En-cell-RNA-Seq av definierade deluppsättningar av retinala Ganglion-celler

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenterar vi ett kombinatoriskt tillvägagångssätt för att klassificera neuronala celltyper före isolering och för efterföljande karaktärisering av enkelcellstransskriptomer. Detta protokoll optimerar beredningen av prover för framgångsrik RNA-sekvensering (RNA-Seq) och beskriver en metod som är utformad speciellt för ökad förståelse av celldiversitet.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Upptäckten av celltypsspecifika markörer kan ge insikt i cellulär funktion och ursprunget till cellulär heterogenitet. Med en nyhetstryck för den förbättrade förståelsen av neuronal mångfald är det viktigt att identifiera gener vars uttryck definierar olika subpopulationer av celler. Näthinnan tjänar som en utmärkt modell för studier av mångfald i centrala nervsystemet, eftersom den består av flera stora celltyper. Studien av varje större klass av celler har givit genetiska markörer som underlättar identifieringen av dessa populationer. Emellertid finns flera subtyper av celler inom var och en av dessa större retinala cellklasser, och få av dessa subtyper har känt genetiska markörer, fastän många har karakteriserats av morfologi eller funktion. Kunskap om genetiska markörer för enskilda retinala subtyper skulle möjliggöra studier och kartläggning av hjärnmål som är relaterade till specifika visuella funktioner och kan också ge insikt i de genenät somUpprätthålla cellulär mångfald. Nuvarande vägar som används för att identifiera de genetiska markörerna för subtyper har nackdelar, såsom klassificeringen av celltyper efter sekvensering. Detta utgör en utmaning för dataanalys och kräver rigorösa valideringsmetoder för att säkerställa att kluster innehåller celler med samma funktion. Vi föreslår en teknik för att identifiera en cells morfologi och funktionalitet före isolering och sekvensering, vilket möjliggör enklare identifiering av subtypsspecifika markörer. Denna teknik kan utvidgas till icke-neuronala celltyper, såväl som till sällsynta populationer av celler med mindre variationer. Detta protokoll ger utmärkta data, eftersom många av biblioteken har gett läsardjup större än 20 miljoner läser för enskilda celler. Denna metod övervinner många av de hinder som presenteras av encells RNA-Seq och kan vara lämpliga för forskare som syftar till att profilera celltyper på ett rakt och mycket effektivt sätt.

Introduction

Neuronal mångfald observeras i hela det centrala nervsystemet, särskilt i ryggradsnätet, en högspecialiserad vävnad bestående av 1 glial och 6 neuronala celltyper som uppstår från en population av retinala stamceller 1 , 2 , 3 . Många subtyper av celler kan klassificeras funktionellt, morfologiskt och genetiskt. Målet med detta protokoll är att binda cellernas typiska variabilitet till deras identifierbara funktionella och / eller morfologiska egenskaper. Ett antal gener har identifierats för klassificering av celler, men många subtyper fortsätter att vara okarakteriserade, eftersom de representerar en liten del av den totala populationen. Identifiering av gener inom dessa specifika subtyper kommer att möjliggöra en större förståelse för neuronal mångfald inom näthinnan och kan också kasta ljuset på diversifieringen av neurala celler på annat håll. FuDessutom möjliggör encellsstudier att upptäcka nya celltyper, vilket kan ha blivit förbisedda på grund av deras låga representation bland den totala populationen 4 , 5 , 6 , 7 .

En av fördelarna med encells transkriptomik är att unika markörer eller kombinationer av markörer som definierar en viss cellulär subtyp kan upptäckas. Dessa kan sedan användas för att få genetisk tillgång till den celltypen för olika manipuleringar. Till exempel använder vi detta protokoll för att karakterisera de celltypspecifika generna av en delmängd av retinala ganglionceller som uttrycker fotopigmentet melanopsin. Användningen av en fluorescerande markör i melanopsin-uttryckande retinala ganglionceller möjliggör studier av dessa celler, eftersom de kluster ihop på grund av deras uttryck av en känd gen. Intressant är det fem kända undertyper av denna cellpopuLation i muskelnätet 8 . För att isolera RNA från celler av varje typ har vi således använt etablerade morfologiska klassificeringar inom den transgena modellen för att identifiera varje subtyp före cellisolering. Denna teknik möjliggör karaktärisering av celler såväl som för deras isolering direkt från näthinnan, utan behov av vävsdissociation, vilket kan orsaka ett stressrespons inom celler och kontaminering på grund av avbrutna dendriter 9 .

En mängd nya tekniker har kommit fram under de senaste åren, eftersom RNA-Seq-metoden fortsätter att utvecklas. Dessa verktyg möjliggör maximalt cellförvärv och större kostnadseffektivitet när man närmar sig frågan 4 , 7 , 10 , 11 , 12 , 13 . Men medanDessa tekniker har varit utmärkta stegstenar, det finns ett antal hinder som fortfarande uppstår som detta protokoll kan adressera. För det första isolerar många av de aktuella procedurerna celler från dissocierad vävnad och försöker använda antingen huvudkomponentanalys eller hierarkisk clustering post-hoc för att bestämma cellklassificering. Att förlita sig på dessa verktyg för att klassificera undertyper kan inte ge tillförlitliga resultat och kan tvinga en att hitta nya sätt att validera denna data för korrelation av en genetisk markör till en funktionell celltyp. Kravet på dissociation i andra protokoll kan ibland resultera i vävnadsskada och kan orsaka att neuronprocesser avbryts, vilket resulterar i en potentiell förlust av mRNA. Dessutom kan spänningsreaktioner i dissocierade cellpreparat börja påverka transkriptomerna av dessa celler 14 . Detta protokoll övervinner dessa utmaningar genom att bestämma funktionell celltyp före isolering, och det bibehåller h bättreCellens hälsa genom att hålla näthinnan intakt.

En teknik infördes 2014 och bestod av in vivo analysen av transkriptomen av levande celler 15 . Medan denna teknik möjliggör undersökning av transkriptomen med minimal mekanisk störning i vävnaden saknar den förmågan att klassificera specifika celltyper i vävnaden innan man undersöker deras transkriptomer utan att använda en mycket specifik reportermus. Vårt protokoll kräver ingen specifik reporter, eftersom vi använder cellfyllning och elektrofysiologi för att karakterisera celler före isolering. En annan begränsning av detta tidigare protokoll är att det kräver en specifik våglängd för att excitera det fotoaktiverbara elementet, medan vårt protokoll tillåter användning av en fluorescerande reporter och fluorescerande färgämne, som är lättillgängliga eller kan väljas av varje laboratorium individuellt. Fortfarande har andra laboratorier gifte sig med de två metoderna för elektrOphysiologi och transkriptomik för studier av cellulär mångfald. Användningen av patch-clamp-inspelningar för att karakterisera funktionen hos en cell före dess isolering har utförts på dissocierade neuroner 16 och i vissa fall har den föregått användningen av mikroarrayanalys 17 för dessa studier. Samma komplikationer uppstår vid dessa tillvägagångssätt, eftersom de kräver vävnadsdissociation eller användningen av mikroarray-teknik, som bygger på hybridisering av prover till tillgängliga prober. En av de senaste framstegen har utvecklats av Patch-Seq, en teknik som kombinerar användningen av patch-clamp-inspelningar och RNA-Seq-teknik för att förstå celler från helhjärnskivor 18 . Medan denna teknik har likheter med protokollet som presenteras här är det återigen viktigt att notera att vårt tillvägagångssätt gör att vävnaden kan förbli intakt för cellernas hälsa. Här presenterar vi ett protokoll för optimizatJon av denna allians, som genererar högkvalitativa, encelliga bibliotek för användning av RNA-Seq för att erhålla ett högläst djup och kartläggningsskydd.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Samtliga förfaranden godkändes av Institutionen för djurvård och användning (IACUC) vid Northwestern University.

1. Framställning av lösningar för elektrofysiologi (4 h)

  1. Gör 0,1% DEPC-behandlad H2O genom att tillsätta 1 ml dietylpyrokarbonat (DEPC) till 999 ml omvänd osmos-renad H2O . Blanda noggrant och låt blandningen inkuberas i 1 h vid rumstemperatur (RT). Därefter autoklaverar DEPC-blandad H2O i 15 min på en flytande cykel. Låt den DEPC-behandlade H2O svalna vid RT.
  2. Gör den extracellulära lösningen genom att blanda en flaska Ames-medium och 1,9 g (23 mM) natriumbikarbonat i 1 liter H2O. Bubbla den extracellulära lösningen med
    95% O2 / 5% CO2 och behåll det vid ett pH av 7,3-7,4.
  3. Generera den intracellulära lösningen genom att kombinera 125 mM K-glukonat, 2 mM MgCl2, 10 mM EGTA, 10 mM HEPES och 0,1% DEPC-behandlad H2 O. Förvara den i 1 ml alikvoter vid -20 ° C. Tillsätt 10 μM fluorescerande spårämne i början av varje experiment.
  4. Gör enzymlösning genom att tillsätta 10 000 enheter kollagenas och 83 mg hyaluronidas till 4,15 ml extracellulär lösning. Enzymlösningen bör lagras i 50 μl alikvoter vid -20 ° C.

2. Framställning av retinalvävnad (2 timmar)

OBS! Alla procedurer i detta avsnitt ska utföras under dim röd belysning

  1. Mörkadjustera djur i minst 1 h före dissektion. Utför alla procedurer under dim röd belysning.
  2. Euthanize djuren genom CO 2 kvävning och enucleate ögonbollarna i en Petri skål med tidigare oxygenerad extracellulär lösning.
  3. Poke hornhinnan med en nål och skär den bort genom att klippa med oftalmisk sax vid gränsen till hornhinnan och sclera 19 .
  4. Ta bort linsen med# 5 tångar. Gör försiktigt en riva i sclera med tången och ta bort den optiska nerven där näthinnan och sclera möts. Avsluta försiktigt bort sclera från näthinnan.
  5. Ta bort det genomskinliga glasögonet med hjälp av # 5 tångar; När en gång avlägsnats visas glasögon som en gelatinös substans som fastnar på tången. Skär retina i hälften (så att det finns 4 stycken / djur) och förvara dem i syrgaserad extracellulär lösning vid RT tills användning.
  6. När du är redo att montera vävnaden i inspelningskammaren, placera en bit av näthinnan för att inkubera i enzymlösning utspädd i 500 | il av syrgaserad extracellulär lösning. Inkubera i en petriskål i 2 minuter vid RT på en skakare.
    1. Tvätta retina i syresatt extracellulär lösning och placera vävnaden i en glasbaserad inspelningskammare; Använd en plastöverföringspipett med spetsen avskuren så att näthinnan kan överföras utan att skada vävnaden.
  7. Använda förCeps att noggrant plana vävnaden med fotoreceptorskiktet vänd nedåt. Ta bort överskottsvätska med hjälp av en pipett. Förankra vävnaden med en platinring med nylonnät.
    OBS: Denna metod kan också användas för att framställa vävnaden för isolering av RNA från märkta amakrina och bipolära celler.
  8. Fyll kammaren med oxygenerad extracellulär lösning och montera den på ett mikroskopsteg. Perfusiv vävnad med oxygenerad extracellulär lösning vid 2-4 ml / min.

3. Visualisering och inriktning av GFP + retinala Ganglion-celler (10 min)

OBS! Alla procedurer i detta avsnitt ska utföras under dim röd belysning

  1. Innan du börjar, dra glasmikropipetter (OD: 1,2 mm, ID: 0,69 mm) för elektrofysiologiska inspelningar med hjälp av en mikropipettdragare. Använd följande protokoll för elektroderna (observera att parametrarna ska justeras för att uppnå önskat motstånd och viljeVariera över dragare och med olika glas): Värme: Ramp +10; Dra: 0; Vel: 23; Fördröjning: 1; Tryck: 500; Programsling: 5 gånger. Se till att tipsen är ~ 1 μm i diameter, med resistanser på 2-4 MΩ för inriktning av stora celler och 5-7 MΩ för att rikta in mindre celler.
  2. Observera ganglioncellskiktet med hjälp av IR-DIC-optik (Infrared Differential Interference Contrast) ( Figur 1A ). Identifiera GFP + Retinal Ganglion Cells (RGC) med epifluorescens (~ 480 nm) ( Figur 1B ).
  3. Sök pipetten fylld med intracellulär lösning i DIC. Applicera litet positivt tryck och noll eventuella spänningsförskjutningar på förstärkaren.
  4. Tryck på glasmikropipetten mot en GFP + -cell och använd negativt tryck för att bilda en GΩ-tätning mellan pipetten och cellmembranet. Applicera testspänningskommandotrin ( t ex 5 mV) för att övervaka tätningsmotståndet. Efter att ha bildat en stabil tätning bryts membranet genom att applicera korta pulser av nEgativt tryck för att få tillgång till helcell.
  5. Vänta 1-2 minuter för cellens dendriter för att fylla med fluorescerande spårämne.
    OBS: Cellen kan skrivas morfologiskt genom att undersöka morfologin vid epifluorescens ( Figur 1C ). När det gäller melanopsin-uttryckande RGC, visualiseras dendritisk stratifikation i det inre plexiforma skiktet genom att undersöka dendriterna fyllda med fluorescerande spårämne under epifluorescerande belysning och bestämma huruvida de stratifierar långt ifrån soma i OFF-sublimina (M1 ipRGC), nära ganglion Cellskikt i ON-sublamina (M2 & M4 ipRGC) eller båda (M3 ipRGCs). Denna observation, kombinerad med soma-storlek (M4s har tydligt stora somas jämfört med alla andra ipRGC-subtyper), möjliggör identifiering av celltyp 20 , 21 , 22 . Sålunda möjliggör denna teknik för identifiering av celltyp in vitro före RNA isoning. Denna metod kan modifieras för andra celltypidentifieringsprotokoll som involverar antingen dendritisk morfologi eller cellulär fysiologi.

4. Cellisolering (2 min)

  1. Innan du börjar, sätt bordplattmikrocentrifugen till 2000 x g. Förbered en provutvisningsapparat genom att ansluta slangen (OD: 3/32 in, ID: 1/32 in) med en 1 cc spruta.
  2. Placera 0,2 ml PCR-rör innehållande 10 | il lysisbuffert och 1% p-merkaptoetanol på is. Förbered en 1 cc spruta innehållande DEPC-behandlad H 2 O för att skölja pipettspetsarna. Förbered en behållare av torris för att frysa lysisbufferten efter provinsamling.
  3. Ta försiktigt ut cytoplasmatiska innehållet i cellpipetten genom att applicera negativt tryck med en 10 ml spruta; Allt cytoplasmatiskt innehåll, inklusive organeller, bör extraheras om möjligt.
    1. Övervaka extraktionen i DIC genom att visualisera cellkroppen som minskar i storlek. Efter extraktion Det cytoplasmatiska innehållet lyfter pipetten försiktigt av vävnaden och tar snabbt bort pipetten från lösningen.
  4. Ta snabbt bort pipetten från huvudstegshållaren och skölj pipettspetsen kort med DEPC-behandlad H 2 O med en 1 ml spruta. Anslut pipetten till en 1 ml spruta via tät slang för att fördröja provet.
  5. Utsätt cellerna omedelbart i 10 μl lysbuffert 1 innehållande 1% p-merkaptoetanol i 0,2 ml PCR-rör.
    OBS: Hela aspiratet med cellerna ska utvisas försiktigt för att inte införa bubblor.
    1. Centrifugera röret kort i en miniscentrifuge med bordplatta vid 2000 xg under 10 s. Flaskfrys proverna omedelbart i 5 minuter på torris. Efter frysning, lagra dem vid -80 ° C i upp till två veckor för bästa resultat; Proverna kan vara längre, men det rekommenderas att de behandlas så snabbt som möjligt.
E "> 5. RNA-rening (30 min)

  1. Innan du börjar, sätt upp en magnetisk separatoranordning genom att tappa överdelen av en inverterad P20 eller P200 tipphållare till det 96-brunnars magnetiska stället 23 .
  2. Förbered fräsch 70% etanol (EtOH) - ungefär 1 ml per prov räcker. Ta bort RNA-magnetiska pärlor från 4 ° C förvaring och tina dem vid RT i minst 30 minuter.
    OBS! Högst 8 prov ska behandlas samtidigt, så många steg i detta protokoll är beroende av effektivitet och snabb hantering.
  3. När de magnetiska pärlorna är vid RT, virvel i 30 s för att säkerställa att lösningen är väl blandad.
    OBS: Pärlorna använder en RNA-specifik buffert för att selektivt binda RNA, och de möjliggör avlägsnande av annat cellulärt avfall vid användning i en magnetplattform.
  4. Tina celler vid RT i 1 min, och sedan tillsätt 5 | il RNas-fri H20 till varje prov; Pipett upp och ner. Tillsätt 22 μL RNA-pärlor till varje rör och pipettE grundligt att blanda. Inkubera proven vid RT i 5 min för att tillåta RNA att interagera och binda med magnetiska pärlorna.
  5. Placera rören på en magnetisk separatoranordning och låt sitta i 8 minuter; Innan du fortsätter, se till att supernatanten är klar. Observera pärlorna från en pellet och var noga med att inte lossna den under pipetteringen.
  6. Ta bort supernatanten från proverna och sätt 150 μL 70% EtOH. Ta bort EtOH och upprepa tvätten två gånger mer.
  7. Låt provet lufttorka i 6 minuter. Kontrollera intermittent för att se om mer EtOH har samlat i botten av röret. Ta bort det i enlighet med detta.
  8. Medan proverna torkar, förbereda 10X reaktionsbuffert genom att kombinera 19 | il lysisbuffert 2 och 1 | j, l RNase-inhibitor (40 U / jil). Snurra det kort och håll det på is.
  9. När provet är torrt och pärlpelletsna inte längre ser blankt ut, ta bort rören från den magnetiska separatorn och tillsätt 9,5 μL RNase-fri H2OAtt rehydrera proverna. Placera proven på is och tillsätt 1 μl 10x reaktionsbuffert till varje prov.

6. Omvänd transkription (10 min)

OBS! Innan du börjar tina de nödvändiga reagenserna för omvänd transkription (RT, förutom enzymet) på is. Dessa innefattar: primer II, buffert 1, oligonukleotid och RNasinhibitor.

  1. Till varje rör tillsätt 2 μl primer II (AAGCAGTGGTATCAACGCAGAGTACT (30) N - 1N, för vilken N- 1 kan vara A, C eller G och N kan vara A, C, G eller T; 12 | im). Placera rören i en termocykler som har förvärmts vid 72 ° C under 3 minuter.
  2. Under inkubation, förbered RT-mastermixen. För varje reaktion tillsätt 4 μl buffert 1 (250 mM Tris-HCl, pH 8,3, 375 mM KCl och 30 mM MgCl2), 1 | il oligonukleotid (48 | im) och 0,5 | il RNasinhibitor (40 U / il).
  3. Omedelbart efter inkuberingen, sätt in rörenIs i 2 min.
  4. Tillsätt 2 μL per reaktion av omvänt transkriptas (100 U / μl) till masterblandningen och pipetten noggrant. Tillsätt 7,5 μL masterblandning till varje rör och blanda med försiktigt pipettering. Snurra rören i korthet för att hämta innehållet i botten och placera dem i en förvärmd termocykler med följande program: 42 ° C i 90 minuter, 70 ° C i 10 minuter och ett håll vid 4 ° C.
  5. Förvara rören vid -20 ° C / N innan du fortsätter, även om det rekommenderas att proven transporteras genom amplifieringssteget innan den lagras under långa perioder. Andra källor antyder O / N-lagring vid 4 ° C skulle också vara acceptabelt vid detta steg 24 .

7. cDNA-amplifiering (2,5 h)

OBS! Innan du börjar, tina PCR-bufferten och PCR-primeren på is och snurra rören i en miniscentrifuger innan du gör PCR-masterblandningen.

  1. För varje reaktion, sReparera en PCR-masterblandning innehållande 25 | il PCR-buffert, 1 | j, l PCR-primer (12 | iM), 1 | j, l DNA-polymeras och 3 | j, l nukleasfri H2O.Tillsätt DNA-polymeraset senast, just före tillsatsen Av mästerblandningen till proven.
  2. Tillsätt 30 μL masterblandning till varje rör och snurra vid 2000 xg i 10 s för att samla innehållet i botten av rören.
  3. Placera rören i en förvärmd termocykler med följande program: 95 ° C i 1 min; 34 cykler av 98 ° C under 10 s, 65 ° C i 30 s och 68 ° C i 3 min; 72 ° C under 10 minuter; Och ett håll vid 4 ° C.
    OBS: Antalet cykler för denna PCR har ökats till 34, skiljer sig från den föreslagna tillverkarens instruktioner. Efter upprepad testning visade sig detta cykelnummer producera konsekvent pålitliga resultat.
  4. Förvara rören vid -20 ° C i upp till ett år innan du fortsätter.

8. Rening av amplifierad cDNA (30 min)

  1. Innan rening påbörjas, ta DNA-pärlorna och elueringsbufferten till RT i minst 30 minuter. Förbered färsk 80% EtOH; 1 ml per prov bör räcka. Tillsätt 1 μl 10X lysisbuffert till varje prov.
  2. Virvel DNA-pärlorna under 30 s och tillsätt 50 pi DNA-pärlor till varje prov. Blanda noggrant genom pipettering och snurra sedan kort dem vid 2000 xg under 10 s. Inkubera rören vid RT i 8 minuter.
  3. Placera rören på magnetiska separationsanordningen i 5 minuter. Försiktigt pipettera supernatanten upp och ner två gånger och låt provet sitta i 2 minuter. Medan proven är på magnetanordningen, avlägsna supernatanten och kassera.
  4. Tillsätt 150 μL nybyggd 80% EtOH till varje prov och låt dem sitta vid rumstemperatur under 30 s. Ta bort EtOH och upprepa EtOH-tvätten en gång.
  5. Snurra proverna snabbare och sätt tillbaka dem på magnetiska separatorn i 1 minut. Ta bort eventuella kvarstående EtOH och låt provet lufttorka i 5 minuter.
  6. När pärlpelleten inte längre ser blank ut, men innan sprickor börjar dyka upp, ta bort röret från den magnetiska separatorn och tillsätt 17 μl elueringsbuffert. Försiktigt pipettera upp och ner för att återuppsätta pärlorna helt.
  7. Inkubera de återuppslammade proven vid RT i 2 min.
  8. Snurra proverna för att samla all vätska i botten och placera dem på magnetskäraren i 2 minuter. Överför 15 μl klar supernatant till ett 1,5 ml RNase-fritt rör och förvara det vid -20 ° C.
  9. Undersök kvaliteten och storleken på cDNA-biblioteket med ett högkänsligt bioanalysatorchip med användning av 1 pl cDNA. Den ideala storleken av ett cDNA-bibliotek är 0,3-2 Kb, med en koncentration av minst 10 ng / μl ( Figur 2 ).
    OBS! Du kan välja att använda PCR som ett sätt att skärpa prov för att säkerställa uttryck av kända markörer innan du fortsätter med prov preparation.

9. Bestäm koncentrationer och märkning cDNA (20 min)

  1. Innan du börjar, ta analysreagenset, utspädningsbufferten och standarderna till RT i 30 minuter. Förbered en masterblandning innehållande 1 jil analysreagens och 199 jil av utspädningsbuffert per reaktion. Aliquot 199 μL av denna blandning i 500 μl analysrör. Tillsätt 1 μL prov och blanda noggrant.
  2. Alikvot 190 μL masterblandning till rör 1 och 2. Lägg till 10 μL standard 1 till rör 1 och 10 μL standard 2 till rör 2. Vortex alla provrör och standardrör i 5 s; Inkubera vid RT under 3 minuter.
  3. Bestäm koncentrationen av prover med en högkänslig fluorometer. Se till att rätt provmängde har matats in genom att välja alternativet "beräkna lagerlösning" och markera "1 μL". Späd varje prov i ett separat 1,5 ml rör till en slutlig koncentration av 0,2 ng / μl i RNas-fri H2O .
    NOTERA:Tillverkarens instruktioner tyder på att man bör börja med 1 ng / μl totalt DNA, vi har använt ett mindre utgångsbelopp och har också anpassat protokollet för att ta hänsyn till detta ändringsförslag.
  4. I nya 0,2 ml PCR-rör, pipett 2,5 μl buffert 2. Lägg till 1,25 μL cDNA i lämpligt rör för totalt 250 pg. Slutligen tillsätt 1,25 μL tagmenteringsblandning till varje rör och pipett noggrant för att blanda; Transposasen inom tagmenteringsblandningen fragmenterar DNA: n i korta strängar och annialler adaptrarna till vardera änden av varje sträng, för senare användning av sekvenseringsinstrumentet.
    OBS: Volymerna som används för märkning och indexkoppling är en bråkdel av den mängd som föreslagits av tillverkarens instruktioner. Detta möjliggör inte bara bevarande av reagenser, men det har också konsekvent producerat taggade prover i vår erfarenhet.
  5. Centrifugera rören på en mikrovågsugn i 1 minut.
  6. Placera rörenI en förvärmd termocykler med följande program: 55 ° C i 10 minuter och ett håll vid 10 ° C.
    OBS: Längden på denna inkubation är 10 min, i motsats till den föreslagna 5 min från tillverkarens instruktioner.
  7. Omedelbart efter det att detta program är färdigt, ta bort rören och sätt till 1,25 μL tagmenterings-neutraliserande buffert till vardera. Pipettera väl för att blanda och inkubera vid RT i 5 min. Slutför detta steg omedelbart, eftersom transposasen förblir aktiv tills bufferten neutraliserar enzymet och stoppar reaktionen.

10. Index koppling och rening (1 h)

OBS! Innan du börjar, ta DNA-pärlorna och resuspenderingsbufferten till RT i minst 30 minuter. Bestäm vilka index som ska användas för varje prov.

OBS: Dessa index kopplas till respektive 5'- och 3'-ändar av det fragmenterade DNA för identifiering av prover som följer sekvensering. Se till att ingen tvåParningar är desamma för prover som kan sekvenseras tillsammans. Till exempel, om prov 1 använder index vita 1 och orange 1, ska prov två använda vit 1 och orange 2 eller vit 2 och orange 2, men aldrig samma kombination av index. Denna sats innehåller 4 distinkta vita och 6 distinkta orange index. Alla olika möjliga kombinationer tillåter upp till 24 prover att samlas i en sekvenseringsfält. Även om vi typiskt bara samlar 10 prover i en körfält, kan man också använda satsen som innehåller 24 index, vilket skulle möjliggöra samling av 96 prover i en enda sekvensföljd, om så önskas.

  1. Till varje rör lägger du 1,25 μL av vänsterindex och 1,25 μL av det högra indexet för det specifika provet. Tillsätt 3,75 μL PCR-mastblandning och pipett väl för att blanda.
  2. Centrifugera i en mikrovågsugn i 1 minut.
  3. Placera rören i en förvärmd termocykler med följande program: 72 ° C i 3 minuter; 95 ° C i 30 s; 12 cykler av 9576 ° C i 10 s, 50 ° C i 30 s och 72 ° C i 1 min; 72 ° C under 5 min; Och ett håll vid 4 ° C.
    OBS: Det första 95 ° C-steget ändrades från 98 ° C, vilket föreslogs av tillverkarens instruktioner. Även cykeldetaljerna justerades så att temperaturerna och tidslängderna tillåts för optimal märkning av våra prover. Den slutliga 72 ° C inkubationen tillsattes också till vårt protokoll och ingick inte i tillverkarens instruktioner.
  4. Snurra snabbt rören för att samla innehållet längst ner. Vortex DNA-pärlorna under 30 s, och tillsätt sedan 30 pi till varje rör och blanda noggrant genom pipettering.
  5. Inkubera proven vid RT i 5 min.
  6. Placera proven på en magnetisk separator i 2 min. Pipettera supernatanten upp och ner två gånger och inkubera prov under 1 minut.
  7. Ta bort och kassera den klara supernatanten. Tillsätt 150 μl 80% EtOH till varje prov och avlägsna. Upprepa EtOH-tvätten en gång.
  8. Tillåt thE prov till lufttorka i 10 min. Kontrollera intermittent för att se om något EtOH har samlat i botten av rören och ta bort vid behov.
  9. När en spricka börjar dyka upp i DNA-pärlpelleten, avlägsna provet från den magnetiska separatorn och tillsätt 27,5 μl resuspensionsbuffert för att återhydrera pelleten. Se till att pelleten är helt återuppslamad och inkubera sedan vid RT i 2 minuter.
    OBS: Volymen som användes för resuspensionsbufferten modifierades för att ta hänsyn till den mindre mängden utgångsmaterial i vårt protokoll och skiljer sig från den föreslagna volymen i tillverkarens instruktioner.
  10. Placera rören på magnetskärmen i 2 minuter. Överför 25 μl klar supernatant i ett RNase-fritt rör och förvara vid -20 ° C.
    OBS! Fortsätt inte med tillverkarens instruktioner för att slutföra bibliotekets normalisering. Proverna framställs framgångsrikt efter detta steg och är beredda för sekvensering som det är.
  11. Analysera tAgmentering av proverna med användning av ett bioanalysatorchip och 1 pl av varje prov.
    OBS: Analysen av smuts kommer att utföras som tidigare; CDNA bör nu detekteras i ett storleksintervall av 0,2-1 Kb ( figur 3 ). Smörj under denna punkt representerar sannolikt försämringen av prover, medan större smuts tyder på ofullständig tagning.

11. Poolning av prov (10 min)

  1. Hämta koncentrationer av tagmentationsprover med den högkänsliga fluorometern från tidigare och bestäm koncentrationen i nM.
    OBS: Denna beräkning kan beräknas med hjälp av ett internetomvandlingsverktyg och bygger på den genomsnittliga fragmentlängden från bioanalyzer-spåret. För att bestämma den genomsnittliga fragmentlängden observera spåret för varje prov individuellt och bestäm storleken på det genomsnittliga DNA-fragmentet. Detta kan också beräknas när man granskar bioanalysatorns spår genom att markera spridningsintervallet och undersöka detE molaritet beräknad av programmet.
  2. Kombinera prov så att poolen innehåller samma koncentration av varje prov. Utsätt inte proverna; Poolen bör vara så utspädd som det lägsta koncentrerade provet och skulle helst ha en total koncentration av minst 15 nM.
  3. Förvara de sammanslagna proven vid -20 ° C före sekvensering; Det föreslås att prover genomgår sekvensering inom 1 vecka av poolning. Utför parad slutet, 100 bp sekvensering med en HiSeq-plattform.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Celltyper klassificeras lätt efter färgämneinjektionen

Figur 1 visar ett exempel på en GFP + RGC före och efter fluorescerande spårfyllning. Denna cell identifierades baserat på dess uttryck av GFP i den transgena linjen ( Figur 1A ). En tät försegling formades med en fin-spetsdriven glaselektrod på summan av denna cell. För att karakterisera subtypen injicerades det fluorescerande färgämnet i summan och fick fylla alla associerade processer ( Figur 1B ). Klassificeringen som en M4 ipRGC aktiverades genom observation att denna cell har en mycket stor soma och att dess processer avslutas inom ON-sublimina hos det inre plexiforma lagret ( Figur 1C ). Som en illustration av skillnader i stratifiering som kan urskiljas i en isolerad retinalberedning fyllde vi M1 (OFF-stratifyinG), M3 (registrerad) och M4 (ON-stratifierande) ipRGCs med en fluorescerande spårare, fixerade dem och utförde konfokal bildbehandling av ON och OFF-subliminae ( Figur 1D ). Denna visualisering av dendritema via konfokal bildbehandling liknar hur dendriter ser ut i oförbunden in vitro- vävnad när cellerna fylls med ett fluorescerande spårämne (Schmidt och Kofuji 2009, 2010 och 2011).

CDNA-bibliotek från enkla celler

Användningen av en Oligo d (T) primer möjliggör selektiv revers transkription och amplifiering av mRNA. Efter generering och amplifiering av cDNA-biblioteken från varje cell användes bioanalysatorchips för att bedöma bibliotekens kvalitet och storlek. Resultaten av denna analys visar att de ideala cDNA-smärtan är 0,5-2 Kb i ett bra prov ( Figur 2A ). Vissa prover visar några band eller smuts under 300 bp mark, sugGissade att dessa bibliotek är av dålig kvalitet (se tabell 1 för felsökning). Ett exempel på ett bioanalysatorspår av god kvalitet visar få eller inga DNA-band under 300bp och en robust smet mellan 500bp och 2kb (Figur 2B). Tomma kontrollbanor ska visa lägre och övre markörer vid respektive 35 respektive 10380 bp, liksom en stadig baslinje som inte fluktuerar. Olika bibliotek kan producera kvalitetsdata, vilket framgår av både Figur 2B och 2C , vilket gav utmärkt läsdjup och höga mapphastigheter. Endast de prover med starka cDNA-bibliotek av den förväntade storleken bör överföras till tagmentation (se tabell 1 för felsökning).

Low-input tagmentation förbereder högkvalitativa prover för sekvensering

Detta protokoll är optimerat för tagmentering med en mindre mängd startmaterial l. Bara 250 pg fungerar bäst för en lyckad tagmentering, eftersom lägre mängder inte förstärker ordentligt och högre mängder kommer inte att fragmentera helt. Efter avslutad tagmentering och PCR-amplifiering / provrengöring analyserades proven igen på en bioanalysatorchip. De ideala cDNA-utstrykningarna vid denna punkt bör vara 0,2-1 Kb ( figur 3A ). Spåret ska vara jämnt och jämnt fördelat mellan de två storlekarna ( Figur 3B ); Detta spår motsvarar provet i lane 1. Figur 3C visar en ofullständig märkning, som enkelt kan lösas (se tabell 1 för felsökning). Vi har utfört dataanalys på proverna och fann att detta protokoll producerade prover med utmärkt läsdjup, som ofta överskrider 12 miljoner läser per prov; Medelvärden av 69,1% kartläggning; Och mer än 5000 uttryckta gener.

/55229fig1.jpg "/>
Figur 1: Identifiering av RGC-typer baserat på GFP-uttryck i Melanopsin-uttryckande ipRGC och på morfologiska egenskaper. ( A ) Ganglioncellskiktet i näthinnan visualiserades med användning av IR-DIC i helmonterad näthinnan. ( B ) Samma förberedelse visualiserades i epifluorescens (~ 480 nm) för att identifiera GFP-uttryckande ganglionceller. ( C ) En GFP-uttryckande cell riktade till patch-clamp-inspelning och fylld med ett fluorescerande spårämne. Cellen kan identifieras som en M4 ipRGC baserat på dess mycket stora soma storlek och ON-stratifierande dendriter 25 , 26 . ( D ) Konfokal bild av ipRGC-dendriter som avbildas i IPL (M1) ON och / eller OFF-underskrift, i IPL (M4) ON-sublimina, och i både IPL (M3) ON och OFF-subliminae. IR-DIC: Infraröd differentiell interferenskontrast..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Analys av cDNA-bibliotekskvalitet med ett Bioanalyzer-spår. ( A) Bioanalyzer-utgångsexempel för multipelprover som har omvänd transkriberats, amplifierats och renats. Banorna 1-3 visar de perfekta DNA-smutsarna, med majoriteten av DNA större än 300 bp. Bibliotek med smuts i detta intervall har konsekvent tillhandahållit utmärkta sekvenseringsdata, vilket visar i genomsnitt 5 683 gener uttryckt per cell. Spår 4 representerar ett prov som misslyckades bearbetat och producerade sålunda ingen cDNA. Den framgångsrika kontrollbanan har en konstant baslinje och två rena toppar vid 35 och 10 380 bp. ( B ) Exempel på ett framgångsrikt bioanalysatorspår med en hög intensitet av cDNA runt 2 Kb. Detta s Mår motsvarar provet i lane 1. ( C ) Exempel på ett framgångsrikt bioanalysatorspår med cDNA centrerat runt 500 bp. Detta spår motsvarar provet i lane 3. Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Tagmenterade prov visar robusta smuts mellan 0,2 och 2 Kb. ( A ) Ett representativt exempel bioanalysatorutgång efter tagmentering, amplifiering och PCR-rengöring. ( B ) Spår av ett framgångsrikt taggat prov som motsvarar spår 1 i (A). ( C ) Exempel på spåret för ett prov med ofullständig tagning, klar med toppintensiteten omkring 1 Kb."> Vänligen klicka här för att se en större version av denna figur.

2 "> Späd provet till koncentrationen av 0,4 ng / μl och rerun tagmentation
Problem Möjlig orsak Lösning
Steg 3.3) Kan inte bilda GΩ-tätning Ytan på cellen är inte tillräckligt ren Rengör vidare med positivt tryck
Steg 3.3) Cell verkar deflera / dö Förbered ny pipett och rikta in en ny cell
Steg 3.4) Kan inte bestämma terminalplats för dendriter Alexafluor har inte haft tillräckligt med tid att diffundera genom cellen eller koncentrationen av Alexafluor är inte tillräckligt hög Kontrollera att förstärkningen och exponeringstiden på kameran är tillräckligt höga. Vänta ytterligare 5 minuter innan du visualiserar dendriter. Om dendriter fortfarande inte är synliga, förbereda lösningen med högre Alexafluorkoncentration.
Steg 4.1) Kan inte aspirera hela cytoplasman
Steg 5.5) Supernatanten är inte klar efter 8 minuter Försiktigt pipettera hela lösningen två gånger, medan den fortfarande är magnetisk separator, och låt sitta i ytterligare 5 min
Steg 5.5) Pellet dispergeras under pipettering Provet är för långt från magnet Håll rör på magnetisk separationsanordning under all pipettering. Expel-lösningen och tillåta pärlor att återpellera i 5 min
Steg 5.7) Efter 5 min visas prover fortfarande blanka Maximal mängd EtOH har inte tagits bort Fortsätt att övervaka prov under torkning. Var 2: e minut, använd en P10 pipett och ta bort allt EtOH i botten av röret
Steg 8.9) Pellet hade sprickor före rehydrering Låt provet rehyderasBetygsätt i totalt 4 min, istället för 2 (steg 8.10)
Steg 8.11) En liten mängd pärlor upptogs med supernatant Lossa hela provet tillbaka i röret och placera på magnetisk separator i 1 min; Pipa upp försiktigt och var noga med att undvika pellets
Steg 8.12) DNA-smuts är inkonsekvent och fluorescensskala förändras kontinuerligt För hög DNA-koncentration för ett HS-chip Kontrollera koncentrationen av provet och späd mellan 1 - 10 ng / μl. Rerun bioanalyzer
Steg 8.12) Smält med låg molekylvikt RNA-nedbrytning Se till att blixten fryser omedelbart efter insamling. Kassera detta cDNA-bibliotek
Steg 8.12) Variabel markörlinje i kontrollpanel Förorening eller gammalt reagens Kassera DNA-markör och använd nytt rör för Bioanalyzer-körning
Steg 8.12) Inget DNA-smear Underlåtenhet att utvisa cell Dra nya nålar med en något större spets
RNA-pärlfel Se till att pärlorna har blivit fullständigt återuppslamna före användning och låt prov inkuberas innan de placeras på magnetisk separator
Steg 8.12) Svagt DNA-smear Inte tillräckligt med förstärkning Använd fler PCR-cykler
Steg 8.12) DNA-smörjning utanför 500bp-2Kb-intervallet DNA-smuts under 0,5 och över 2 Kb är sannolikt förorening. Kassera provet
Steg 8.12) Regelbundna spikar på DNA-spår Förorening av provet Använd alltid nya handskar och gör ny etanol för sköljning. Filtertips ska alltid användas
Steg 9.3) Kan inte detektera koncentration av prov på fluorometer Prover under detekteringsnivån har för lite DNA för tagmentering och kan inte användas
Steg 10.10) Proverna är inte torra efter 10 minuter Fortsätt att avlägsna överskott av EtOH Låt provet lufttrycka längre, kolla på dem varje minut
Steg 10.13) Smör skevad mot 2Kb Ofullständig fragmentering Återutspätt prov till en koncentration av 0,15 ng / μl, snarare än 0,2 ng / μl; Rerun tagmentation
Steg 10.13) Smör skevad mot 200bp För lite DNA-ingång Torka provet mindre, prova en koncentration av 0,4 ng / μL; Rerun tagmentation
Tagmenteringsreaktion för lång Minska reaktionstid för tagmentering till 8 min
Steg 10.13) Svaga smutsar Felaktig förstärkning av DNA
Steg 11.2) Maximal tillgänglig poolkoncentration är under 5 nM Identifiera vilka prov (er) som har signifikant låga koncentrationer och återanvändning med ny utspädning

Tabell 1: Lösningar och förslag till potentiella hinder i protokollet. I tabellen visas potentiella problem som kan inträffa under det här protokollet och de steg där man kan stöta på dem. I tabellen visas möjliga orsaker för många av dessa problem, liksom lösningar som kan hjälpa till att lösa eventuella problem.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vårt protokoll visar genom en snabb och användarvänlig guide en metod för att förbereda enskilda celler av identifierade morfologiska klasser för högkvalitativ sekvensering, med liten skada på provet. I det nuvarande manuskriptet karaktäriseras intrinsiskt ljuskänsliga retinala ganglionceller morfologiskt, isoleras och prepareras för RNA-Seq. Cellspänningar kan inträffa under retinalhantering; Av denna anledning byter vi varje bit av vävnad efter högst 4 timmars användning. Vi kan bedöma cellernas tillstånd genom att använda elektrofysiologiska riggen för att spela in från dessa celler och att övervaka deras svar, vilket gör att vi kan se till att cellerna har god hälsa. Vårt protokoll medgav för genereringen av framgångsrika cDNA-bibliotek från 15 av 23 prover bearbetade, vilket gav en framgångsgrad på 65%. Vidare var kvaliteten på våra sekvenseringsdata utmärkt, eftersom det genomsnittliga antalet gener uttryckta av våra celler varierade från 2 236-10 353 med i genomsnitt 5 683Gener som registrerar med ett icke-noll-FPKM-värde. Dessa siffror liknar uttryckta genräkningar som hittas av andra studier av neuroner 5 , vilket visar att våra data också är av god kvalitet.

Medan vi har haft framgång med detta protokoll för dessa specifika neuroner, bör det noteras att mindre ändringar av denna teknik kan tillämpas för ett antal olika tillämpningar. Med hjälp av fluorescensaktiverad cellsortering (FACS) inom en separat musmodell har vi isolerade små populationer av celler (1000 - 25 000) märkta med en GFP-markör från centrala nervsystemet. RNA från dessa populationer isolerades och 1 jil (vid eller något under 12 ng / jil) av detta RNA användes för att påbörja omvänd transkription vid steg 6.1. Den enda justeringen som ska göras till protokollet efter detta steg sker i steg 7.4, vid vilken tidpunkt man kan välja att använda färre PCR-cykler. Vi har använt 19 cykler i fall då det ursprungliga provet innehöll gReater än 10 000 celler och har funnit att detta producerar cDNA-bibliotek av god kvalitet. Exempelvis framställdes cellprover från en FACSorterad population och antalet gener uttryckta varierade från 12,340-14,052, med i genomsnitt 13.265 gener med ett icke-noll-FPKM-värde. Denna teknik kan tillämpas på olika musmodeller för vilka en fluorescerande reporter är närvarande. På grund av detta ändringsförslag kan forskare eventuellt studera vilken cellpopulation som en fluorescerande reportermus är tillgänglig för, och utvidga studierna över området för neuronal mångfald.

En andra anpassning kan göras till profilceller baserat på funktionalitet snarare än bara morfologi. Detta projekt bygger på en transgen modell, men denna teknik kan tillämpas på neuroner utan kända molekylära identifierare. Till exempel finns över 30 funktionella subtyper av retinala ganglionceller som för närvarande identifieras 27 , av vilka få få har unika markörer. Som den här teknikenFörlitar sig redan på en elektrofysiologi-rigg för cellfyllningen, kan man använda plåstringsklämma för att identifiera den funktionella responsprofilen för varje cell baserat på dess spikningsmönster. Med hjälp av lätt framkallade spikinspelningar kunde klassificeringen av retinala neuroner bestämmas före cellisolering. Denna teknik arbetar på retinala ganglionceller, men det kan utökas för att undersöka andra retinala neuroner. Det bör emellertid observeras att om detta protokoll används för att typa retina bipolära eller amakrina celler i det inre kärnskiktet, måste man vara försiktig med att ge konstant positivt tryck vid elektrodens spets för att undvika att kontakta celler som Elektroden passerar genom ganglioncellskiktet och det inre plexiformskiktet. För retinala nervceller i det inre kärnskiktet skulle beredningen av retinala sektioner före cellinspelningar fungera bäst för att konsekvent kunna undvika kontaminering. Varje cell skulle isoleras och framställas som beskrivet här efter claSsification steget. Dessutom föreslår vi användningen av detta protokoll för studier av neuroner, men denna teknik kan tillämpas på vilken celltyp som helst som kan morfologiskt karakteriseras eller isoleras genom användning av en transgen modell.

Denna teknik kan också modifieras för att fungera med tidigare framställda cDNA-bibliotek, som vi tidigare har genererat för mikroarray-hybridisering 28 . Med ett separat förberedt bibliotek börjar man med cDNA-kvantiteter inom intervallet 50-150 ng och startar protokollet i steg 8.4; Högre och lägre koncentrationer har inte försökts, även om de kan fungera också. Rening av cDNA med användning av DNA-pärlor skulle ske först, följt av tagmentering och PCR-amplifiering. Vi har testat denna justering med cDNA från bibliotekspreparat, såsom de för mikroarrayhybridisering 29 , och har framgångsrikt producerat tagmenterade bibliotek för RNA-Seq.

FenaAllierat kan detta protokoll användas vid bedömningen av framgången för en särskild induktion av cellpopulationer från inducerade Pluripotenta stamceller (iPSCs). Drivkraften bakom differentiering av dessa omprogrammerade pluripotenta celler är beroende av en förståelse för transkriptionsfaktorerna som leder celltyper att utvecklas separat från varandra. Att köra iPSCs mot specifika cellförluster är en ny metod för att studera neuronal mångfald, eftersom den kan användas för att selektivt generera celltyper. Detta protokoll kan anpassas för att bedöma kvaliteten på mångfalden bland differentierade celler från denna modell. Som tidigare nämnts finns det mer än 30 funktionella subtyper av retinal ganglionceller, och många ansträngningar har gjorts för att generera funktionella RGC från iPSCs. Identifieringen av markörer för subtyper av RGC - i vårt fall, ipRGCs - skulle göra det möjligt för forskaren att utvärdera framgången med deras protokoll för att producera olika subtyper av RGC. Utvärderingen av celltyperBland dessa neuroner skulle gynnas av detta protokoll och kan också fungera som ett verktyg för fortsatt undersökning av subtypsspecifika markörer eftersom detta modellsystem blir lättillgängligt.

I det nuvarande manuskriptet beskriver vi en enkel teknik för isolering och beredning av enskilda celler för transkriptomisk analys. Dessutom föreslår vi sätt att redigera protokollet så att denna teknik kan användas för en mängd experiment med ett antal mål i åtanke. Protokollet som beskrivits här anpassades från ett protokoll som beskrivits av Trombetta et al. 24 som en justering av de rekommenderade kitinstruktionerna för låginmatnings-RNA-Seq. De stora skillnaderna ligger inom cellisolering och olika volymetriska förändringar som vi valt att bäst passa behoven av detta projekt. Det är viktigt att framhäva att det viktigaste steget i detta protokoll är isoleringen av celler från näthinnan. Detta är punkten i protokollet durinG som de flesta fel kan uppstå, och det bör utföras med största försiktighet. Eventuell mängd kontaminering kan resultera i oanvändbara prover, medan förlusten av cytoplasma kan orsaka en allvarlig utarmning av mRNA-molekyler. Detta steg bör utföras med försiktighet och av samma person från experiment till experiment för att säkerställa att proverna har hanterats exakt.

Sammanfattningsvis beskriver detta protokoll en teknik för klassificering, isolering och beredning av celler för högkvalitativ RNA-Seq. Detta är ett effektivt, relativt billigt sätt att optimera kvaliteten på data från enskilda celler. Denna teknik är mångsidig och kan minimeras modifierad för tillämpning på olika studier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

Vi skulle vilja erkänna Jennifer Bair och Einat Snir, liksom University of Iowa Institute for Human Genetics, för deras hjälp vid förberedelser och hantering av prover.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics