. Hinzufügen 0,8 Volumen Isopropanol und 0,1 Volumen 3 M Natriumacetat (pH 5,5). Gut mischen durch Umdrehen und kurz Verwirbelung.
    10. Auszufällen die Nukleinsäure durch das Rohr bei -20 ° C kühlt für mindestens 2 Stunden (bis zu O / N).
  3. Isopropanolpräzipitation und Ethanol waschen
    1. Zentrifugieren Sie die Röhrchen für 30 Minuten bei etwa 16.000 × g und 4 ° C. Vorsichtig verwenden, um eine Pipette den Überstand zu entfernen, um das Pellet intakt bleibt.
    2. Hinzufügen, 500 ul 100% Ethanol. Vertreiben des Pellets mit leichter Verwirbelung oder Pipettieren ohne das Pellet zu berühren. Zentrifuge für 5 min bei 16.000 xg und 4 ° C.
    3. verwerfen Sie vorsichtig den Ethanolüberstand. Verwenden Sie ein P10-Pipette so viel Ethanol wie möglich zu entfernen, ohne das Pellet zu stören.
    4. Luft trocknen das Pellet bei RT für 15 min.
    5. Resuspendieren des Pellets in 20 u & mgr; lltra reines 0,1x Tris-EDTA-Puffer. Lassen Sie die Probe auf Eis zu kühlen 10 min und Pipette immer wieder voll Aufwirbelung zu gewährleisten. Wenn das Pellet nicht auflöst, übertragen das Rohr bis zu 40 ° C Heizblock für bis zu 10 min Auflösung zu unterstützen.
    6. Messen der Nukleinsäurekonzentration unter Verwendung eines Spektrophotometers 19.
    7. Falls erwünscht, können getrennte DNA von RNA eine Säule clean-up - Kit, nach dem Protokoll des Herstellers 20.
    8. Lagern Sie die Nukleinsäure bei -80ºC oder fortzusetzen.

2. PCR - Amplifikation der 16S rRNA Gene V4 hypervariable Region

Hinweis: Führen Sie die PCR-Amplifikation in Gruppen von 12 Proben oder weniger das Risiko einer Kontamination und menschliche Fehler zu minimieren. Wenn mehrere Runden der Amplifikation durchgeführt wird , seriell die Chargen Verstärkung Nummer und jede Probe der Verstärkung Chargennummer in Tabelle 1 notieren.

  1. Vorbereitung of die Reagenzien und PCR-Haube
    1. Fügen Sie die PCR - Amplifikation eingestellt Informationen zu Tabelle 1, die als Grundlage der Zuordnungsdatei auf der Sequenzanalyse Bühne dienen.
    2. Entfernen Sie alle Materialien aus einem PCR-Haube und reinigen Sie die Innenflächen gründlich mit Bleichmittel von einem Dekontaminations gefolgt, die RNasen, DNasen und DNA entfernt. Achten Sie darauf , jedes Reagenz und Ausrüstungsstück zu dekontaminieren (zB Pipetten) , bevor sie in der Haube setzt. Tragen Sie frische Handschuhe mit einer Nukleinsäure Dekontaminationsmittel gereinigt, bevor sie in der Haube zu arbeiten.
    3. Falls nötig, verdünnen Sie die Template-Nukleinsäure zu 50 bis 100 ng / ul unter Verwendung von DNA-frei und Nuklease-freies Wasser.
    4. Thaw Aliquots der 5-fach High-Fidelity (HF) Puffer, dNTPs und Primer in der PCR saubere Haube. Sanft Wirbel und Zentrifuge alle Lösungen nach dem Auftauen. Zur Minimierung der Frost-Tau-Zyklen und das Risiko einer Kontamination Lager, bereiten Aliquots der 5-fach HF-Puffer, dNTPs und Primer.
    5. Platz einsauber Benchtop-Kühler Rack für Mikrozentrifugenröhrchen und einer PCR-Plattenkühler in die Haube.
  2. Bei PCR-Reaktion herzustellen, indem man die Kombination von 15,5 & mgr; l ultrareines Wasser, 5 ul 5x HF-Puffer, 0,5 ul dNTPs, 0,5 ul 515F Vorwärtsprimer, 0,75 ul 3% DMSO und 0,25 ul Polymerase den Master-Mix für jede Reaktion. Montieren Sie alle Reaktionskomponenten in den Kühler und fügen Sie die Polymerase zuletzt. Gut mischen durch Pipettieren. Fügen Sie zwei zusätzliche Proben der Zählung Reaktion, wenn die Master-Mix vorbereitet, zum Pipettieren Fehler zu berücksichtigen.
  3. PCR-Reaktion Aufbau:
    Hinweis: Führen Sie Amplifikationen in dreifacher Ausfertigung, dh jede Probe in drei separate 25 ul Reaktionen verstärkt wird. Führen Sie einen No-Template-Wassersteuerung mit jedem Paar Primer. Arbeiten Sie schnell, aber sorgfältig, vermeiden Einführung von Verunreinigungen befreien.
    1. Beschriften Sie einen 8-Well Streifen mit Einzeldeckeln und in einen PCR-Kühler.
    2. Pipette 90 ul Master-Mix in den erstenGut.
    3. Fügen Sie 2 ul des reversen Primers (Supplemental File 1). Achten Sie darauf, sorgfältig die Reverse - Primer - Barcode mit jeder Probe in Tabelle 1 verwendet , beachten.
    4. Gut mischen und Transfer 23 ul Master-Mix in den vierten und (die No-Template-Steuerung).
    5. In 2 ul Wasser zum vierten gut.
    6. In 6 ul der entsprechenden Probe in die erste Vertiefung. Gut mischen und übertragen 25 ul auf die zweite gut. Ändern Tipps und übertragen weitere 25 & mgr; l aus dem ersten und zum Brunnen Drittel. Fest Kappe jeder gut darauf achten, nicht in das Innere der Vertiefungen oder Kappe in den Prozess berühren.
    7. Wiederholen Sie für jede Probe.
  4. Führen PCR-Amplifikation
    1. Übertragen Sie die Streifen Rohre zu einem Thermocycler und führen Sie das folgende Programm: 30 s bei 98 ° C, gefolgt von 30 Zyklen von 10 s bei 98 ° C, 30 Sekunden bei 57 ° C und 12 Sekunden bei 72 ° C, gefolgt von einem 10 min halten bei 72 ° C und Endverweilzeit eint 4 ° C.
    2. Die folgenden Schritte werden auf einer sauberen Labortisch. Schnell die Rohre Spinflüssigkeit von den Wänden zu sammeln. Kombinieren dreifach PCR Reaktionen von jeder Probe, mit einem Gesamtvolumen von 75 ul, in ein steriles markierten Röhrchen. Auch Transfer 25 ul jeder No-Template-Steuerung in einem separaten sterilen Röhrchen. Kombinieren Sie nicht Amplikons aus verschiedenen Proben noch.
  5. Validierung erfolgreiche PCR-Amplifikation von Proben durch Gelelektrophorese.
    1. Bereiten Sie eine 1,5% Agarose - Gel (1,5 g Agarose - Pulver in 100 ml 1x TAE - Puffer) mit genügend Brunnen jedes Amplikon zu halten, frei , und Leiter 21.
    2. Während die Gel verhärtet (ca. 30 min), die Probe für die Elektrophorese vorbereitet: 1 & mgr; l 6-fachem Beladungs ​​Farbstoff zu einem neuen, markierten Röhrchen. Zu diesem Rohr, fügen Sie 5 ul des Amplikons und mischen durch Pipettieren.
    3. Wenn das Gel gesetzt hat, entfernen Sie die Kämme, das Gel in der Elektrophorese-Tank zu platzieren, und den Tank mit 1x TAE-Puffer zu füllen. Zum ersten gut, fügen Sie 5 ul DNA-Leiter.
    4. Legen Sie 5 ul der Probe Amplikons zu einem anderen gut. Last 5 ul der no-Template Amplikon zu einem separaten gut. Weiter wie für jede Probe benötigt.
    5. Wenn alle Proben geladen worden ist, schieben Sie den Tankdeckel an Ort und Stelle und schalten Sie die Stromquelle bis 120 V. Lassen Sie das Gel für 30 laufen - 60 min.
    6. Sehen Sie das Gel unter UV-Licht.
      1. Überprüfen Sie, ob eine erfolgreiche Amplifikation jeder Probe durch eine einzige starke Bande um 380 bp unter Hinweis darauf. Wenn es eine Doppelbande ist, re-amplifiziert, die Probe mit einem anderen Rückwärts Barcode (Schritt 2.3). Wenn es kein Band überhaupt, Wieder verstärken die Probe entweder die gleiche Reverse-Barcode oder eine neue Rückwärtsbarcode (Schritt 2.3) verwendet. Wenn erneute Amplifikation nicht erfolgreich ist, können PCR-Inhibitoren in der Probe vorhanden sein, in welchem ​​Fall eine spaltenbasierten DNA cleanup durchführen, um PCR-Inhibitoren zu entfernen.
        Hinweis: Eine erfolgreiche Amplifikation nicht möglich sein kann, wenn die bakterielle DNA-Konzentration in der oderiginal Probe ist unzureichend (<5 ng / ul).
      2. Überprüfen Sie den Mangel an Kontamination der Reagenzien durch das Fehlen einer Band unter Hinweis darauf, in der No-Template-Steuerung.
    7. Bewahren Sie die restlichen 70 ul Amplifikat bei -20 ° C. Entsorgen Sie die restlichen 20 ul der No-Template-Steuerung, vorausgesetzt, es ist nicht eine Band brachte.

3. Bibliothek Pooling und Hochdurchsatz-Sequenzierung

  1. Erstellen Sie die Amplicon-Pool durch ein gleiches Volumen kombiniert (2 bis 5 & mgr; l) jedes Amplifikat in einem einzigen sterilen Röhrchen. Wenn das Band von einer Probe besonders schwach betrachtet, fügen das doppelte Volumen im Vergleich zum Rest der Proben.
  2. Entfernen Sie die PCR - Primer aus dem Amplicon - Pool eine PCR Clean-up - Kit nach den Anweisungen des Herstellers 22. Führen Sie die Clean-up mit mehreren Spalten, wenn das Amplifikat Pool Volumen über 100 & mgr; l ist. Hinweis: Jede Spalte 100 & mgr; l Kapazität hat.
    1. Speichern Sie die Bibliothek bei -20 & #176; C oder zum nächsten Schritt fort.
  3. Falls zutreffend, kombinieren die Grundierung freien Amplikon Pools, um die endgültige Bibliothek erstellen. Bestimmen Sie die DNA - Konzentration der Bibliothek ein Spektrophotometer oder ein fluorometrische System 23. A 260/280 Verhältnis zwischen 1,8-2,0 ist bezeichnend für reine DNA.
  4. Verdünne die Bibliothek 20 nM. Bestätigen Sie die Qualität der Bibliothek mit einem einzigen Band um 400 bp Visualisierung ein Elektrophorese-Instrument. Bestätigen Sie die Konzentration der Bibliothek eine fluorometrische System 23 auf .
  5. Führen Sie eine endgültige Verdünnung von 1:10 in Wasser, um die Bibliothek zu 2 nM zu verdünnen. Speichern Sie dann die Bibliothek bei 20 ° C auf unbestimmte Zeit.
  6. Senden Sie eine Teilmenge der endgültigen Bibliothek mit den drei erforderlichen Sequenzierprimer (Read 1, Read 2 und Index; siehe Tabellen von Materialien / Geräte) auf einem Illumina-Sequenzierer werden. Wenn weniger als 300 Proben für die Sequenzierung gemultiplext wurden, verwenden Sie einen Single-End 300 bp laufen und mit einem 12 bp-Index lesen ona MiSeq, mit einer abschließenden Bibliothek Konzentration von 05.00 und 10% denaturiert PhiX Spike-in. Siehe die ergänzenden Materialien von Caporaso et al. ISME J 2012 10. Ausführliche Sequenzierung Anweisungen.

4. Sequenzanalyse

Hinweis: Umrissen hier ist eine grundlegende Pipeline für die Sequenzanalyse der QIIME 1.8.0 Software-Paket. Der Einfachheit halber nehmen die zur Verfügung gestellten Befehle, dass die Zuordnungsdatei mapping.txt aufgerufen wird, wird der 12 bp-Index lesen Datei namens index.fastq und das 300 bp-Sequenzierung lesen Datei sequences.fastq genannt wird. Installieren Sie QIIME oder MacQIIME 16 und machen Sie sich mit den Grundlagen von UNIX , diese Befehle auszuführen. Lesen Sie die vollständige Anleitung zur QIIME an:

  1. Füllen Sie die Zuordnungsdatei für das Experiment (Tabelle 1). Fügen Sie so viel wie möglich von Metadaten. Anmerkung, die Proben wurden in der gleichen Charge extrahiert oder verstärkt wird, um zu bestimmen, ob es batch-Effekte sind.
  2. zB mapping.txt. Überprüfen Sie die Formatierung der Zuordnungsdatei, indem Sie den folgenden Befehl ausführen: validate_mapping_file.py -m mapping.txt -o mapping_output
    Hinweis: Dieser Befehl wird mit dem eingebauten "validate_mapping_file.py" QIIME Skript, das um einen neuen Ordner macht, die so genannte "mapping_output", eine HTML-Datei unter Angabe der Zuordnungsdatei Fehler enthält, sofern vorhanden.
  3. Prüfen Sie die Qualität der Sequenzierung liest mit Hilfe eines Hochdurchsatz - Sequenzdatenqualität Prüfprogramm, wie FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Abbildung 5 zeigt die pro Basensequenz Qualität das kann von einem erfolgreichen Lauf zu erwarten.
    Hinweis: Der Sequenzer weist jede Nukleotidbase eine Phred Qualität der Gäste, die mit der Wahrscheinlichkeit entspricht, dass die Basis fälschlicherweise genannt wurde. Ein Phred Qualitätsfaktor von 10 zeigt an, dass es eine 10% ige Chance, dass das Nukleotid falsch gewesen zuweisened, 20 weist auf eine Chance von 1%, 30 eine 0,1% ige Chance gibt, und 40 (die höchstmögliche Punktzahl) eine 0,01% ige Chance , 24.
  4. Mit Hilfe der Zuordnungsdatei als Schlüssel, demultiplexen, Qualität der Sequenzierungsdaten filtern und die Ergebnisse in einem Ordner speichern (in diesem Fall, die so genannte "sl_out") von der Ausführung dieses Befehls 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Hinweis: Die q - Flag bezeichnet die maximale inakzeptable Phred Qualität der Gäste, zum Beispiel "-q 29" filtert alle Sequenzen mit Phred Scores unter 30, um sicherzustellen , Genauigkeit von 99,9% der Basis Anrufe.
  5. Mit dem Greengenes 16S operativen taxonomischen Einheit (OTU) Referenzdatenbank 26 (http://qiime.org/home_static/dataFiles.html), führen Open-Referenz OTU Kommissionierung von der Ausführung dieses Befehls 27: pick_open_reference_otus.py -i sl_out / ASTA. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Hinweis: Die Option -s gibtder Anteil der Sequenzen, die an der Referenzdatenbank auszurichten versäumt, die in der de novo clustering aufgenommen werden. "-s 0,1" 10% der ausgefallenen Sequenzen enthält in der de novo - Clustering. Verwenden Sie das Flag -a die OTU Kommissioniervorgang zu parallelisieren und die Bearbeitungszeit von Tagen auf Stunden reduzieren, wenn mehrere Kerne zur Verfügung stehen.
  6. Erstellen Sie eine benutzerfreundliche taxonomischen Fülle Tabelle von OTUs auf Artenebene Verschmelzung von der Ausführung dieses Befehls 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Hinweis: Die resultierende Tabelle leicht in jeder Tabellenkalkulations-Software betrachtet werden können. Beachten Sie, dass 16S-rRNA-Sequenzierung nicht zuverlässig Auflösung Artniveau bietet.
  7. Bestimmen Sie die ökologische Vielfalt in jeder Probe, indem sie mit dem QIIME Skript alpha_diversity.py mehrere Alpha-Diversität Metriken zu berechnen. Anschließend bestimmen Sie die Unterschiede zwischen den Paaren von Proben unter Verwendung des QIIME Skript beta_diversity.py.
  8. Visualize die Daten, zum Beispiel durch einen Kaiser 29 Hauptkoordinaten Grundstück oder Heatmap verwenden.
  9. Führen formale statistische Vergleiche von Mapping - Dateikategorien, zum Beispiel mit QIIME des compare_catagories.py Skript 30.

Representative Results

Die allgemeine Übersicht über das Protokoll, welches die Bestimmung der relativen Abundanzen bakteriellen aus einem Tupfer - Sequenzierung unter Verwendung 16S - rRNA - Gens, dargestellt in Figur 1 .Das Protokoll wurde optimiert für den menschlichen vaginale Abstriche, aber kann leicht angepasst für die meisten Schleimhautmessstellen ermöglicht und anderen Wirten. Abbildung 2 zeigt die hochwertige DNA und RNA, die die sickenschlag Protokoll isoliert werden können. 3 veranschaulicht eine erfolgreiche PCR - Amplifikation von 12 Proben, wobei jede Amplifikation mit einer Probe eine einzige starke Bande der korrekten ergab Größe und jedes Wasserkontrolle hat eine Band nicht ergeben. Abbildung 4 zeigt die Quantifizierung der endgültigen Bibliothek Pool vor der Sequenzierung. 5 zeigt eine typische Abfolge Qualitätsprofil nach einer Single-End 300 bp MiSeq laufen.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Abbildung 1. Schematische Übersicht des Protokolls. Zunächst wird Nukleinsäure aus einem Tupfer von Wulst-Schläge in einer gepufferten Lösung extrahiert , das Phenol, Chloroform und Isoamylalkohol. Variable Region 4 des 16S-rRNA-Gen wird dann aus der erhaltenen Nukleinsäure unter Verwendung von PCR amplifiziert. PCR-Produkte von bis zu Hunderten von Proben werden dann kombiniert und auf einem einzigen Lauf sequenziert. Die resultierenden Sequenzen werden mit einer Referenzdatenbank abgeglichen relativen Abundanzen bakterielle zu bestimmen. Das gesamte Protokoll kann in etwa drei Tagen durchgeführt werden. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Hochwertige Nukleinsäure Heraus Verwendung des Phenol: Chloroform Bead Beating Methode. (A) DNA - Qualität, wie ein Spektrophotometer verwendet wird . Ein A260 / A280 Verhältnis zwischen 1,8 und 2,0 zeigt an reine Nukleinsäure , die nicht mit Phenol oder Protein. (B) Nach einer Spalte Bereinigungs kontaminiert ist, kann dieses Protokoll qualitativ hochwertige RNA ergeben, angezeigt durch starke 16S und 23S - rRNA - Gipfel. (C) RNA - Abbau kann auftreten , wenn die Probe nicht kalt nach der Entnahme gehalten wird (während Transport und Lagerung) oder wenn RNasen während der Verarbeitung vorhanden sind. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Bestätigung der erfolgreichen 16S - rRNA - Gene Amplifikation unter Verwendung der 515F und Barcodierte 806R Primer - Set. Top) Gel - Elektrophorese verwendet , um die Anwesenheit eines einzigen Band um 380 Basenpaare zu bestätigen in jede Probe, die mit Schablone amplifiziert. Das Fehlen einer Bande zeigt erfolglosen Verstärkung; dies ist in der Regel aufgrund von menschlichem Versagen und der PCR - Reaktion aus dieser Probe zu wiederholen. Unten) Kein Template (Wasser) Kontrollen in parallel mit dem gleichen Primerpaar laufen sollte kein Band vorhanden sind. Das Vorhandensein einer Bande in der Wasserkontrolle zeigt an kontaminierten Reagenzien; verwerfen die Reagenzien , die kontaminiert sein können und wieder tun , um die PCR - Amplifikationen sowohl der Vorlage und Wassersteuerung für das Primerpaar. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Quantifizierung der Schluß Bibliothek Pool Konzentration und Validierung der Bibliothek Größe. Nachdem die einzelnen Probe Amplikons Bündelung the Konzentration der fertigen Bibliothek Pool muss bestimmt werden. Die Bibliothek Pool muss dann weiterhin eine 2 nM Konzentration zu erreichen , verdünnt werden. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5. Repräsentative Bar Plot der Sequenz Qualitätsfaktor bei jeder Position des Read. Es ist normal , dass die Sequenz Qualität nach 200 Basenpaare fallen zu lassen, aber die durchschnittliche Qualität der Gäste sollte über 30 bleiben Bitte klicken Sie hier um eine größere Version zu sehen dieser Figur.

#SampleID Strichcode
LinkerPrimer
Sequenz
rcbcPrimer SampleType Extraktion
Stapel
Verstärkung
Teller
Beschreibung
#an Beispiel Mapping-Datei finden Sie unter: http://qiime.org/_static/Examples/File_
Formate /
Beispiel_
Kartierung_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 zervikal
Tupfer
1 EIN

Tabelle 1. Mapping Dateivorlage. Creating eine genaue und gründliche Mapping-Datei für die erfolgreiche kritisch das Protokoll ausführt. Die Mapping - Datei ist nicht nur für die Ausführung von QIIME erforderlich, aber es ermöglicht auch die Forscher den Zusammenhang zwischen der Probe Barcode und Metadaten zu halten, um die Daten für alle systematischer Fehler (zB Batch-to-Batch - Variation) zu analysieren und zu bestimmen , interessante Korrelationen zwischen den Metadaten und Bakterienpopulationen. Eine nackte Knochen-Mapping-Datei zur Verfügung gestellt, aber die Benutzer werden ermutigt, so viele Spalten wie möglich mit Metadaten hinzuzufügen. Beispiele für zusätzliche Metadaten für ein vaginaler Abstrich umfasst das Alter der Teilnehmer, Datum / Uhrzeit der Abstrichentnahme, Art hormonalen Kontrazeptivums (falls zutreffend), sexuell übertragene Infektion Testergebnisse, usw.

suppliment 1
Supplemental - Datei 1. Liste der Barcodierte Reverse Primer Sequenzen 10 Bitte hier klicken , um diese Datei herunterzuladen.

Discussion

Hier beschreiben wir ein Protokoll für die Identifizierung und Charakterisierung der relativen bakteriellen Häufigkeiten innerhalb eines menschlichen vaginaler Abstrich. Dieses Protokoll kann leicht für andere Probentypen, wie Stuhl und Tupfer anderer Körperstellen angepaßt werden, und für Proben aus einer Vielzahl von Quellen gesammelt. Die Extraktion von Nukleinsäure von sicken Schlagen in einer gepufferten Lösung von Phenol und Chloroform ermöglicht die Isolierung von sowohl DNA als auch RNA, die besonders wichtig ist, wenn sie mit wertvollen Proben gesammelt durch klinische Studien zu arbeiten. Die isolierte bakterielle DNA eignet sich hervorragend für bakterielle taxonomische Identifizierung und genomische Montage, während die gleichzeitige Sammlung von RNA die Möglichkeit bietet, funktionelle bakterielle Wirt und Virus-Beiträge durch RNA-seq zu bestimmen. Das beschriebene Protokoll basiert auf einer validierten Ein-Schritt - Primer - Set , das auf einer Vielzahl von Probenarten erfolgreich eingesetzt wurde, einschließlich Mensch, Hund und Umweltproben 10

Die Nukleinsäureextraktion Teil dieses Protokolls wird durch die erforderlichen Sicherheitsvorkehrungen begrenzt, wenn mit Phenol und Chloroform zu arbeiten, und die Herausforderungen, die Pipeline zu einem hohen Durchsatz zu automatisieren, 96-Well-Plattenformat. Zusätzlich wird die kräftige Wulst Schläge für die mechanische Lyse Schere die bakterielle DNA auf ca. 6 kb Fragmente verwendet; wenn längere DNA-Fragmente werden für Downstream-Anwendungen erforderlich, die Dauer der Wulst Schlagen should verkürzt werden. Die Beschränkungen des Bakterienidentifizierungs Teil dieses Protokolls sind inhärent für jede Methode, die auf 16S-rRNA-Gen-Sequenzierung beruht. 16S-rRNA-Sequenzierung ist für die Identifizierung von Bakterien, die zur Gattung und sogar Artniveau ideal, aber nur selten bietet Verformungspegel Identifikation. Während die V4 variable Region der 16S - rRNA - Gen unter den meisten Bakterienarten 11, zusätzliche Rechenverfahren wie Oligotyping 31 robust Diskriminierungs bietet müssen genau verwendet werden , um bestimmte Arten, wie Lactobacillus crispatus identifizieren. Schließlich Informationen über die genaue bakterielle funktionellen Fähigkeiten in einer bestimmten Probe kann nicht allein durch die 16S-rRNA-Gen-Sequenzierung bestimmt werden, obwohl dieses Protokoll Extraktion von whole genome DNA und RNA ermöglicht, die zu diesem Zweck verwendet werden können.

Der kritischste Schritt zur Gewährleistung Erfolg mit diesem Protokoll wird unter großer Sorgfalt Kontamination zu verhindern during Probensammlung, Nukleinsäure-Extraktion und PCR-Amplifikation. Stellen Sie sicher, Sterilität zum Zeitpunkt der Probenentnahme durch saubere Handschuhe tragen und mit sterilen Tupfern, Röhren und Schere. Um eine Kontamination der Sammlung Materialien beurteilen zu können, sammeln negative Kontrolltupfer, indem zusätzliche nicht verwendeten Tupfer direkt in Transportröhren zum Zeitpunkt der Probenahme. Im Labor führen alle Vorverstärkung Schritte in einem sterilisierten Haube nur dekontaminiert liefert und nur mit molekularen, DNA-freie Reagenzien enthält. Während die Nukleinsäureextraktion, verhindern eine Kreuzkontamination durch den Einsatz neuer sterilen Pinzette und frische Handschuhe mit jeder Probe, und halten Sie alle Rohre, es sei denn im Gebrauch geschlossen. Die Verarbeitung nicht verwendeten Tupfer parallel sorgt für Sterilität sowohl der Probensammlung und Nukleinsäure-Extraktion; die nicht verwendeten Tupfer sollte nicht ein Pellet nach Isopropanol-Fällung und Ethanol Waschen erhalten. Wenn ein Pellet angezeigt wird, führen 16S-rRNA-Gen-Amplifikation eine mögliche Quelle zu bestimmen,die Verunreinigung (zB würde das Vorhandensein von Streptococcus oder Staphylococcus Kontamination der Haut zeigen). Zusätzlich führen PCR Amplifikationen ohne Templat Kontrollreaktionen in parallel, um sicherzustellen, dass die PCR-Reagenzien und Reaktionen sind nicht kontaminiert worden ist. Wenn ein Band in einem keine Vorlage Steuerung angezeigt wird, um die Reagenzien zu verwerfen und die Amplifikation mit frischen Reagenzien wiederholen. Diese Vorsichtsmaßnahmen werden erfolgreiche Sequenzierung der Bakterien Interesse sicherzustellen.

Die PCR-Amplifikation Schritt neigt dazu, die meisten Problembehandlung erfordern. Amplifizierung in Gruppen von zwölf Proben stellt ein Gleichgewicht zwischen Effizienz und Konsistenz. Das vollständige Fehlen von Banden in allen Proben in einem bestimmten Verstärkung Satz deutet auf eine systematische Versagen, zum Beispiel vergessen , ein Reagens hinzuzufügen oder falsch den Thermocycler Programmierung. Das Fehlen einer Bande von einigen Proben ist in der Regel aufgrund von menschlichem Versagen und die Amplifikationen erneut r sollteun mit der gleichen Paarung von Probe und Reverse-Primer. Im Fall einer fortgesetzten Abwesenheit eines Bandes kann die Probe mit einem anderen Strichcode unter Verwendung eines reversen Primers erneut amplifiziert werden. Wiederholter Ausfall der PCR mit mehreren Reverse-Primer können einen Inhibitor in der Probe vorhanden zeigen. Inhibitoren entfernen, ohne signifikant zu verändern relativen Abundanzen bakteriellen In diesem Fall wird häufig die DNA mit einer Säule gereinigt wird. Wenn mehrere Bänder nach einer Verstärkung führen, wieder verstärken, um die Probe mit einem anderen Reverse-Primer-Barcode.

Zusätzlich zu einer Kontamination der Umwelt zu verhindern und sicherzustellen, Amplifikation eines einzelnen spezifischen Produkt, erfolgreiche Sequenzierung beruht auf Pflege, wenn die Bibliothek Pool vorbereitet. Das Ziel ist, äquimolare Mengen von jeder Probe des Amplicons zu kombinieren etwa die gleiche Anzahl von Sequenzierungs sicherzustellen pro Abtastwert liest. Wenn die Nukleinsäure-Konzentrationen vor der Verstärkung vergleichbar sind, das Hinzufügen einfach gleichen Volumina jeder sample des Amplikons ist ausreichend, wenn die Bibliothek Pool zu schaffen. Jedoch, wenn die Nukleinsäurekonzentrationen erheblich unterschiedlich sind und in gleichem Volumen, wobei die Probe mit der geringen Nukleinsäurekonzentration wird schlecht mit einer geringen Anzahl von Lesevorgängen dargestellt zugesetzt. In diesem Fall ist es möglich, ein höheres Volumen der Amplikons von der Niedrigkonzentrationsprobe von der relativen Intensität der Gel-Bande basierend hinzuzufügen. Alternativ ist es möglich, rigoroser Primern aus den einzelnen Amplifikaten entfernen, quantifizieren die einzelnen Proben Amplicon-Konzentration einen fluorimetrischen Quantifizierung dsDNA-Kit und genau äquimolaren Mengen jeder Probe kombinieren.

Sobald ein ausgewogenes Amplicon-Pool generiert wird, wird es von entscheidender Bedeutung, um sorgfältig die Konzentration des Pool messen. Im Anschluss vorsichtig Verdünnung und Spike-in mit PhiX erhöhen die Lese Komplexität für das Erreichen optimaler Sequenzierungsergebnisse kritisch ist. Hochdurchsatz-Sequenzern, die Sequen verwendencing durch Synthese sind in den Cluster-Dichte auf der Durchflusszelle sehr empfindlich. Laden einer Bibliothek Pool, der auch konzentriert in overclustering, mit geringerer Qualität Partituren, geringere Datenausgabe und ungenau Demultiplexen 32 führen wird. Laden eines Bibliothek-Pool, der auch bei niedrigen Datenausgang führt zu verdünnt wird. die Bibliothek Pool vor der Sequenzierung sorgfältig Quantifizierung werden optimale Ergebnisse zu gewährleisten.

16S-rRNA-Gen-Sequenzierung bietet eine umfassende Beurteilung der vorhandenen Bakterien innerhalb einer gegebenen Probe und ist ein absolut entscheidender erster Schritt in Hypothesengenerierung. Das Vorhandensein einer umfangreichen Satz von Metadaten ermöglicht weiterhin die Forscher Assoziationen zwischen bestimmten Bakterienarten zu testen und wichtige biologische Faktoren. Darüber hinaus kann die gleiche 16S - Informationen verwendet werden , um die bakterielle Funktionen mit Werkzeugen ableiten wie PICRUSt 33. Oberstes Ziel ist es 16S Charakterisierung verwenden neue Assoziationen zu identifizieren, die sein könnenweiter getestet und in Modellsystemen validiert, zusätzlich zu unserem wachsenden Verständnis der Auswirkungen der bakteriellen microbiome auf die menschliche Gesundheit und Krankheiten.

Acknowledgements

Wir möchten, dass Elizabeth Byrne, David Gootenberg und Christina Gosmann für kritisches Feedback über das Protokoll zu danken; Megan Baldridge, Scott Handley, Cindy Monaco und Jason Norman für die Probenvorbereitung Führung und Demonstrationen; Wendy Garrett, Curtis Huttenhower Skip Virgin und Bruce Walker für die Protokoll-Rat und fruchtbare Diskussionen; und Jessica Hoisington-Lopez für die Sequenzierung Unterstützung. Die Arbeit wurde von der Bill and Melinda Gates Foundation, und die NIAID (1R01AI111918) nicht unterstützt. DSK erhielt zusätzliche Unterstützung vom Burroughs Wellcome Fund. MNA wurde von Verleihungsnummer T32GM007753 vom NIGMS, und der Paul und Daisy Soros Fellowship unterstützt. Der Inhalt ist allein in der Verantwortung der Autoren und stellen nicht notwendigerweise die offizielle Position der NIGMS oder die NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics