Одноклеточная РНК-Seq определенных подмножеств клеток сетчатки ганглия

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы представляем комбинаторный подход для классификации типов нейронных клеток до выделения и для последующей характеристики одноклеточных транскриптомов. Этот протокол оптимизирует подготовку образцов для успешного секвенирования РНК (РНК-Seq) и описывает методологию, разработанную специально для углубленного понимания клеточного разнообразия.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Открытие маркеров, специфичных для типа клеток, может дать представление о клеточной функции и происхождении клеточной гетерогенности. С недавним толчком для лучшего понимания нейронного разнообразия важно идентифицировать гены, экспрессия которых определяет различные субпопуляции клеток. Сетчатка служит отличной моделью для исследования разницы в центральной нервной системе, так как она состоит из нескольких основных типов клеток. Изучение каждого крупного класса клеток дало генетические маркеры, которые облегчают идентификацию этих популяций. Однако в каждом из этих основных классов клеток сетчатки существуют многочисленные подтипы клеток, и лишь немногие из этих подтипов имеют известные генетические маркеры, хотя многие из них характеризуются морфологией или функцией. Знание генетических маркеров для индивидуальных подтипов сетчатки позволило бы изучать и отображать мозговые мишени, связанные со специфическими визуальными функциями, и также может давать представление о генных сетях, которыеПоддерживать клеточное разнообразие. Существующие способы идентификации генетических маркеров подтипов имеют недостатки, такие как классификация типов клеток после секвенирования. Это создает проблему для анализа данных и требует строгих методов проверки, чтобы гарантировать, что кластеры содержат ячейки одной и той же функции. Мы предлагаем метод идентификации морфологии и функциональности клетки до выделения и секвенирования, что позволит более легко идентифицировать маркеры, специфичные для подтипов. Этот метод может быть распространен на не-нейронные типы клеток, а также на редкие популяции клеток с незначительными вариациями. Этот протокол обеспечивает отличное качество данных, так как многие библиотеки обеспечивают глубину чтения более 20 миллионов считываний для отдельных ячеек. Эта методология преодолевает многие из препятствий, представленных одноячеечной РНК-Seq, и может быть подходящей для исследователей, стремящихся к профилированию типов клеток простым и высокоэффективным способом.

Introduction

Разнообразие нейронов наблюдается во всей центральной нервной системе, особенно в сетчатке позвоночных, высокоспециализированной ткани, состоящей из 1 глиального и 6 типов нейронов, которые возникают из одной популяции клеток-предшественников сетчатки 1 , 2 , 3 . Многие подтипы клеток могут быть классифицированы функционально, морфологически и генетически. Цель этого протокола - связать генетическую изменчивость типов клеток с их идентифицируемыми функциональными и / или морфологическими характеристиками. Для классификации клеток было идентифицировано несколько генов, но многие подтипы продолжают оставаться нехарактеризованными, так как они представляют небольшую часть общей популяции. Идентификация генов в этих специфических подтипах позволит лучше понять разнообразие нейронов в сетчатке и может также пролить свет на диверсификацию нервных клеток в других местах. марихуанаБолее того, одноклеточные исследования позволяют выявлять новые типы клеток, которые, возможно, были упущены из-за их низкой представленности среди всего населения 4 , 5 , 6 , 7 .

Одно из преимуществ одноклеточной транскриптомии заключается в том, что можно обнаружить уникальные маркеры или комбинации маркеров, которые определяют конкретный клеточный подтип. Затем они могут быть использованы для получения генетического доступа к этому типу клеток для различных манипуляций. Например, мы используем этот протокол, чтобы охарактеризовать гены определенного типа клеток подмножества клеток сетчатки ганглия, которые экспрессируют фотопигмент меланопсин. Использование флуоресцентного маркера в меланопсин-экспрессирующих ганглиозных клетках сетчатки позволяет исследовать эти клетки, поскольку они сгруппированы вместе из-за их экспрессии известного гена. Интересно, что существует пять известных подтипов этой ячейки popuВ сетчатке мыши 8 . Таким образом, для выделения РНК из клеток каждого типа мы использовали установленные морфологические классификации в трансгенной модели для идентификации каждого подтипа до выделения клеток. Этот метод позволяет характеризовать клетки, а также их выделение непосредственно из сетчатки, без необходимости диссоциации тканей, что может вызвать стресс-реакцию внутри клеток и загрязнение из-за разъединенных дендритов 9 .

За последние несколько лет появилось множество новых методов, поскольку метод РНК-Seq продолжает развиваться. Эти инструменты позволяют добиться максимальной мобильности клеток и большей эффективности затрат при приближении к вопросу 4 , 7 , 10 , 11 , 12 , 13 . Однако, хотяЭти методы были отличными ступенями, существует ряд препятствий, которые все еще встречаются, с которыми этот протокол способен справиться. Во-первых, многие из нынешних процедур изолируют клетки от диссоциированной ткани и пытаются использовать либо основной компонентный анализ, либо иерархическую кластеризацию post-hoc для определения классификации клеток. Опираясь на эти инструменты для классификации подтипов, может не дать надежных результатов и может заставить искать новые способы проверки этих данных для корреляции генетического маркера с функциональным типом клетки. Требование диссоциации в других протоколах может иногда приводить к повреждению тканей и может приводить к отделению нейрональных процессов, что приводит к потенциальной потере мРНК. Кроме того, в диссоциированных клеточных препаратах стрессовые реакции могут начинать влиять на транскриптомы этих клеток 14 . Этот протокол преодолевает эти трудности, определяя тип функциональных клеток до изоляции, и он лучше поддерживает hЗа счет сохранения целостности ткани сетчатки.

Один метод был введен в 2014 году и состоял из анализа in vivo транскриптома живых клеток 15 . Хотя этот метод позволяет исследовать транскриптом с минимальным механическим разрушением ткани, ему не хватает способности классифицировать определенные типы клеток в ткани до исследования их транскриптомов без использования очень специфической мыши-репортера. Наш протокол не требует специального репортера, так как мы используем заполнение клеток и электрофизиологию для характеристики клеток перед их изоляцией. Другим ограничением этого предыдущего протокола является то, что он требует определенной длины волны для возбуждения фотоактивируемого элемента, тогда как наш протокол позволяет использовать флуоресцентный репортер и флуоресцентный краситель, которые легко доступны или могут быть выбраны каждой лабораторией индивидуально. Тем не менее, другие лаборатории вышли замуж заOphysiology и transcriptomics для изучения клеточного разнообразия. Использование патч-зажимных записей для характеристики функции клетки до ее изоляции было выполнено на диссоциированных нейронах 16, а в некоторых случаях предшествовало использование анализа микрочипов 17 для этих исследований. Этими подходами сталкиваются те же самые осложнения, поскольку они требуют диссоциации тканей или использования технологии микрочипов, которая основана на гибридизации образцов с доступными зондами. Одним из последних достижений является разработка Patch-Seq, метода, который сочетает использование патч-зажимных записей и технологию RNA-Seq для понимания клеток из цельных мозговых срезов 18 . Хотя этот метод имеет сходство с протоколом, представленным здесь, снова важно отметить, что наш подход позволяет ткани оставаться неповрежденным для здоровья клеток. Здесь мы представляем протокол для optimizatКоторый создает высококачественные одноячеечные библиотеки для использования РНК-Seq для получения высокой глубины считывания и покрытия карт.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры были одобрены Институциональным комитетом по уходу за животными и их использованием (IACUC) в Северо-западном университете.

1. Подготовка растворов для электрофизиологии (4 ч)

  1. Сделайте 0,1% DEPC-обработанной H 2 O добавлением 1 мл диэтилпирокарбоната (DEPC) к 999 мл очищенного обратным осмосом H 2 O. Тщательно перемешайте и дайте смеси инкубировать в течение 1 часа при комнатной температуре (RT). Затем автоклавируют DEPC-смешанную H 2 O в течение 15 мин в жидком цикле. Дайте обработанному DEPC H 2 O охладиться при комнатной температуре.
  2. Сделайте внеклеточный раствор, смешав одну бутылку среды Эймса и 1,9 г (23 мМ) бикарбоната натрия в 1 л H 2 O. Пузырьком внеклеточный раствор с
    95% O 2 /5% CO 2 и поддерживать его при рН 7,3-7,4.
  3. Сформируйте внутриклеточный раствор, объединив 125 мМ K-глюконат, 2 мМ MgCl 2 , 10 мМ EGTA, 10 мМ HEPES и 0,1% DEPC-обработанный H2 О. Хранить в 1 мл аликвоты при -20 ° C. Добавьте 10 мкМ флуоресцентного индикатора в начале каждого эксперимента.
  4. Сделать раствор фермента, добавив 10000 единиц коллагеназы и 83 мг гиалуронидазы до 4,15 мл внеклеточного раствора. Раствор фермента следует хранить в 50 мкл аликвотах при -20 ° C.

2. Приготовление сетчатой ​​ткани (2 ч)

ПРИМЕЧАНИЕ. Все процедуры в этом разделе должны выполняться при тусклом освещении

  1. Адаптированные к темноте животные в течение, по крайней мере, 1 часа до вскрытия. Выполняйте все процедуры при тусклом освещении.
  2. Усыпите животных за счет угасания СО 2 и заклейте глазные яблоки в чашку Петри с предварительно обогащенным кислородом внеклеточным раствором.
  3. Проткните роговицу иглой и обрежьте ее, разрезая офтальмологическими ножницами на границе роговицы и склеры. 19 .
  4. Удалите объектив, используя# 5 щипцы. Аккуратно сделайте разрыв в склере с помощью щипцов и разъедините зрительный нерв, где встречаются сетчатка и склера. Тщательно закончите удаление склеры с сетчатки.
  5. Удалите прозрачную стекловидную камеру с помощью щипцов № 5; После удаления стекловидное тело появляется в виде студенистого вещества, прилипшего к щипцам. Разделите сетчатки пополам (так, чтобы было 4 части / животное) и сохраните их в насыщенном кислородом внеклеточном растворе при комнатной температуре до использования.
  6. Когда будете готовы к установке ткани в записывающей камере, поместите кусочек сетчатки для инкубации в растворе фермента, разведенном в 500 мкл насыщенного кислородом внеклеточного раствора. Инкубируйте в чашке Петри в течение 2 минут при комнатной температуре на шейкере.
    1. Вымойте кусочек сетчатки в насыщенном кислородом внеклеточном растворе и поместите ткань в камеру для записи со стеклянным дном; Используйте пластиковую пипетку для переноски с отрезанным наконечником, чтобы можно было переносить сетчатку без повреждения ткани.
  7. Использовать дляБелые грибы тщательно размять ткань слоем фоторецептора вниз. Удалите лишнюю жидкость с помощью пипетки. Закрепите ткань с помощью платинового кольца с нейлоновой сеткой.
    ПРИМЕЧАНИЕ. Этот метод можно также использовать для получения ткани для выделения РНК из меченых амакриновых и биполярных клеток.
  8. Заполните камеру насыщенным кислородом внеклеточным раствором и установите его на подставку для микроскопа. Перфуза ткань с насыщенным кислородом внеклеточного раствора при 2-4 мл / мин.

3. Визуализация и нацеливание клеток GFP + сетчатки ганглия (10 мин)

ПРИМЕЧАНИЕ. Все процедуры в этом разделе должны выполняться при тусклом освещении

  1. Перед началом вытащите стеклянные микропипетки (OD: 1,2 мм, ID: 0,69 мм) для электрофизиологических записей с помощью съемника микропипетки. Используйте следующий протокол для электродов (обратите внимание, что параметры должны быть соответственно отрегулированы для достижения желаемого сопротивления и будутВарьируются между съемниками и с различным стеклом): Heat: Ramp +10; Pull: 0; Vel: 23; Задержка: 1; Давление: 500; Программный цикл: 5 раз. Убедитесь, что наконечники диаметром ~ 1 мкм, с сопротивлением 2-4 MОм для ориентации больших ячеек и 5-7 МОм для ориентации меньших ячеек.
  2. Наблюдайте за слоем ганглиозной ячейки с помощью инфракрасной дифференциальной контрастной интерференционной контрастности (IR-DIC) ( рис. 1A ). Определите GFP + клетки сетчатки сетчатки (RGCs), используя эпифлуоресценцию (~ 480 нм) ( Рисунок 1B ).
  3. Найдите пипетку, заполненную внутриклеточным раствором в DIC. Приложите небольшое положительное давление и обнулите любые смещения напряжения на усилителе.
  4. Надавите стеклянную микропипетку на ячейку GFP + и нанесите отрицательное давление, чтобы сформировать уплотнение GΩ между пипеткой и клеточной мембраной. Примените шаги команды испытательного напряжения ( например, 5 мВ), чтобы контролировать сопротивление уплотнения. После формирования устойчивого уплотнения разрывайте мембрану, применяя кратковременные импульсы nЧтобы получить доступ к целым клеткам.
  5. Подождите 1-2 мин, чтобы дендриты клетки заполнились флуоресцентным индикатором.
    ПРИМЕЧАНИЕ. Клетку можно морфологически набрать, изучив морфологию эпифлуоресценции ( рис. 1С ). В случае РГК, экспрессирующих меланопсин, дендритная стратификация во внутреннем плексиформном слое визуализируется путем исследования дендритов, заполненных флуоресцентным индикатором при эпифлуоресцентном освещении, и определения того, насколько они стратифицируются вдали от сомы в ОТС-субламинах (M1 ipRGCs), вблизи ганглия Клеточного слоя в субшаминах ON (M2 и M4 ipRGCs) или обоих (M3 ipRGCs). Это наблюдение в сочетании с размером сомы (M4s имеют отчетливо большие сомы по сравнению со всеми другими подтипами ipRGC), позволяют идентифицировать тип клеток 20 , 21 , 22 . Таким образом, эта методика позволяет идентифицировать тип клеток in vitro перед изоамином РНКляционной. Этот метод может быть модифицирован для других протоколов идентификации типа клеток, включающих либо дендритную морфологию, либо клеточную физиологию.

4. Выделение клеток (2 мин)

  1. Перед началом установите настольную микроцентрифугу на 2000 г. Подготовьте аппарат для вытаскивания образца, подсоединив трубку (OD: 3/32 дюйма, ID: 1/32 дюйма) шприцем 1 см3.
  2. Поместите 0,2 мл пробирки для ПЦР, содержащие 10 мкл буфера для лизиса и 1% β-меркаптоэтанола на льду. Подготовьте 1 см3 шприц, содержащий DEPC-обработанный H 2 O, для ополаскивания наконечников пипеток. Подготовьте контейнер с сухим льдом для замораживания лизисного буфера после взятия пробы.
  3. Тщательно извлекайте содержание цитоплазмы в пипетке клеток, применяя отрицательное давление, используя шприц 10 мл; Все цитоплазматическое содержимое, включая органеллы, должно быть извлечено, если возможно.
    1. Контролируйте извлечение в DIC, визуализируя тело клетки, уменьшающееся в размере. После извлечения Содержимое цитоплазмы аккуратно вынимают пипетку из ткани и быстро удаляют пипетку из раствора.
  4. Быстро вытащите пипетку из держателя для головы и быстро промойте наконечник пипетки обработанным DEPC H 2 O, используя шприц 1 мл. Подключите пипетку к шприцу объемом 1 мл через герметичную трубку, чтобы удалить образец.
  5. Немедленно удалите клетки в 10 мкл буфера для лизиса 1, содержащего 1% β-меркаптоэтанола в 0,2 мл пробирках для ПЦР.
    ПРИМЕЧАНИЕ. Весь аспират с клетками следует осторожно удалять, чтобы не вводить пузырьки.
    1. Кратко центрифугируют пробирку в настольной мини-центрифуге при 2000 xg в течение 10 с. Немедленно замораживать образцы в течение 5 мин на сухом льду. После замораживания храните их при -80 ° C в течение двух недель для достижения наилучших результатов; Образцы могут длиться дольше, но рекомендуется, чтобы они обрабатывались как можно быстрее.
E "> 5. Очистка РНК (30 мин)

  1. Прежде чем начать, установите магнитное сепараторное устройство, прикрепив верхнюю часть перевернутого держателя наконечника P20 или P200 к 96-луночному магнитному стенду 23 .
  2. Подготовьте свежий 70% этанол (EtOH) - приблизительно 1 мл на образец будет достаточным. Удалите магнитные шарики РНК из хранилища 4 ° C и оттаивайте их при комнатной температуре в течение как минимум 30 минут.
    ПРИМЕЧАНИЕ. Одновременно должно обрабатываться не более 8 образцов, так как многие шаги в этом протоколе зависят от эффективности и быстрой обработки.
  3. Когда магнитные шарики находятся при комнатной температуре, встряхивают в течение 30 секунд, чтобы раствор хорошо перемешивался.
    ПРИМЕЧАНИЕ. Бусины используют специфичный для РНК буфер для избирательного связывания РНК и позволяют удалять другие клеточные отходы при использовании с подставкой для магнитных пластин.
  4. Оттаивают клетки при комнатной температуре в течение 1 мин, а затем добавляют к каждому образцу 5 мкл Н 2 О без РНКазы; Пипеткой вверх и вниз. Добавьте 22 мкл РНК-гранул в каждую пробирку и пипеттE тщательно перемешать. Инкубируйте образцы при комнатной температуре в течение 5 мин, чтобы позволить РНК взаимодействовать и связываться с магнитными шариками.
  5. Поместите трубки на магнитный сепаратор и дайте им посидеть 8 минут; Перед тем как продолжить, убедитесь, что надосадочная жидкость чиста. Наблюдайте за шариками из одной гранулы и убедитесь, что не отсоединяете ее во время пипетирования.
  6. Удалите супернатант из образцов и добавьте 150 мкл 70% EtOH. Удалите EtOH и повторите промывку еще два раза.
  7. Дайте пробам высохнуть на воздухе в течение 6 мин. Периодически проверяйте, не собирается ли больше EtOH на дне пробирки. Удалите его соответствующим образом.
  8. Пока образцы сушат, готовят 10X реакционный буфер, объединяя 19 мкл буфера для лизиса 2 и 1 мкл ингибитора РНКазы (40 Ед / мкл). Кратко поверните его и держите на льду.
  9. После того как образцы сухие и гранулы шариков больше не выглядят глянцевыми, удалите пробирки из магнитного сепаратора и добавьте 9,5 мкл H 2 O, не содержащего РНКазыДля регидратации образцов. Поместите пробы на лед и добавьте 1 мкл 10-кратного реакционного буфера к каждому образцу.

6. Обратная транскрипция (10 мин)

ПРИМЕЧАНИЕ. Перед началом оттаивания необходимо использовать необходимые реагенты для обратной транскрипции (RT, за исключением фермента) на льду. К ним относятся: праймер II, буфер 1, олигонуклеотид и ингибитор РНКазы.

  1. В каждую пробирку добавить 2 мкл праймера II (AAGCAGTGGTATCAACGCAGAGTACT (30) N- 1 N, для которого N- 1 может быть A, C или G и N может быть A, C, G или T; 12 мкМ). Поместите пробирки в термоциклер, который был предварительно нагрет до 72 ° С в течение 3 мин.
  2. Во время инкубации подготовьте RT-мастер-микс. Для каждой реакции добавляют 4 мкл буфера 1 (250 мМ Трис-HCl, pH 8,3, 375 мМ KCl и 30 мМ MgCl 2 ), 1 мкл олигонуклеотида (48 мкМ) и 0,5 мкл ингибитора РНКазы (40 ед / мкл).
  3. Сразу же после инкубации установите трубки наЛед в течение 2 мин.
  4. Добавьте 2 мкл на каждую реакцию обратной транскриптазы (100 ЕД / мкл) в основную смесь и пипетку тщательно. Добавить 7,5 мкл мастер-смеси в каждую пробирку и перемешать путем осторожного пипетирования. Кратко прокрутите пробирки, чтобы собрать содержимое на дне и поместите их в предварительно нагретый термоциклер со следующей программой: 42 ° C в течение 90 минут, 70 ° C в течение 10 минут и трюм при 4 ° C.
  5. Перед тем, как продолжить, храните пробирки при температуре -20 ° СO / N, хотя рекомендуется хранить образцы на этапе амплификации перед хранением в течение длительных периодов времени; Другие источники предполагают, что хранение на складе при 4 ° С также будет приемлемым на этом этапе 24 .

7. Амплификация кДНК (2,5 ч)

ПРИМЕЧАНИЕ. Перед началом разморозки ПЦР-буфера и ПЦР-праймера на льду и откручивания пробирок на мини-центрифуге перед тем, как сделать основную смесь ПЦР.

  1. Для каждой реакции pПовторить основную смесь ПЦР, содержащую 25 мкл ПЦР-буфера, 1 мкл ПЦР-праймера (12 мкМ), 1 мкл ДНК-полимеразы и 3 мкл Н 2 О без нуклеазы. Добавить ДНК-полимеразу последним, непосредственно перед добавлением Мастер-микса к образцам.
  2. Добавить 30 мкл мастер-микса в каждую пробирку и вращать при 2000 х g в течение 10 с для сбора содержимого в нижней части пробирок.
  3. Поместите трубки в предварительно нагретый термоциклер со следующей программой: 95 ° C в течение 1 минуты; 34 цикла при 98 ° С в течение 10 с, 65 ° С в течение 30 с и 68 ° С в течение 3 мин; 72 ° С в течение 10 мин; И трюм при 4 ° C.
    ПРИМЕЧАНИЕ. Число циклов для этой PCR было увеличено до 34, что отличается от инструкций, предложенных изготовителем. После повторного тестирования было обнаружено, что этот номер цикла дает стабильно надежные результаты.
  4. Перед продолжением храните пробирки при температуре -20 ° C в течение года.

8. Очистка амплифицированного cDNA (30 мин)

  1. Перед началом очистки доведите гранулы ДНК и элюирующий буфер до комнатной температуры в течение по крайней мере 30 мин. Подготовьте свежий 80% EtOH; 1 мл на образец должно быть достаточным. Добавьте 1 мкл буфера для лизиса 10Х к каждому образцу.
  2. Вихревой ДНК гранулы в течение 30 с и добавить 50 мкл ДНК-гранул для каждого образца. Тщательно перемешать с помощью пипетки, а затем кратко открутить их до 2000 xg в течение 10 с. Инкубируйте пробирки при комнатной температуре в течение 8 мин.
  3. Поместите трубки на магнитное разделительное устройство на 5 мин. Осторожно пипеткой супернатант вверх и вниз дважды и позволяют образцы сидеть в течение 2 мин. Пока образцы находятся на магнитном устройстве, удалите супернатант и выбросите.
  4. Добавьте к каждому образцу 150 мкл свежеприготовленного 80% EtOH и дайте им посидеть при комнатной температуре в течение 30 секунд. Удалите EtOH и повторите промывку EtOH один раз.
  5. Кратко открутите образцы и поместите их обратно на магнитный сепаратор на 1 мин. Удалите оставшийся EtOH и дайте пробы высохнуть на воздухе в течение 5 мин.
  6. После того, как шарик гранул больше не выглядит глянцевым, но до появления трещин, снимите трубку с магнитного сепаратора и добавьте 17 мкл буфера для элюции. Мягко пипеткой вверх и вниз, чтобы ресуспендировать бисер полностью.
  7. Инкубируйте ресуспендированные образцы при комнатной температуре в течение 2 мин.
  8. Кратко поверните образцы, чтобы собрать всю жидкость на дне и поместите их на магнитный сепаратор на 2 мин. Перенесите 15 мкл прозрачного супернатанта в 1,5 мл пробирку без РНКазы и сохраните ее при -20 ° C.
  9. Изучите качество и размер библиотеки кДНК с помощью высокочувствительного чипа биоанализатора, используя 1 мкл кДНК. Идеальный размер библиотеки кДНК составляет 0,3-2 КБ, с концентрацией не менее 10 нг / мкл ( фиг. 2 ).
    ПРИМЕЧАНИЕ. Вы можете использовать PCR в качестве способа отбора проб для обеспечения выражения известных маркеров, прежде чем приступать к тестированию preparation.

9. Определить концентрации и кДНК-метки (20 мин)

  1. Перед началом доведите аналитический реагент, буфер разбавления и стандарты до комнатной температуры в течение 30 мин. Подготовьте мастер-микс, содержащий 1 мкл реагента для анализа и 199 мкл буфера для разбавления на реакцию. Алиготе 199 мкл этой смеси в 500 мкл пробирки для анализа. Добавьте 1 мкл образца и тщательно перемешайте.
  2. Алиготе 190 мкл мастер-смеси к пробирке 1 и 2. Добавить 10 мкл стандарта 1 в пробирку 1 и 10 мкл стандарта 2 в пробирку 2. Встряхивать все пробирки и стандартные пробирки в течение 5 с; Инкубировать при комнатной температуре в течение 3 мин.
  3. Определить концентрацию образцов с помощью высокочувствительного флуорометра. Убедитесь, что введено правильное количество образца, выбрав опцию «Рассчитать исходное решение» и выделив «1 мкл». Разбавляют каждый образец в отдельной 1,5-миллилитровой пробирке до конечной концентрации 0,2 нг / мкл в H 2 O без РНКазы.
    ЗАМЕТКА:Принимая во внимание, что инструкции изготовителя предполагают, что следует начинать с 1 нг / мкл общего количества ДНК, мы использовали меньшую начальную сумму и также скорректировали протокол для учета этой поправки.
  4. В новых 0,2 мл пробирках для ПЦР пипеткой 2,5 мкл буфера 2. Добавьте 1,25 мкл кДНК в соответствующую пробирку в общей сложности 250 пг. Наконец, добавьте 1,25 мкл меченой смеси к каждой пробирке и пипеткой, тщательно перемешайте; Транспозаза внутри смеси меченых фрагментов ДНК в короткие нити и отжига адаптеров к любому концу каждой нити, для последующего использования инструментом секвенирования.
    ПРИМЕЧАНИЕ. Объемы, используемые для связывания меток и индексов, составляют часть суммы, предложенной инструкциями изготовителя. Это не только позволяет сохранить реагенты, но также последовательно производит пробы с маркировкой в ​​нашем опыте.
  5. Центрифуга пробирки на столешнице микроцентрифуге в течение 1 мин.
  6. Поместите трубыВ предварительно нагретом термоциклере со следующей программой: 55 ° C в течение 10 минут и удержание при 10 ° C.
    ПРИМЕЧАНИЕ. Длительность этой инкубации составляет 10 мин, в отличие от предложенных 5 мин. От инструкций изготовителя.
  7. Сразу после завершения этой программы удалите пробирки и добавьте по 1.25 мкл нейтрализующего буфера для мечения. Пипетку хорошо перемешать и инкубировать при комнатной температуре в течение 5 мин. Незамедлительно выполните этот шаг, так как транспозаза остается активной до тех пор, пока буфер не нейтрализует фермент и не прекратит реакцию.

10. Индексная связь и очистка (1 час)

ПРИМЕЧАНИЕ: Перед началом, принесите бусы ДНК и буфер ресуспендирования к RT в течение как минимум 30 мин. Определите, какие индексы использовать для каждого из образцов.

ПРИМЕЧАНИЕ. Эти индексы будут прикреплены к соответствующим 5 'и 3' концам фрагментированной ДНК для идентификации образцов после секвенирования. Убедитесь, что нет двухСпаривание одинаково для образцов, которые могут быть секвенированы вместе. Например, если образец 1 будет использовать индексы белый 1 и оранжевый 1, образец 2 должен использовать белый 1 и оранжевый 2 или белый 2 и оранжевый 2, но никогда не ту же комбинацию индексов. Этот набор содержит 4 различных белых и 6 различных оранжевых индексов. Все различные возможные комбинации позволяют объединять до 24 выборок в одной последовательности последовательности. Хотя обычно мы собираем только 10 выборок на полосе, можно было бы также использовать набор, содержащий 24 индекса, что позволило бы при желании объединить 96 выборок в одну полосу секвенирования.

  1. В каждую пробирку добавить 1,25 мкл левого индекса и 1,25 мкл правого индекса для этого конкретного образца. Добавить 3,75 мкл ПЦР-смеси и пипетки хорошо перемешать.
  2. Центрифуга в настольной микроцентрифуге в течение 1 мин.
  3. Поместите пробирки в предварительно нагретый термоциклер со следующей программой: 72 ° C в течение 3 минут; 95 ° С в течение 30 с; 12 циклов по 9576 ° С в течение 10 с, 50 ​​° С в течение 30 с и 72 ° С в течение 1 мин; 72 ° С в течение 5 мин; И трюм при 4 ° C.
    ПРИМЕЧАНИЕ. Первый шаг 95 ° C был изменен с 98 ° C, что было предложено инструкциями изготовителя. Кроме того, детали цикла были скорректированы таким образом, что температуры и длительности времени позволяли оптимальную маркировку наших образцов. Окончательная инкубация при 72 ° C была также добавлена ​​к нашему протоколу и не была включена в инструкции изготовителя.
  4. Кратко вращайте трубы, чтобы собрать содержимое снизу. Вихревой ДНК гранулы в течение 30 с, а затем добавить 30 мкл в каждую пробирку и тщательно перемешать с помощью пипетки.
  5. Инкубируйте образцы при комнатной температуре в течение 5 мин.
  6. Поместите образцы на магнитный сепаратор в течение 2 мин. Внесите супернатант дважды вверх и вниз и инкубируйте образцы в течение 1 мин.
  7. Удалите и выбросьте прозрачный супернатант. Добавить 150 мкл 80% EtOH к каждому образцу и удалить. Повторите промывку EtOH один раз.
  8. Разрешить thЕ образцы для сушки на воздухе в течение 10 мин. Периодически проверяйте, не собрался ли какой-либо EtOH в нижней части пробирок и при необходимости удалите.
  9. Как только трещина начинает появляться в грануле ДНК-шарика, удалите пробу из магнитного сепаратора и добавьте 27,5 мкл буфера для суспендирования суспензии для регидратации осадка. Убедитесь, что таблетка полностью ресуспендирована, а затем инкубируйте при комнатной температуре в течение 2 мин.
    ПРИМЕЧАНИЕ. Громкость, используемая для буфера ресуспендирования, была изменена с учетом меньшего количества исходного материала в нашем протоколе и отличается от предложенного объема в инструкциях производителя.
  10. Поместите трубки на магнитный сепаратор на 2 мин. Передайте 25 мкл прозрачного супернатанта в пробирку без РНКазы и храните при -20 ° C.
    ПРИМЕЧАНИЕ. Не выполняйте инструкции производителя, чтобы завершить нормализацию библиотеки. Образцы успешно готовятся после этого шага и готовятся к секвенированию как есть.
  11. Проанализируйте tАгментация образцов с использованием чипа биоанализатора и 1 мкл каждого образца.
    ПРИМЕЧАНИЕ: анализ мазков будет проводиться как раньше; Однако, кДНК должна теперь обнаруживаться в диапазоне размеров 0,2-1 Кб ( рис. 3 ). Мазки ниже этой точки, вероятно, представляют собой деградацию образцов, в то время как большие мазки указывают на неполную маркировку.

11. Объединение образцов (10 мин)

  1. Получить концентрации образцов мечения с помощью высокочувствительного флюорометра из ранее и определить концентрацию в нМ.
    ПРИМЕЧАНИЕ. Этот расчет может быть рассчитан с использованием инструмента интернет-конверсии и зависит от средней длины фрагмента от трассировки биоанализатора. Чтобы определить среднюю длину фрагмента, наблюдайте трассу для каждого образца в отдельности и определите размер среднего фрагмента ДНК. Это также можно рассчитать при анализе следа биоанализатора, выделив диапазон мазка и исследуяРассчитанная по программе.
  2. Объединяйте образцы таким образом, чтобы в пуле содержалась одинаковая концентрация каждого образца. Не разбавлять образцы; Пул должен быть только разбавленным, как образец с наименьшей концентрацией, и в идеале должен иметь общую концентрацию по меньшей мере 15 нМ.
  3. Храните собранные образцы при -20 ° C перед секвенированием; Предполагается, что образцы подвергаются секвенированию в течение 1 недели после объединения. Выполнение парного конца, 100 bp sequencing с помощью платформы HiSeq.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Типы клеток легко классифицируются после введения красителя

На рисунке 1 показан пример GFP + RGC до и после заполнения флуоресцентными индикаторами. Эта клетка была идентифицирована на основе ее экспрессии GFP в трансгенной линии ( фиг.1А ). Плотное уплотнение было сформировано с тонким наконечником, электродом стянутого стекла на сому этой ячейки. Для того чтобы охарактеризовать подтип, флуоресцентный краситель был введен в сому и позволил заполнить все связанные процессы ( рис. 1В ). Классификация как M4 ipRGC была разрешена путем наблюдения, что эта клетка имеет очень большую сому и что ее процессы заканчиваются внутри ON суббламина внутреннего плексиформного слоя ( рис. 1C ). В качестве иллюстрации различий в стратификации, которая может быть обнаружена в изолированном препарате сетчатки, мы заполнили M1 (OFF-stratifyinG), M3 (bistratified) и M4 (ON-stratifying) ipRGCs с флюоресцентным индикатором, фиксировали их и проводили конфокальную визуализацию сублуминалей ON и OFF ( рисунок 1D ). Эта визуализация дендритов посредством конфокальной визуализации очень похожа на то, как дендриты выглядят в незафиксированной ткани in vitro, когда клетки заполнены флуоресцентным индикатором (Schmidt and Kofuji 2009, 2010, and 2011).

Библиотеки кДНК из отдельных клеток

Использование Oligo d (T) праймера позволяет селективную обратную транскрипцию и амплификацию мРНК. После генерирования и амплификации библиотек кДНК из каждой ячейки, биоанализаторы использовали для оценки качества и размера библиотек. Результаты этого анализа показывают, что идеальные образцы кДНК составляют 0,5-2 КБ в хорошем образце ( рисунок 2А ). Некоторые образцы показывают несколько полос или мазков ниже отметки 300 пар оснований,Что эти библиотеки имеют низкое качество (см. Таблицу 1 для устранения неполадок). Пример трассировки биоанализатора хорошего качества показывает, что полосы ДНК ниже 300 б.п. или нет, а прочный мазок между 500 п.н. и 2 Кб (рис. 2Б). Пустые полосы контроля должны отображать нижний и верхний маркеры на 35 и 10380 пар оснований соответственно, а также устойчивую базовую линию, которая не колеблется. Различные библиотеки могут выдавать качественные данные, что видно на рисунке 2В и , что обеспечивает отличную глубину считывания и высокую скорость отображения. Только те образцы с сильными библиотеками кДНК ожидаемого размера должны быть перенесены в метку (см. Таблицу 1 для поиска и устранения неисправностей).

Метка с низким уровнем ввода готовит высококачественные образцы для секвенирования

Этот протокол оптимизирован для мечения незначительным количеством исходной материи л. Всего 250 пг лучше всего работает для успешной маркировки, так как меньшие суммы не будут усиливаться должным образом, а более высокие суммы не будут полностью фрагментироваться. После завершения амплификации и ПЦР-амплификации / очистки образца образцы снова анализировали на чипе биоанализатора. Идеальный мазок кДНК в этот момент должен составлять 0,2-1 Кб ( фиг. 3А ). Трасса должна казаться гладкой и равномерно распределенной между этими двумя размерами ( рисунок 3B ); Эта трасса соответствует образцу в дорожке 1. На рисунке 3C показана неполная маркировка, которая может быть легко разрешена (см. Таблицу 1 для устранения неполадок). Мы провели анализ данных на образцах и обнаружили, что этот протокол дает образцы с отличной глубиной считывания, часто превосходя 12 миллионов считываний на образец; В среднем составляет 69,1%; И более 5000 экспрессируемых генов.

/55229fig1.jpg "/>
Рисунок 1: Идентификация типов RGCs на основе GFP экспрессии в меланопсин-экспрессирующих ipRGCs и морфологических свойствах. ( A ) Слой ганглиозных клеток сетчатки, визуализированный с использованием ИК-DIC в препарате для всей сетчатки сетчатки. ( B ) Тот же препарат визуализируется в эпифлуоресценции (~ 480 нм) для идентификации GFP-экспрессирующих ганглиозных клеток. ( C ) GFP-экспрессирующая клетка, предназначенная для регистрации патч-струбцины и заполненная флуоресцентным индикатором. Ячейка может быть идентифицирована как M4 ipRGC на основе ее очень большого размера сомы и ON стратифицирующих дендритов 25 , 26 . ( D ) Конфокальное изображение дендритов ipRGC, отображаемых в субнаминах ON и / или OFF IPL (M1), в субшаминах ON IPL (M4) и в обеих субламинах ON и OFF IPL (M3). IR-DIC: инфракрасный дифференциальный интерференционный контраст..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Анализ качества библиотеки кДНК с помощью трассировки биоанализатора. ( A) Пример вывода биоанализатора для нескольких образцов, которые были обрат- но транскрибированы, амплифицированы и очищены. На дорожках 1-3 показаны идеальные мазки ДНК, при этом большая часть ДНК больше 300 п.н. Библиотеки с мазками в этом диапазоне последовательно предоставляли превосходные данные секвенирования, демонстрируя в среднем 5 683 гена, выраженные в каждой клетке. Дорожка 4 представляет собой образец, который был безуспешно обработан и, таким образом, не продуцировал кДНК. Успешная контрольная полоса имеет постоянную базовую линию и два чистых пика на 35 и 10380 б.п. ( B ) Пример успешного следа биоанализатора с высокой интенсивностью кДНК около 2 Kb. Это Mear соответствует образцу в дорожке 1. ( C ) Пример успешного следа биоанализатора с кДНК с центром около 500 пар оснований. Эта трасса соответствует образцу в полосе 3. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Приведенные примеры показывают прочные мазки между 0.2 и 2 КБ. ( A ) Типичный пример выхода биоанализатора после мечения, амплификации и очистки ПЦР. ( B ) Трассировка успешно помеченного образца, соответствующего дорожке 1 в (A). ( C ) Пример трассы для образца с неполной маркировкой, очищаемый пиковой интенсивностью около 1 Kb."> Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

2 "> Разбавьте пробу до концентрации 0,4 нг / мкл и отметьте повторную отметку
проблема Возможная причина Решение
Шаг 3.3) Не удается сформировать уплотнение GΩ Поверхность ячейки недостаточно чистая Дальнейшее очищение с использованием положительного давления
Шаг 3.3). Ячейка, кажется, сдувается / умирает Подготовьте новую пипетку и намеривайтесь на новую клетку
Шаг 3.4) Не удается определить расположение терминалов дендритов У Alexafluor не было достаточного количества времени для диффузии по всей клетке, или концентрация Alexafluor недостаточно высока Убедитесь, что коэффициент усиления и экспозиция на камере достаточно высоки. Подождите еще 5 мин перед визуализацией дендритов. Если дендриты все еще не видны, подготовьте раствор с более высоким Alexafluorконцентрация.
Шаг 4.1) Невозможно аспирировать всю цитоплазму
Шаг 5.5). Супернатант не очищается через 8 минут Осторожно пипетируйте весь раствор дважды, все еще на магнитном сепараторе, и дайте ему еще 5 минут
Стадия 5.5) Гранулы диспергируются во время пипетирования Образец слишком удален от магнита Держите пробирки на магнитном разделительном устройстве во время всех пипетирования. Извлечь раствор и дать гранулам повторно нанести осадок в течение 5 минут
Шаг 5.7) Через 5 минут образцы все еще выглядят блестящими Максимальное количество EtOH не было удалено Продолжайте следить за образцами во время сушки. Каждые 2 мин используйте пипетку P10 и удалите весь EtOH в нижней части пробирки
Шаг 8.9) Гранулы имели трещины перед регидратацией Позвольте образцу восстановитьсяВ течение всего 4 мин, а не 2 (этап 8.10)
Шаг 8.11) Небольшое количество шарика выращивали супернатантом Вытащите весь образец обратно в трубку и поместите на магнитный сепаратор на 1 мин; Мягко впитайте и убедитесь, что избегаете пеллет
Шаг 8.12) Мазки ДНК несовместимы, и масштаб флуоресценции непрерывно изменяется Слишком высокая концентрация ДНК для HS-чипа Проверьте концентрацию образца и разведите его в пределах 1 - 10 нг / мкл. Повторный биоанализатор
Шаг 8.12) Мазок с низкой молекулярной массой Деградация РНК Не забудьте заморозить ячейку сразу после сбора. Отменить эту библиотеку кДНК
Шаг 8.12) Флуктуация базовой линии маркера в контрольной полосе Загрязнение или старый реагент Отбросить маркер ДНК и использовать новую пробирку для биоанализатора
Шаг 8.12) Нет мазка ДНК Невозможность исключить ячейку Потяните новые иглы с немного большим кончиком
Отказ борта РНК Убедитесь, что шарики полностью ресуспендировали перед использованием и позволяли пробам инкубироваться перед помещением на магнитный сепаратор
Шаг 8.12) Слабая ДНК-мазка Недостаточно усиления Используйте больше циклов ПЦР
Шаг 8.12). Мазок ДНК вне диапазона 500 bp-2Kb Мазки ДНК ниже 0,5 и выше 2 Кбайт, вероятно, являются загрязнением. Отменить выборку
Шаг 8.12). Регулярно расположенные шипы на трассе ДНК Загрязнение образца Всегда носите свежие перчатки и делайте новый этанол для полосканий; Советы фильтра должны использоваться в любое время
Шаг 9.3) Не удалось обнаружить концентрацию образца на флуорометре Образцы, находящиеся ниже уровня обнаружения, имеют слишком мало ДНК для мечения и не могут быть использованы
Шаг 10.10). Образцы не сухие после 10 мин. Продолжать удалять избыток EtOH Дайте пробам проветриться дольше, проверяйте каждую минуту
Шаг 10.13) Мазок искажается до 2Kb Неполная фрагментация Повторно разбавить образец до концентрации 0,15 нг / мкл, а не 0,2 нг / мкл; Повторная отметка
Шаг 10.13) Мазок искажен до 200 б.п. Слишком мало ввода ДНК Разбавьте образец меньше, попробуйте концентрацию 0,4 нг / мкл; Повторная отметка
Слишком длинная реакция на тагментацию Сократите время реакции мечения до 8 минут
Шаг 10.13) Слабые мазки Неправильная амплификация ДНК
Стадия 11.2) Максимально достижимая концентрация в пуле ниже 5 нМ Определите, какая (ые) выборка (ы) имеет значительно низкие концентрации и повторную маркировку новым разбавлением

Таблица 1: Решения и рекомендации для потенциальных препятствий в Протоколе. В этой таблице перечислены потенциальные трудности, которые могут возникнуть в этом протоколе, и шаги, с которыми он может столкнуться. В этой таблице перечислены возможные причины многих из этих проблем, а также решения, которые могут помочь решить любые проблемы.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Наш протокол демонстрирует с помощью быстрого и простого в использовании руководства метод подготовки отдельных клеток определенных морфологических классов для высококачественного секвенирования с небольшим ущербом для образца. В настоящей рукописи, собственно фоточувствительные ганглиозные клетки сетчатки морфологически охарактеризованы, выделены и подготовлены к РНК-Seq. Клеточные напряжения могут возникать во время обработки сетчатки; По этой причине мы заменяем каждый кусочек ткани не более чем через 4 часа использования. Мы можем оценить состояние клеток, используя электрофизиологическую установку для записи из этих клеток и контролировать их ответы, что позволяет нам гарантировать, что клетки имеют хорошее здоровье. Наш протокол позволил генерировать успешные библиотеки кДНК из 15 из 23 обработанных образцов, давая показатель успеха 65%. Кроме того, качество наших данных секвенирования было превосходным, так как среднее количество генов, выраженных нашими клетками, варьировало от 2,316 до 10,353, в среднем 5,683Гены, регистрирующиеся с ненулевым значением FPKM. Эти цифры похожи на экспрессию генов, полученную другими исследованиями нейронов 5 , что свидетельствует о хорошем качестве наших данных.

Несмотря на то, что мы успешно использовали этот протокол для этих специфических нейронов, следует отметить, что незначительные поправки к этой методике могут применяться для ряда различных приложений. Используя флуоресцентно-активированный сортировщик клеток (FACS) в рамках отдельной мышиной модели, мы выделили небольшие популяции клеток (1000-25 000), помеченные маркером GFP из центральной нервной системы. РНК из этих популяций выделяли и для начала обратной транскрипции на этапе 6.1 использовали 1 мкл (при уровне или чуть ниже 12 нг / мкл) этой РНК. Единственная корректировка, которая должна быть сделана для протокола после этого шага, происходит на этапе 7.4, и в этот момент можно выбрать меньшее количество циклов PCR. Мы использовали 19 циклов в тех случаях, когда исходная выборка содержала gReater чем 10.000 клеток и находили что это производит доброкачественные библиотеки кДНК. Например, образцы клеток получали из популяции FACSorted, а количество экспрессируемых генов варьировалось от 12 340 до 14 052, в среднем 13 265 генов с ненулевым значением FPKM. Этот метод может быть применен к различным моделям мыши, для которых присутствует флуоресцентный репортер. Благодаря этой поправке исследователи могли потенциально изучить любую клеточную популяцию, для которой имеется флуоресцентная репортерная мышь, расширяя исследования за пределами области нейронного разнообразия.

Вторая корректировка может быть сделана для профильных ячеек на основе функциональности, а не только морфологии. Этот проект основан на трансгенной модели, но этот метод может быть применен к нейронам без известных молекулярных идентификаторов. Например, в настоящее время выявлено более 30 функциональных подтипов ганглиозных клеток сетчатки 27 , очень немногие из которых имеют уникальные маркеры. Как этот методУже полагается на электрофизиологическую установку для заполнения клеток, можно использовать патч-фиксацию, чтобы идентифицировать профиль функционального отклика каждой клетки на основе ее пика. При использовании световых записей с шипами классификация нейронов сетчатки может быть определена до выделения клеток. Этот метод работает на ганглиозных клетках сетчатки, но он может быть расширен для изучения других нейронов сетчатки. Однако следует отметить, что если этот протокол используется для ввода биполярных или амакриновых клеток сетчатки во внутреннем ядерном слое, например, нужно быть осторожным, чтобы обеспечить постоянное положительное давление на наконечнике электрода, чтобы избежать контакта с клетками в качестве Электрод проходит через слой ганглиозных клеток и внутренний плексиформный слой. Для нейронов сетчатки во внутреннем ядерном слое подготовка секций сетчатки до клеточных записей, вероятно, лучше всего работает, чтобы последовательно избежать загрязнения. Каждую клетку выделяли и готовили, как описано здесь, после claШаге выравнивания. Кроме того, мы предлагаем использовать этот протокол для изучения нейронов, но этот метод может быть применен к любому типу клеток, который может быть морфологически охарактеризован или выделен с помощью трансгенной модели.

Этот метод также может быть модифицирован для работы с ранее подготовленными библиотеками кДНК, как мы это делали в прошлом для гибридизации микрочипов 28 . В отдельно подготовленной библиотеке начинается с количества кДНК в диапазоне 50-150 нг и начинается протокол на этапе 8.4; Более высокие и более низкие концентрации не предпринимались, хотя они могут также работать. Сначала должна происходить очистка кДНК с использованием ДНК-гранул, затем следует метилирование и амплификация ПЦР. Мы проверили эту настройку с кДНК из библиотечных препаратов, например, для гибридизации микрочипов 29 , и успешно создали библиотеки заметок для РНК-Seq.

ПлавникЭтот протокол может быть использован для оценки успеха определенной индукции клеточных популяций из индуцированных плюрипотентных стволовых клеток (iPSCs). Движущая сила дифференцировки этих перепрограммированных плюрипотентных клеток основана на понимании факторов транскрипции, которые приводят типы клеток к развитию отдельно друг от друга. Вождение iPSCs в сторону конкретных сущностей клеток является новым методом изучения нейронного разнообразия, поскольку его можно использовать для выборочного генерирования типов клеток. Этот протокол может быть адаптирован для оценки качества разнообразия между дифференцированными клетками из этой модели. Как упоминалось ранее, существует более 30 функциональных подтипов ганглиозных клеток сетчатки, и было сделано много попыток создать функциональные РСК из iPSC. Идентификация маркеров для подтипов RGC - в нашем случае ipRGCs - позволит исследователю оценить успех своего протокола при производстве различных подтипов RGC. Оценка типов клетокСреди этих нейронов выиграют от этого протокола и могут также служить инструментом для дальнейшего исследования маркеров подтипов, поскольку эта модельная система становится легко доступной.

В настоящей рукописи мы описали простой метод для выделения и подготовки отдельных клеток для транскриптомического анализа. Более того, мы предлагаем способы редактирования протокола, чтобы этот метод можно было использовать для множества экспериментов с целым рядом целей. Описанный здесь протокол был адаптирован из протокола, описанного Trombetta et al. 24 в качестве корректировки рекомендованных инструкций набора для низкоуровневой РНК-Seq. Основные различия заключаются в изоляции ячеек и различных объемных изменениях, которые мы выбрали для наилучшего удовлетворения потребностей этого проекта. Важно подчеркнуть, что самым важным шагом в этом протоколе является выделение клеток из ткани сетчатки. Это точка в протоколе durinG, который может вызвать наибольшее количество ошибок, и он должен выполняться с самым тщательным вниманием. Любое количество загрязнений может привести к непригодным образцам, в то время как потеря цитоплазмы может вызвать сильное истощение молекул мРНК. Этот шаг должен выполняться с осторожностью и тем же человеком от эксперимента до эксперимента, чтобы гарантировать, что образцы были обработаны точно.

Таким образом, этот протокол описывает методику классификации, выделения и подготовки клеток для высококачественной РНК-Seq. Это эффективный, относительно недорогой способ оптимизации качества данных из отдельных ячеек. Этот метод является универсальным и может быть минимально изменен для применения в различных исследованиях.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Мы хотели бы выразить благодарность Дженнифер Баир и Эйнату Снир, а также Институту Генетики Университета Айовы за их помощь в подготовке и обработке образцов.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics