Eficiente de Ácido Nucleico Extração e sequenciamento genético 16S rRNA para Bacteriana Comunidade Caracterização

Biology
 

Summary

Nós descrevemos um método eficiente, robusto e de baixo custo para extração de ácidos nucleicos de cotonetes para a caracterização das comunidades bacterianas usando 16S rRNA amplicon gene seqüenciamento. O método permite uma abordagem comum para processamento de múltiplos tipos de amostras e acomoda uma série de processos analíticos jusante.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Existe uma crescente valorização para o papel das comunidades microbianas como moduladores críticos da saúde humana e doenças. tecnologias de sequenciação de alto rendimento têm permitido a caracterização rápida e eficiente de comunidades bacterianas usando rRNA 16S de sequenciação de genes a partir de uma variedade de fontes. Embora ferramentas prontamente disponíveis para seqüenciamento do gene 16S rRNA têm fluxos de trabalho computacionais padronizadas, processamento de amostras para extração de DNA continua a ser uma fonte contínua de variabilidade entre os estudos. Aqui nós descrevemos um método eficiente, robusto e rentável para extrair ácidos nucleicos a partir de esfregaços. Também delinear métodos jusante para sequenciamento de genes 16S rRNA, incluindo a geração de bibliotecas de sequenciamento, controle de qualidade de dados e análise de sequência. O fluxo de trabalho pode acomodar vários tipos de amostras, incluindo fezes e suabes coletados a partir de uma variedade de locais anatômicos e espécies hospedeiras. Além disso, recuperou ADN e ARN podem ser separados e utilizadospara outras aplicações, incluindo a sequenciação do genoma total ou RNA-seq. O método descrito permite uma abordagem processamento comum para vários tipos de amostras e acomoda análise a jusante da informação genómica, metagenômica e transcrição.

Introduction

O ser humano inferior trato reprodutivo, sistema gastrointestinal, trato respiratório e da pele são colonizados por comunidades bacterianas complexas que são fundamentais para a manutenção da homeostase do tecido e apoiar a saúde do hospedeiro 1. Por exemplo, certa lactobacilos criar um ambiente inóspito para patógenos por acidificação da cúpula vaginal, produzindo efetores antimicrobianos e modulação da imunidade host local 2-4. A apreciação crescente para a importância do microbioma bacteriana também tem aumentado o interesse na caracterização de comunidades bacterianas em muitos contextos clínicos. Aqui nós descrevemos um método para determinar a composição do microbioma bacteriano a partir de esfregaços genitais. O protocolo pode ser facilmente modificado para amostras de fezes e suabes coletados de outras localizações anatômicas e outras espécies hospedeiras.

Devido às limitações inerentes ao número de amostras que podem ser recolhidos e armazenados a partir de um determinado pernoY participante, este protocolo foi concebido para extrair o ADN, ARN, e potencialmente ainda proteína a partir de uma única mecha com um fenol-clorofórmio com esferas batendo-5,6 método adaptado. A combinação de ruptura física das paredes das células bacterianas com talão-batimento e perturbações química com detergentes permite rápida de lise de bactérias Gram-positivas, Gram-negativas, e ácido-resistentes, sem etapas adicionais de digestão enzimática. Para obter o RNA de alta qualidade, é recomendado o uso de compressas secas que foram mantidas a ou abaixo de 4 ° C imediatamente após a colheita e durante o transporte para o laboratório (se aplicável), e armazenada a longo prazo a -80 ° C.

Para determinar o microbioma bacteriana dentro de uma dada amostra, este procedimento utiliza 16S rRNA sequenciamento amplicon gene, que é atualmente o meio mais rentáveis ​​para atribuir de forma abrangente taxonomia bacteriana e realizar quantificação relativa. Os métodos alternativos incluem alvo qPCR 7, microarr personalizadoays 8, e de todo o sequenciamento do genoma 9. O gene 16S rRNA contém nove regiões hipervariáveis, e não há consenso sobre a região V ideal para sequenciar para estudos microbioma vaginais. Aqui usamos o conjunto de primers 515F / 806R e construir sobre o gasoduto projetado pelo Caporaso et al. 10-12. Caporaso et al 's. 515F / 806R conjunto de iniciadores permite a multiplexação de centenas de amostras em uma única sequenciamento de execução devido à disponibilidade de milhares de primers barcoded validados e compatibilidade com plataformas de sequenciamento Illumina. Ao contrário de 27F / 338R cartilha do Projeto Microbioma Humano ajuste 13, 515F / 806R também amplifica efetivamente Bifidobacteriaceae e capta com precisão, assim, Gardnerella vaginalis, um membro importante da comunidade microbiana vaginal em algumas mulheres. Em alternativa, um par de iniciadores de 338F / 806R tem sido utilizado com sucesso para pyrosequencing de amostras vaginais 14 e um par de iniciadores de 515F / 926R tem recently se tornam disponíveis para a próxima geração de sequenciamento 12.

Finalmente, este protocolo fornece instruções básicas para realizar 16S análise amplicon utilizando os Insights quantitativos em Ecologia Microbiana (QIIME) Pacote de software 15. A implementação bem sucedida dos comandos QIIME descritos aqui gera uma tabela contendo abundâncias taxonômicos de bactérias para cada amostra. Muitos passos adicionais de controlo de qualidade, os métodos de classificação taxonómica, e passos de análise podem ser incorporadas na análise, tal como descrito em detalhe no site da QIIME (http://qiime.org/index.html). Se a análise será realizada em um computador Apple, o pacote MacQIIME 16 oferece fácil instalação de QIIME e suas dependências. Pacotes de software alternativos para análise de sequência do gene 16S rRNA incluem Mothur 17 e UPARSE 18.

Protocol

O protocolo do estudo foi aprovado pelo e seguiu as orientações do Comitê de Investigação Biomédica de Ética da Universidade de KwaZulu-Natal (Durban, África do Sul) e do Hospital Institutional Review Board Geral de Massachusetts (2012P001812 / MGH; Boston, MA).

1. Extração do total de ácido nucleico de cervicovaginais Cotonetes

Nota: Executar extrações de ácido nucleico em conjuntos de, 16 amostras ou menos. O protocolo conforme escrito abaixo assume amostras são processadas em conjuntos de 12. Se a execução de várias rodadas de extrações, número de série dos lotes de extração e gravar o número do lote de extração de cada amostra, bem como outras informações de amostra (incluem metadados, como número de identificação, idade do participante , a data / hora da coleta por swab, tipo de contraceptivo hormonal, sexualmente transmitidas resultados dos testes de infecção, etc.) na Tabela 1.

  1. Preparação de Reagentes e exaustor
    1. Ajustar o pH do fenol: clorofórmio: álcool isoamílico (IAA) (25: 24: 1) para pH 7,9 pela adição de 65 ul de tampão alcalina Tris por 1 ml de fenol, agitação da mistura durante 2 min, e permitindo que as duas fases de separada naturalmente ou por centrifugação a 10000 xg durante 5 min à TA.
      Atenção: O fenol é tóxico se ingerido, inalado ou em contato com a pele e os olhos. Não respirar os fumos. Use luvas impermeáveis, óculos de segurança com anteparos laterais, e um jaleco.
    2. Filtro-esterilizar 25 ml de sulfato de dodecilo de sódio a 20% (SDS) através de um filtro de 0,22 um. Faça alíquotas de 5 ml de SDS a esterilizadas.
    3. Refrigerar uma alíquota de 10 ml de isopropanol a -20 ° C.
    4. Preparar um tubo de talão batimento para cada sWAB para ser processada por pesagem de 0,3 g de esferas de vidro para um tubo estéril 2 ml, que é apropriado para o batedor de esferas.
    5. Obter cotonetes, por amostragem, a ectocérvice com uma compressa absorvente estéril. Imediatamente após a coleta, coloque o algodão embebido em um cryovial vazio e estéril, armazenar a 4 ° C, durante 1-4 horas durante o transporte para o laboratório, e armazenar durante vários meses a -80 ° C. Transfira os swabs (contidos em tubos individuais) para ser processado em gelo molhado.
    6. Prepare o gabinete de segurança biológica (BSC). Usar uma BSC com um "dedal" ligado à extracção do edifício para assegurar a remoção adequada de produtos químicos voláteis.
      1. Retire todos os materiais da capa.
      2. Limpar todas as superfícies da capa com lixívia, seguido por um descontaminante que remove RNases, DNases, e DNA de superfícies. Limpar todos os itens subsequentes trazidos para o exaustor com lixívia seguido por um descontaminante ácido nucleico, incluindo luvas. Utilizar os reagentes frescos RNase DNase-livre /, como pdicas ipette, sempre que possível.
      3. Gravar um saco de risco biológico química esterilizado para a parte traseira da capa. Todos os resíduos secos contendo fenol ou clorofórmio deve ser colocado em este saco para o descarte adequado.
      4. Coloque um frasco esterilizado no capuz para recolher os resíduos líquidos contendo fenol ou clorofórmio.
  2. extracção com fenol-clorofórmio.
    1. Na capa, a cada tubo de batimento do grânulo, adicionar 500 ul de tampão (a partir do passo 1.1.1), 210 ul de sulfato de dodecilo de sódio a 20%, e 500 ul de fenol: clorofórmio: IAA (25: 24: 1, pH 7,9 ).
    2. Transferir o cotonete do frasco de transporte para dentro do tubo talão batendo usando um novo par de pinças esterilizadas. Absolutamente esfregar a cabeça cotonete contra as paredes internas do tubo de talão batida durante pelo menos 30 seg. Re-tampão da amostra quando terminar. Se realizar extrações de vários cotonetes, mudar de luvas entre cada amostra.
    3. Arrefeça a amostra em gelo durante pelo menos 10 min. Remova o cotonete dotalão batendo tubo segurando a alça swab com pinças estéreis enquanto pressiona a cabeça cotonete contra a parede do tubo interno utilizando uma ponta P200 limpo. Descarte os cotonetes no saco de lixo químico. Nota: A ação "rodo" (pressionando a cabeça swab) irá liberar o líquido do swab absorvente e aumentar a recuperação de ácido nucleico.
    4. Colocar o tubo talão batendo no batedor de esferas e homogeneizar durante 2 min a 4 ° C.
    5. Centrifugar o tubo de batimento talão durante 3 min a 6000 xg e 4 ° C para sedimentar os detritos e separar as fases aquosas e de fenol.
    6. Transferir a fase aquosa (~ 500-600 uL) para um tubo esterilizado de 1,5 mL. Adicione um volume igual de fenol: clorofórmio: IAA. Misturar por inversão e breve vórtice.
    7. Centrifugar o tubo durante 5 min a 16000 xg e 4 ° C.
    8. Transferir a fase aquosa a um novo tubo esterilizado de 1,5 mL. Ser conservador e não transferem material da camada de interfase ou o fenol subjacenteEstágio. Note-se a volume da fase aquosa transferida. Salve a fase de fenol para o futuro isolamento de proteínas.
    9. Adicionar 0,8 volume de isopropanol e 0,1 volumes de acetato de sódio 3M (pH 5,5). Misturar bem por inversão e vórtex brevemente.
    10. Precipitar o ácido nucleico arrefecendo o tubo à temperatura de -20 ° C durante pelo menos 2 h (até S / N).
  3. precipitação com isopropanol e lavagem de etanol
    1. Centrifuga-se o tubo durante 30 minutos a aproximadamente de 16.000 x g e 4 ° C. Cuidadosamente usar uma pipeta para remover o sobrenadante, deixando o pellet intacto.
    2. Adicionar 500 ul de etanol a 100%. Desalojar o sedimento com vórtex suave ou pipetagem sem tocar a pelota. Centrifugar durante 5 minutos a 16000 xg e 4 ° C.
    3. Cuidadosamente descartar o sobrenadante de etanol. Usar uma pipeta de P10 para remover o máximo possível de etanol, sem perturbar o sedimento.
    4. Ar secar o sedimento à temperatura ambiente durante 15 min.
    5. Ressuspender o sedimento em 20 ul de uLTRA-puro 0,1x tampão Tris-EDTA. Deixar a amostra para relaxar em gelo durante 10 min e pipeta várias vezes para garantir a ressuspensão completa. Se a pelete não se dissolve, transferir o tubo para um bloco de calor a 40 ° C durante até 10 minutos para facilitar a dissolução.
    6. Medir a concentração de ácido nucleico usando um espectrofotómetro 19.
    7. Se desejado, o DNA separado a partir de RNA usando um kit de limpeza de coluna, seguindo o protocolo do fabricante 20.
    8. Armazenar o ácido nucleico a -80 ° C ou continuar.

2. Amplificação por PCR do gene da região hipervariável V4 16S rRNA

Nota: Executar a amplificação por PCR em conjuntos de amostras de 12 ou menos para minimizar o risco de contaminação e de erro humano. Se executar várias rodadas de amplificação, número de série dos lotes de amplificação e gravar número de lote ampliação de cada amostra na Tabela 1.

  1. preparação dof os reagentes e capô PCR
    1. Adicionar a informação definida amplificação por PCR com a Tabela 1, a qual irá servir como a base do ficheiro de mapeamento na fase de análise da sequência.
    2. Remove todos os materiais a partir de uma capa de PCR e limpar as superfícies internas cuidadosamente com lixívia seguido por um descontaminante que remove RNases, DNases, e ADN. Certifique-se de descontaminar todos os reagentes e peça de equipamento (por exemplo, pipetas) antes de os colocar na capa. Usar luvas frescos limpos com um descontaminante ácido nucleico antes de trabalhar na capa.
    3. Se necessário, diluir o molde de ácido nucleico de 50 - 100 ng / ul usando livre de ADN e livre de nuclease água.
    4. alíquotas descongelamento das 5x de alta fidelidade (HF) tampão, dNTPs, e primers na capa PCR clean. Suavemente vórtice e centrifuga-se todas as soluções após a descongelação. Para minimizar a ciclos de congelação-descongelação e o risco de contaminação do estoque, preparar as alíquotas de 5x tampão de HF, dNTP e iniciadores.
    5. Colocar umbancada limpa prateleira refrigerador para microtubos e uma placa refrigerador PCR no capuz.
  2. Para a reacção de PCR, preparar a mistura principal através da combinação de 15,5 ul de água ultra-pura, 5 ul de tampão 5x HF, 0,5 ul de dNTP; 0,5 ul de 515F iniciador directo, 0,75 ul de 3% de DMSO e 0,25 ul de polimerase para cada reacção. Montagem de todos os componentes da reação no refrigerador e adicione a polimerase passado. Misturar bem por pipetagem. Adicionar duas amostras extras para a contagem de reacção ao preparar a mistura principal, para dar conta de erros de pipetagem.
  3. PCR configuração reação:
    Nota: Execute amplificações em triplicado, ou seja, cada amostra é amplificada em três 25 reações ul separadas. Executar um controle de água não-modelo com cada par de primer. Trabalhar rapidamente, mas com cuidado, evitando a introdução de qualquer contaminação.
    1. Rotular um tira de 8 poços com tampas individuais e coloque em um refrigerador de PCR.
    2. Pipeta 90 ul de mistura principal para o primeirobem.
    3. Adicionar 2 ul de iniciador inverso (Ficheiro Suplementar 1). Certifique-se de observar cuidadosamente o código de barras iniciador inverso utilizado com cada amostra na Tabela 1.
    4. Misturar bem e transferir 23 ul de mistura principal para o quarto poço (o controlo sem molde).
    5. Adicionar 2 mL de água para o quarto poço.
    6. Adicionar 6 ul de amostra apropriado para o primeiro poço. Misturar bem e transferir 25 ul para o segundo poço. Alterar dicas e transferir mais 25 ul da primeira cavidade para o terceiro poço. Firmemente coroar todos os bem, tomando cuidado para não tocar no interior dos poços ou boné no processo.
    7. Repita para cada amostra.
  4. Realizar a amplificação por PCR
    1. Transferência dos tubos de tiras a um termociclador e executar o seguinte programa: 30 seg a 98 ° C, seguido de 30 ciclos de 10 seg a 98 ° C, 30 seg a 57 ° C, e 12 seg a 72 ° C, seguido por um 10 min segurar a 72 ° C e manter a últimaT 4 ° C.
    2. Execute as seguintes etapas em um banco de laboratório limpo. giram rapidamente os tubos a recolher líquido das paredes. Combinar as reacções de PCR em triplicado de cada amostra, com um volume total de 75 ul, para um tubo rotulado estéril. Também transferir 25 ul de cada controlo não-molde para um tubo estéril separada. Não combine amplicons de amostras diferentes ainda.
  5. Validação de uma amplificação bem sucedida de PCR de amostras por electroforese em gel.
    1. Preparar um gel de agarose a 1,5% (1,5 g de agarose em pó em 100 ml de tampão 1 x TAE) com cavidades suficientes para manter cada fragmento amplificado, o controlo de água, e escada 21.
    2. Enquanto os endurece em gel (cerca de 30 min), preparar a amostra para electroforese: Adicione 1 ml de corante 6x carregamento para um tubo novo, rotulado. Para que o tubo, adicionam-se 5 ul do fragmento amplificado e misturar por pipetagem.
    3. Quando o gel se pôs, remover os pentes, coloque o gel no tanque de eletroforese, e encher o depósito com tampão 1x TAE. Para o primeiro poço, adicionam-se 5 ul de escada de ADN.
    4. Carga de 5 ul do fragmento amplificado de amostra para outro poço. Carga de 5 ul do fragmento amplificado não-modelo a um poço separado. Continue conforme necessário para cada amostra.
    5. Quando todas as amostras foram carregadas, deslize a tampa do reservatório no lugar e ligue a fonte de alimentação a 120 V. Permitir que o gel de correr para 30 - 60 min.
    6. Ver o gel sob luz UV.
      1. Verifique amplificação bem sucedida de cada amostra por referir uma única banda forte em torno de 380 pb. Se há uma banda dupla, re-amplificar a amostra com um código de barras diferente reversa (Passo 2.3). Se não houver nenhuma banda em tudo, re-amplificar a amostra usando o mesmo código de barras inversa ou um novo código de barras reversa (Passo 2.3). Se re-amplificação não for bem sucedida, os inibidores de PCR podem estar presentes na amostra, em cujo caso, realizar uma limpeza de ADN baseada em coluna para remover os inibidores de PCR.
        Nota: a amplificação bem sucedida pode não ser possível se a concentração de DNA bacteriano ou noiginal amostra é insuficiente (<5 ng / mL).
      2. Verificar a ausência de contaminação do reagente notando a ausência de uma banda no controlo sem modelo.
    7. Armazenar os restantes 70 ul do fragmento amplificado a -20 ° C. Descartar os restantes 20 mL do controlo sem molde, assumindo que não deu uma banda.

3. Biblioteca Pooling e alto throughput sequenciação

  1. Criar o conjunto fragmento amplificado através da combinação de um volume igual (2-5 ul) de cada fragmento amplificado num único tubo estéril. Se a banda a partir de uma amostra parecia particularmente fraco, adicionar duas vezes a relação de volume para o resto das amostras.
  2. Remover os iniciadores de PCR a partir da piscina de amplicão, utilizando um kit PCR Clean-up, seguindo as instruções do fabricante 22. Realize a limpeza com várias colunas, se o volume de conjunto de amplicon é mais de 100 mL. Nota: Cada coluna tem uma capacidade de 100 uL.
    1. Armazenar a biblioteca a -20 & #176; C ou prosseguir para a próxima etapa.
  3. Se for o caso, combine as piscinas amplicon livre de primers para criar a biblioteca final. Determinar a concentração de DNA da biblioteca utilizando um espectrofotómetro ou de um sistema de 23 fluorométrico. Um rácio 260/280 entre 1,8-2,0 é indicativo de DNA pura.
  4. Diluiu-se a biblioteca de 20 nM. Confirmar a qualidade da biblioteca de visualização de uma única banda de cerca de 400 pb usando um instrumento de electroforese. Confirmar a concentração da biblioteca utilizando um sistema de 23 fluorométrico.
  5. Efectuar uma diluição final 1:10 em água para diluir a biblioteca a 2 nM. Em seguida, a biblioteca armazenar a 20 ° C indefinidamente.
  6. Enviar uma alíquota da biblioteca final com os três iniciadores de sequenciação necessários (Leia 1, Leia 2, e índice; ver quadros de materiais / equipamentos) a ser sequenciado num sequenciador Illumina. Se menos de 300 amostras foram multiplexados para o seqüenciamento, usar um único-end 300 pb prazo e com um índice de 12 bp ler ond MiSeq com uma concentração final da biblioteca de pM e um 5 a 10% desnaturado espiga em phix. Veja os materiais suplementares de Caporaso et al. ISME J de 2012 10 para instruções detalhadas de sequenciamento.

Análise 4. Sequence

Nota: Descrito aqui é um gasoduto de base para a análise de sequência utilizando o pacote de software QIIME 1.8.0. Para simplificar, os comandos fornecidos assumir que o arquivo de mapeamento é chamado mapping.txt, o índice de 12 bp ler o arquivo é chamado index.fastq, eo sequenciamento de 300 pb ler o arquivo é chamado sequences.fastq. Instale QIIME ou MacQIIME 16 e se familiarizar com os conceitos básicos de UNIX para executar estes comandos. Leia o guia completo para QIIME em:

  1. Completar o arquivo de mapeamento para o experimento (Tabela 1). Inclua o máximo de metadados quanto possível. Observe que as amostras foram extraídas ou amplificado no mesmo lote, para determinar se existem efeitos de lote.
  2. por exemplo, mapping.txt. Validar a formatação do arquivo de mapeamento, executando o seguinte comando: validate_mapping_file.py -m mapping.txt -o mapping_output
    Nota: Este comando usa o script QIIME built-in "validate_mapping_file.py" que faz com que uma nova pasta, chamada "mapping_output", que contém um arquivo .html que indica os erros de arquivo de mapeamento, se houver.
  3. Verifique a qualidade do sequenciamento lê usando um high-throughput qualidade dos dados verificação de sequência de programa, como FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). A Figura 5 demonstra a qualidade per sequência de bases que pode ser esperado de uma temporada de sucesso.
    Nota: O sequenciador atribui a cada base de nucleotídeo uma pontuação de qualidade Phred, o que corresponde à probabilidade de que a base foi erroneamente chamado. Uma pontuação de 10 indica qualidade Phred que existe uma probabilidade de 10% que o nucleótido tem sido incorrectamente atribuired, 20 indica uma chance de 1%, 30 indica uma chance de 0,1%, e 40 (da pontuação mais alta possível) indica a chance de 0,01% 24.
  4. Usando o arquivo de mapeamento como uma chave, demultiplex, a qualidade filtrar os dados de sequenciamento, e salvar os resultados para uma pasta (neste caso, chamado de "sl_out") executando este comando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Nota: A bandeira q denota a máxima pontuação de qualidade inaceitável Phred, por exemplo, "q 29" filtra quaisquer sequências com pontuação abaixo de 30 Phred, assegurando 99,9% de precisão das chamadas base.
  5. Usando o banco de dados Greengenes 16S operacional unidade taxonômica (OTU) de referência 26 (http://qiime.org/home_static/dataFiles.html), execute-referência aberta OTU escolher executando este comando 27: pick_open_reference_otus.py -i sl_out / PDCs. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Nota: A bandeira indica -sa fracção de sequências que não conseguiu alinhar para o banco de dados de referência que irão ser incluídas no agrupamento de novo. "-s 0.1" inclui 10% das sequências falhou no agrupamento de novo. Use a bandeira -a para paralelizar o processo de picking OTU e reduzir o tempo de processamento de dias para horas caso de múltiplos núcleos estão disponíveis.
  6. Crie uma tabela abundância taxonômica user-friendly, fundindo OTUs ao nível de espécie executando este comando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Nota: A tabela resultante pode ser facilmente visualizado em qualquer software de planilha. Note-se que 16S rRNA sequenciamento não fornece de forma confiável resolução nível de espécie.
  7. Determinar a diversidade ecológica dentro de cada exemplo calculando várias métricas de diversidade alpha com a alpha_diversity.py roteiro QIIME. Em seguida, determinar a diversidade entre pares de amostras usando o beta_diversity.py roteiro QIIME.
  8. Visualize os dados, por exemplo, usando um principal Imperador 29 coordenadas de plotagem ou heatmap.
  9. Realizar comparações estatísticas formais de categorias de arquivos de mapeamento, por exemplo, com roteiro compare_catagories.py de QIIME 30.

Representative Results

A visão geral do protocolo, que permite a determinação da abundância de bactérias relativas de uma mecha usando 16S rRNA seqüenciamento de genes, é mostrado na Figura protocolo 1 .O foi optimizada para secreção vaginal humanos, mas pode ser facilmente adaptado para a maioria dos locais de amostragem da mucosa e outros hospedeiros. a Figura 2 demonstra o ADN de alta qualidade e ARN que pode ser isolado utilizando o protocolo de talão-batimento. a Figura 3 ilustra uma amplificação por PCR bem sucedida de 12 amostras, onde cada amplificação com uma amostra produziu uma única banda forte da correcta tamanho e cada controle de água não deu uma banda. a Figura 4 ilustra a quantificação do conjunto final da biblioteca antes da sequenciação. a Figura 5 mostra um perfil típico de qualidade sequência após uma única ponta 300 pb MiSeq prazo.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
A Figura 1. Visão geral esquemática do protocolo. Em primeiro lugar, o ácido nucleico que é extraída a partir de uma zaragatoa por grânulo-batendo numa solução tamponada que contém fenol, clorofórmio, ea álcool isoamílico. região variável 4 do gene de ARNr 16S é então amplificado a partir do ácido nucleico utilizando PCR resultante. amplicons de PCR de até centenas de amostras são então combinados sequenciado e em uma única corrida. As sequências resultantes são comparadas com uma base de dados de referência para determinar abundâncias bacterianas relativos. O protocolo completo pode ser realizado em aproximadamente três dias. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. alta qualidade de Ácido Nucleico extraído utilizando o Fenol: Clorofórmio Bead batendo Método. (A) a qualidade do DNA, tal como avaliado utilizando um espectrofotómetro. Uma razão A260 / A280 de 1,8 ea 2,0 indica ácido nucleico puro que não está contaminada com fenol ou proteína. (B) Depois de uma coluna de limpeza, este protocolo pode produzir ARN de alta qualidade, indicada por fortes picos de 16S e 23S rRNA. (C) a degradação de ARN pode ocorrer se a amostra não é mantido frio após a coleta (durante o transporte e armazenamento) ou se RNases estão presentes durante o processamento. por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. A confirmação do sucesso 16S rRNA Gene Amplification Usando a 515F e 806R Barcoded Primer Set. Topo) A electroforese em gel é usado para confirmar a presença de uma única banda de cerca de 380 pares de bases IN a cada amostra que foi amplificada com o molde. A ausência de uma banda indica a amplificação sem sucesso; Isso geralmente é devido a erro humano e a reação de PCR a partir dessa amostra deve ser repetido. inferior) no modelo (de água) controles correr em paralelo com o mesmo par de primers não deve ter uma banda de presente. A presença de uma banda no controle da água indica reagentes contaminados; descartar as reagentes que podem ser contaminados e re-fazer as amplificações da PCR, tanto do modelo e água controle para esse par de primers. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. Quantificação da concentração Biblioteca final Piscina e Validação do tamanho da biblioteca. Depois reunindo os fragmentos amplificados de amostras individuais, the concentração da piscina biblioteca final deve ser determinada. A piscina biblioteca deve então ser diluída para atingir uma concentração de 2 nM. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5. Representante Bar Plot da sequência de Índices de qualidade em cada posição do Ler. É normal que a qualidade sequência a cair depois de 200 pares de bases, mas o escore médio de qualidade deve permanecer acima de 30. Por favor, clique aqui para ver uma versão maior desta figura.

#SampleID Código de barras
LinkerPrimer
Seqüência
rcbcPrimer SampleType Extração
fornada
Amplificação
prato
Descrição
arquivo de exemplo mapeamento #An podem ser encontradas em: http://qiime.org/_static/Examples/File_
formatos /
Exemplo_
Mapeamento_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervical
Cotonete
1 UMA

Tabela 1. Mapeamento de arquivo de modelo. Creating um arquivo de mapeamento preciso e completo é essencial para a execução com sucesso o protocolo. O arquivo de mapeamento não só é necessária para a execução de QIIME, mas também permite que o pesquisador de manter a ligação entre o código de barras da amostra e metadados, para analisar os dados para quaisquer desvios sistemáticos (por exemplo, de lote para lote variação), e para determinar correlações interessantes entre os metadados e as populações bacterianas. Um arquivo de mapeamento de nu-ossos é fornecido, mas usuários são encorajados a adicionar tantas colunas contendo metadados possível. Exemplos de metadados adicionais para um esfregaço vaginal inclui a idade, a data / hora do participante da coleta de swab, tipo de contraceptivo hormonal (se aplicável), infecção sexualmente transmissíveis resultados dos testes, etc.

suppliment 1
Suplementar arquivo 1. Lista de códigos de barra dos iniciador inverso Sequências 10 Por favor clique aqui para baixar esse arquivo.

Discussion

Aqui nós descrevemos um protocolo para a identificação e caracterização de abundâncias bacterianas relativo dentro de um esfregaço vaginal humana. Este protocolo pode ser facilmente adaptado para outros tipos de amostras, tais como fezes e suabes de outros locais do corpo, e para amostras coletadas a partir de uma ampla variedade de fontes. A extracção de ácido nucleico de cordão-batendo numa solução tamponada de fenol e clorofórmio permite o isolamento de ambos o ADN e ARN, que é particularmente importante quando se trabalha com amostras preciosas recolhidos por meio de estudos clínicos. O DNA bacteriano isolado é excelente para a identificação taxonômica bacteriana e montagem genômica, enquanto a recolha simultânea de RNA fornece a oportunidade de determinar bacteriana funcional, anfitrião, e as contribuições virais através de RNA-seq. O protocolo descrito utiliza um conjunto validado de uma etapa de primer que foi implantado com sucesso em uma ampla gama de tipos de amostras, incluindo humano, canino, e amostras ambientais 10

A parte de extração de ácidos nucléicos deste protocolo é limitado pelas precauções de segurança necessárias quando se trabalha com fenol e clorofórmio, e os desafios da automatização do gasoduto para uma alta taxa de transferência, formato de placa de 96 poços. Adicionalmente, o batimento vigorosa grânulo usado para as tesouras lise mecânica do ADN bacteriano de cerca de 6 fragmentos de quilobases; se fragmentos de ADN mais longos são necessários para aplicações a jusante, a duração do talão batendo should ser encurtado. As limitações da porção de identificação bacteriana deste protocolo são inerentes a qualquer método que se baseia em seqüenciamento do gene 16S rRNA. 16S rRNA seqüenciamento é ideais para a identificação de bactérias para o nível de género e até mesmo espécies, mas raramente fornece a identificação do nível de tensão. Enquanto a região variável da V4 do gene 16S rRNA proporciona a discriminação entre a maioria das robusta 11 espécies bacterianas, métodos computacionais adicionais, tais como Oligotyping 31 pode precisar de ser usada para identificar com precisão certas espécies, tais como Lactobacillus crispatus. Finalmente, a informação sobre as capacidades funcionais bacterianos precisa dentro de uma determinada amostra não pode ser determinada por sequenciação de 16S rRNA gene sozinho, embora este protocolo permite a extracção do DNA do genoma e ARN que podem ser usadas para esta finalidade.

O passo mais fundamental para garantir o sucesso com este protocolo está tomando grande cuidado para evitar contaminação during de recolha de amostras, a extracção de ácido nucleico, e a amplificação por PCR. Assegurar a esterilidade no momento da coleta da amostra através do uso de luvas limpas e usar compressas estéreis, tubos e tesoura. Para avaliar se há contaminação dos materiais de coleta, coletar swabs de controlo negativo, colocando compressas não utilizadas adicionais diretamente em tubos de transporte no momento da amostragem. No laboratório, executar todas as etapas de pré-amplificação em uma capa esterilizado contendo suprimentos única descontaminadas e usando apenas a nota molecular, reagentes isentos de ADN. Durante a extração de ácido nucleico, evitar a contaminação cruzada, usando novas pinças esterilizadas e luvas frescas com cada amostra, e mantendo todos os tubos fechados a menos em uso. Processamento swabs não utilizados em paralelo garante a esterilidade tanto da coleta de amostras e extração de ácido nucleico; os cotonetes não utilizados não devem produzir um pelete após precipitação isopropanol e lavagem de etanol. Se um pellet for exibido, execute a amplificação do gene 16S rRNA para determinar uma possível fonte dea contaminação (por exemplo, a presença de Streptococcus ou Staphylococcus iria indicar a contaminação da pele). Além disso, efectuar as amplificações de PCR de controlo sem reacções modelo em paralelo para assegurar que os reagentes e as reacções de PCR não ter sido contaminadas. Se aparecer uma faixa em um controle nenhum modelo, descarte os reagentes e repetir a amplificação com reagentes frescos. Tomando essas precauções irá garantir sequenciamento sucesso das bactérias de interesse.

O passo de amplificação por PCR tende a necessitar de mais solução de problemas. Amplificando em conjuntos de doze exemplos proporciona um equilíbrio entre eficiência e consistência. A completa ausência de bandas em todas as amostras de um dado conjunto de amplificação indica uma falha sistemática, por exemplo, esquecendo-se adicionar um reagente ou incorrectamente programação do termociclador. A ausência de uma banda de algumas amostras é geralmente devido a erro humano, e as amplificações deve ser re-run com o mesmo emparelhamento de amostra e iniciador inverso. No caso da ausência de uma banda contínua, a amostra pode ser re-amplificada utilizando um iniciador reverso com um código de barras diferente. falhas repetidos de amplificação com múltiplos iniciadores inversos podem indicar um inibidor presente na amostra. Nesse caso, a limpeza do ADN com uma coluna, muitas vezes, remover inibidores sem alterar significativamente as abundâncias relativas bacterianas. Se várias bandas resultar após a amplificação, re-amplificar a amostra com um código de barras iniciador inverso diferente.

Além de evitar a contaminação do ambiente e assegurar a amplificação de um único produto específico, a sequenciação de sucesso depende de cuidado quando se prepara a biblioteca piscina. O objectivo é combinar quantidades equimolares de fragmentos amplificados de cada amostra para assegurar aproximadamente o mesmo número de sequenciação leituras por amostra. Se as concentrações de ácido nucleico antes da amplificação são comparáveis, a simples adição de volumes iguais de cada saamplicons de mple é suficiente ao criar o pool de biblioteca. No entanto, se as concentrações de ácido nucleico são muito diferentes e adicionado em volume igual, a amostra com a baixa concentração de ácido nucleico irá estar mal representados com um número baixo de leituras. Nesta caso, é possível adicionar um volume maior de produtos de amplificação a partir da baixa concentração de amostra com base na intensidade relativa de a banda de gel. Em alternativa, é possível remover mais rigorosamente iniciadores a partir dos fragmentos amplificados individuais, quantificar a concentração amplicão de amostra individual, utilizando um kit de ADNcd quantificação fluorométrico, e precisamente combinam-se quantidades equimolares de cada amostra.

Uma vez que uma piscina amplicon bem equilibrada é gerado, ele torna-se crítica para medir cuidadosamente a concentração da piscina. diluição cuidadosa subseqüente e spike-in com phix para aumentar a complexidade de leitura é fundamental para alcançar os melhores resultados de sequenciamento. sequenciadores de alto rendimento que usam sequencing por síntese são muito sensíveis à densidade do aglomerado na célula de fluxo. Carregando uma piscina biblioteca que é muito concentrada resultará em Overclustering, com menor pontuação de qualidade, saída de dados mais baixa, e demultiplexing imprecisa 32. Carregando um pool da biblioteca que é demasiado diluída também vai resultar na saída de dados de baixo. Cuidadosamente quantificar a piscina biblioteca antes da sequenciação irá garantir os melhores resultados.

Seqüência do gene 16rRNA fornece uma avaliação abrangente das bactérias presentes dentro de uma dada amostra e é um primeiro passo absolutamente crítico na geração de hipóteses. A presença de um rico conjunto de metadados ainda permite que o pesquisador para testar associações entre espécies bacterianas específicas e fatores biológicos importantes. Além disso, a mesma informação 16S pode ser usada para inferir as funções bacterianas utilizando com ferramentas tais como PICRUSt 33. O objetivo final é usar 16S caracterização para identificar novos associações que podem serainda mais testado e validado em sistemas modelo, acrescentando à nossa crescente compreensão do impacto do microbioma bacteriana sobre a saúde humana e doenças.

Acknowledgements

Nós gostaríamos de agradecer a Elizabeth Byrne, David Gootenberg, e Christina Gosmann para feedback crítico sobre o protocolo; Megan Baldridge, Scott Handley, Cindy Monaco, e Jason Norman para orientação preparação de amostras e demonstrações; Wendy Garrett, Curtis Huttenhower, Skip Virgin, e Bruce Walker para o conselho de protocolo e discussões frutíferas; e Jessica Hoisington-Lopez para seqüenciamento apoio. Este trabalho foi financiado pela Fundação Bill e Melinda Gates e o NIAID (1R01AI111918). DSK recebeu apoio adicional do Fundo Burroughs Wellcome. MNA foi apoiado pelo número prêmio T32GM007753 do NIGMS, eo Paul e Daisy Soros Fellowship. O conteúdo é da exclusiva responsabilidade dos autores e não representam necessariamente as opiniões oficiais da NIGMS ou do NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics