L'ARN monocellulaire-séquentiel des sous-ensembles définis des cellules ganglionnaires rétiniennes

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous présentons une approche combinatoire pour classer les types de cellules neuronales avant l'isolement et pour la caractérisation ultérieure des transcriptomes monocellulaires. Ce protocole optimise la préparation d'échantillons pour un séquençage d'ARN réussi (RNA-Seq) et décrit une méthodologie conçue spécifiquement pour une meilleure compréhension de la diversité cellulaire.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La découverte de marqueurs spécifiques de type cellulaire peut donner un aperçu de la fonction cellulaire et des origines de l'hétérogénéité cellulaire. Avec une poussée récente pour une meilleure compréhension de la diversité neuronale, il est important d'identifier des gènes dont l'expression définit diverses sous-populations de cellules. La rétine sert d'excellent modèle pour l'étude de la diversité du système nerveux central, car elle est composée de multiples types de cellules majeures. L'étude de chaque classe majeure de cellules a donné des marqueurs génétiques qui facilitent l'identification de ces populations. Cependant, de multiples sous-types de cellules existent dans chacune de ces principales classes de cellules rétiniennes, et quelques-uns de ces sous-types connaissent des marqueurs génétiques, même si beaucoup ont été caractérisés par une morphologie ou une fonction. Une connaissance des marqueurs génétiques pour les sous-types individuels de la rétine permettrait l'étude et la cartographie des cibles cérébrales liées à des fonctions visuelles spécifiques et pourrait également donner un aperçu des réseaux génétiques quiMaintenir la diversité cellulaire. Les avenues actuelles utilisées pour identifier les marqueurs génétiques des sous-types présentent des inconvénients tels que la classification des types de cellules suite au séquençage. Cela présente un défi pour l'analyse des données et nécessite des méthodes de validation rigoureuses pour s'assurer que les grappes contiennent des cellules de même fonction. Nous proposons une technique pour identifier la morphologie et la fonctionnalité d'une cellule avant l'isolement et le séquençage, ce qui permettra une identification plus facile des marqueurs spécifiques aux sous-types. Cette technique peut être étendue aux types de cellules non neuronales, ainsi qu'à des populations rares de cellules présentant des variations mineures. Ce protocole produit des données d'excellente qualité, car de nombreuses bibliothèques ont fourni des profondeurs de lecture supérieures à 20 millions de lectures pour des cellules individuelles. Cette méthodologie remédie à plusieurs des obstacles présentés par les cellules monocellulaires RNA-Seq et peut être adaptée pour les chercheurs visant à faire connaître les types de cellules d'une manière simple et efficace.

Introduction

La diversité neuronale est observée dans tout le système nerveux central, en particulier dans la rétine des vertébrés, un tissu hautement spécialisé constitué de 1 type de cellules gliaires et 6 neuronales provenant d'une population de cellules progénitrices rétiniennes 1 , 2 , 3 . De nombreux sous-types de cellules peuvent être classés fonctionnellement, morphologiquement et génétiquement. Le but de ce protocole est de lier la variabilité génétique des types de cellules à leurs caractéristiques fonctionnelles et / ou morphologiques identifiables. Un certain nombre de gènes ont été identifiés pour la classification des cellules, mais de nombreux sous-types continuent à ne pas caractériser, car ils représentent une petite fraction de la population globale. L'identification des gènes dans ces sous-types spécifiques permettra une meilleure compréhension de la diversité neuronale au sein de la rétine et peut également éclairer la diversification des cellules neuronales ailleurs. FuDe plus, les études à une seule cellule permettent de découvrir de nouveaux types de cellules, ce qui pourrait avoir été négligé en raison de leur faible représentation parmi la population générale 4 , 5 , 6 , 7 .

L'un des avantages de la transcriptomie monocellulaire est que des marqueurs uniques ou des combinaisons de marqueurs qui définissent un sous-type cellulaire particulier peuvent être découverts. Ceux-ci peuvent ensuite être utilisés pour obtenir un accès génétique à ce type de cellule pour différentes manipulations. Par exemple, nous utilisons ce protocole pour caractériser les gènes spécifiques du type cellulaire d'un sous-ensemble de cellules ganglionnaires rétiniennes qui expriment le photopigment de la mélanopsine. L'utilisation d'un marqueur fluorescent dans des cellules ganglionnaires rétiniennes exprimant la mélanopsine permet d'étudier ces cellules car elles sont regroupées en raison de leur expression d'un gène connu. Fait intéressant, il existe cinq sous-types connus de cette popu cellulaireDans la retine de la souris 8 . Ainsi, pour isoler l'ARN des cellules de chaque type, nous avons utilisé des classifications morphologiques établies dans le modèle transgénique pour identifier chaque sous-type avant l'isolement cellulaire. Cette technique permet la caractérisation des cellules ainsi que leur isolement directement à partir de la rétine, sans nécessiter de dissociation tissulaire, ce qui peut provoquer une réponse au stress dans les cellules et la contamination due à des dendrites coupées 9 .

Une multitude de nouvelles techniques sont apparues au cours des dernières années alors que la méthode RNA-Seq continue de se développer. Ces outils permettent une acquisition maximale des cellules et une plus grande rentabilité tout en abordant la question à l'étude 4 , 7 , 10 , 11 , 12 , 13 . Cependant, pendantCes techniques ont été d'excellents tremplins, il existe un certain nombre d'obstacles encore rencontrés que ce protocole peut traiter. Tout d'abord, bon nombre des procédures actuelles isolent les cellules du tissu dissocié et tentent d'utiliser soit l'analyse des composants principaux, soit le regroupement hiérarchique post-hoc pour déterminer la classification des cellules. S'appuyer sur ces outils pour classer les sous-types peut ne pas produire de résultats fiables et peut forcer l'un à trouver de nouvelles façons de valider ces données pour la corrélation d'un marqueur génétique avec un type de cellule fonctionnelle. L'exigence de dissociation dans d'autres protocoles peut parfois entraîner des lésions tissulaires et peut entraîner la rupture des processus neuronaux, entraînant une perte potentielle d'ARNm. En outre, dans les préparations de cellules dissociées, les réponses au stress peuvent commencer à affecter les transcriptomes de ces cellules 14 . Ce protocole surmonte ces défis en déterminant le type de cellule fonctionnelle avant l'isolement, et il maintient mieux le hLa santé des cellules en gardant le tissu rétinien intact.

Une technique a été introduite en 2014 et consistait en l'analyse in vivo du transcriptome des cellules vivantes 15 . Bien que cette technique permette l'examen du transcriptome avec une rupture mécanique minimale du tissu, il manque la capacité de classer les types de cellules spécifiques dans le tissu avant d'examiner leurs transcriptomes sans utiliser une souris journaliste très spécifique. Notre protocole ne nécessite pas de journaliste spécifique, car nous utilisons le remplissage cellulaire et l'électrophysiologie pour caractériser les cellules avant leur isolement. Une autre limitation de ce protocole précédent est qu'il nécessite une longueur d'onde spécifique pour exciter l'élément photoactivable, alors que notre protocole permet l'utilisation d'un reporter fluorescent et d'un colorant fluorescent, qui sont facilement disponibles ou peuvent être choisis par chaque laboratoire individuellement. Pourtant, d'autres laboratoires ont épousé les deux méthodes de l'électrL'ophysiologie et la transcriptomie pour l'étude de la diversité cellulaire. L'utilisation d'enregistrements patch-clamp pour caractériser la fonction d'une cellule avant son isolement a été réalisée sur des neurones dissociés 16 et, dans certains cas, elle a précédé l'utilisation de l'analyse par microarrays 17 pour ces études. Les mêmes complications sont rencontrées par ces approches, car elles nécessitent une dissociation des tissus ou l'utilisation de la technologie des microarray, qui repose sur l'hybridation des échantillons sur les sondes disponibles. L'un des progrès les plus récents a été le développement de Patch-Seq, une technique qui combine l'utilisation des enregistrements de patch-clamp et de la technologie RNA-Seq pour comprendre les cellules des tranches de cerveau entier 18 . Bien que cette technique ait ses similitudes avec le protocole présenté ici, il est à nouveau important de noter que notre approche permet au tissu de rester intact pour la santé des cellules. Ici, nous présentons un protocole pour l'optimisationDe cette alliance, qui génère des bibliothèques à une seule cellule de haute qualité pour l'utilisation d'ARN-Seq pour obtenir une profondeur de lecture et une couverture de cartographie élevées.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les procédures ont été approuvées par le Comité institutionnel pour les soins et l'utilisation des animaux (IACUC) à l'Université Northwestern.

1. Préparation de solutions pour électrophysiologie (4 h)

  1. Faire 0,1% d'H 2 O traité par DEPC en ajoutant 1 ml de pyrocarbonate de diéthyle (DEPC) à 999 ml d'H 2 O purifié par ósmosis inverse. Mélanger soigneusement et laisser le mélange incuber pendant 1 h à température ambiante (RT). Ensuite, autoclavez le H 2 O mélangé à DEPC pendant 15 minutes sur un cycle liquide. Laisser refroidir le H 2 O traité par DEPC à TA.
  2. Effectuez la solution extracellulaire en mélangeant une bouteille de milieu Ames et 1,9 g (23 mM) de bicarbonate de sodium dans 1 L de H 2 O. Bulle la solution extracellulaire avec
    95% O 2 /5% de CO 2 et le maintenir à un pH de 7,3-7,4.
  3. Générer la solution intracellulaire en combinant 125 mM de K-gluconate, 2 mM de MgCl2, 10 mM d'EGTA, 10 mM de HEPES et 0,1% de DEPC traité H2 O. Conservez-le dans des portions aliquotes de 1 ml à -20 ° C. Ajouter 10 μM de traceur fluorescent au début de chaque expérience.
  4. Effectuer une solution enzymatique en ajoutant 10 000 unités de collagénase et 83 mg d'hyaluronidase à 4,15 ml de solution extracellulaire. La solution enzymatique doit être stockée dans des aliquotes de 50 μL à -20 ° C.

2. Préparation du tissu rétinien (2 h)

REMARQUE: Toutes les procédures de cette section doivent être effectuées sous un éclairage rouge foncé

  1. Adaptez les animaux au soleil pendant au moins 1 heure avant la dissection. Effectuez toutes les procédures sous un éclairage rouge foncé.
  2. Éuthaniser les animaux par asphyxie au CO 2 et enucleer les globes oculaires dans une boîte de Petri avec une solution extracellulaire préalablement oxygénée.
  3. Pousser la cornée avec une aiguille et la couper en couper avec des ciseaux ophtalmiques à la limite de la cornée et de la sclérotique 19 .
  4. Retirez l'objectif en utilisantPince # 5. Faites doucement dans la sclérotique avec la pince et séchez le nerf optique où la rétine et la scléro se rencontrent. Finissez soigneusement d'enlever la sclérotique de la rétine.
  5. Retirez le vitreux transparent en utilisant des pince # 5; Une fois éliminé, le vitré apparaît comme une substance gélatineuse collée à la pince. Couper les rétines en deux (de sorte qu'il y ait 4 pièces / animal) et les stocker dans une solution extracellulaire oxygénée à la température ambiante jusqu'à l'utilisation.
  6. Lorsqu'il est prêt à monter le tissu dans la chambre d'enregistrement, placez un morceau de rétine pour incuber dans une solution enzymatique diluée dans 500 μl de solution extracellulaire oxygénée. Incuber dans une boîte de Petri pendant 2 min à la température ambiante sur un agitateur.
    1. Laver le morceau de rétine dans une solution extracellulaire oxygénée et placer le tissu dans une chambre d'enregistrement en verre; Utilisez une pipette de transfert en plastique avec la pointe coupée pour permettre la transfert de la rétine sans endommager le tissu.
  7. Utiliser pourPour aplatir soigneusement le tissu avec la couche de photorécepteur vers le bas. Retirer l'excès de liquide à l'aide d'une pipette. Ancrez le tissu en utilisant un anneau en platine avec un filet en nylon.
    NOTE: Ce procédé pourrait également être utilisé pour préparer le tissu pour l'isolement de l'ARN à partir de cellules amacrines et bipolaires marquées.
  8. Remplissez la chambre avec une solution extracellulaire oxygénée et montez-la sur un microscope. Tissus de perfusion avec une solution extracellulaire oxygénée à 2-4 mL / min.

3. Visualisation et ciblage des cellules Ganglion rétiniennes GFP + (10 min)

REMARQUE: Toutes les procédures de cette section doivent être effectuées sous un éclairage rouge foncé

  1. Avant de commencer, tirer des micropipettes en verre (OD: 1,2 mm, ID: 0,69 mm) pour les enregistrements électrophysiologiques à l'aide d'un extracteur à micropipettes. Utilisez le protocole suivant pour les électrodes (notez que les paramètres doivent être ajustés en conséquence pour obtenir la résistance souhaitée etVarient entre les extracteurs et avec un verre différent): Chaleur: Rampe +10; Tirer: 0; Vel: 23; Retard: 1; Pression: 500; Boucle du programme: 5 fois. Assurez-vous que les pointes ont un diamètre de ~ 1 μm, avec des résistances de 2-4 MΩ pour cibler de grandes cellules et de 5-7 MΩ pour cibler des cellules plus petites.
  2. Observez la couche de cellules ganglionnaires à l'aide de l'optique infrarouge à contraste différentiel (IR-DIC) ( Figure 1A ). Identifiez GFP + Cellules de ganglion rétiniennes (RGC) en utilisant une épifluorescence (~ 480 nm) ( Figure 1B ).
  3. Localisez la pipette remplie de solution intracellulaire dans DIC. Appliquer une légère pression positive et ne pas compenser aucun décalage de tension sur l'amplificateur.
  4. Appuyez sur la micropipette en verre contre une cellule GFP + et appliquez une pression négative pour former un joint d'étanchéité GΩ entre la pipette et la membrane cellulaire. Appliquer les étapes de commande de la tension d'essai ( p. Ex., 5 mV) pour surveiller la résistance du joint. Après avoir formé un joint stable, rompre la membrane en appliquant de courtes impulsions de nPression négative pour obtenir l'accès de cellules entières.
  5. Attendez 1-2 minutes pour que les dendrites de la cellule se remplissent avec un traceur fluorescent.
    NOTE: La cellule peut être typée morphologiquement en examinant la morphologie dans l'épifluorescence ( figure 1C ). Dans le cas des RGC exprimant la mélanopsine, la stratification dendritique dans la couche plexiforme interne est visualisée en examinant les dendrites remplies de traceurs fluorescents sous l'illumination épifluorescente et en déterminant qu'elles se stratifient loin du soma dans la sublamina OFF (M1 ipRGC), près du ganglion Couche de cellule dans la SO sublamina (M2 et M4 ipRGC), ou les deux (M6 ipRGC). Cette observation, combinée à la taille du soma (M4s ont des somas nettement grandes par rapport à tous les autres sous-types d'ipRGC), permettent d'identifier les cellules de type 20 , 21 , 22 . Ainsi, cette technique permet d'identifier le type de cellule in vitro avant l'iso d'ARNLation. Cette méthode pourrait être modifiée pour d'autres protocoles d'identification de type cellulaire impliquant soit une morphologie dendritique soit une physiologie cellulaire.

4. Isolation cellulaire (2 min)

  1. Avant de commencer, réglez la microcentrifugeuse de table sur 2 000 x g. Préparez un appareil d'expulsion d'échantillons en connectant le tube (OD: 3/32 in, ID: 1/32 in) avec une seringue de 1 cc.
  2. Placer des tubes PCR de 0,2 ml contenant 10 μL de tampon de lyse et 1% de β-mercaptoethanol sur de la glace. Préparez une seringue de 1 cc contenant de l'H 2 O traité par DEPC pour rincer les pointes de pipette. Préparer un récipient de glace carbonique pour congeler le tampon de lyse après la collecte des échantillons.
  3. Extraire soigneusement le contenu cytoplasmique de la pipette cellulaire en appliquant une pression négative à l'aide d'une seringue de 10 ml; Tout le contenu cytoplasmique, y compris les organites, devrait être extrait si possible.
    1. Surveillez l'extraction dans DIC en visualisant le corps de la cellule en diminution de taille. Après extraction Le contenu cytoplasmique, soulevez la pipette soigneusement du tissu et retirez rapidement la pipette de la solution.
  4. Retirez rapidement la pipette du support de la tête et rincez rapidement la pointe de la pipette avec de l'H 2 O traité par DEPC en utilisant une seringue de 1 ml. Connectez la pipette à une seringue de 1 ml par un tube serré pour expulser l'échantillon.
  5. Immédiatement expulser les cellules dans 10 μl de tampon de lyse 1 contenant 1% de β-mercaptoethanol dans des tubes de PCR de 0,2 ml.
    REMARQUE: L'aspiration complète avec les cellules doit être expulsée doucement afin de ne pas introduire de bulles.
    1. Centrifuger brièvement le tube dans une mini centrifugeuse de table à 2 000 xg pendant 10 s. Immédiatement gelé les échantillons pendant 5 minutes sur de la glace carbonique. Après la congélation, rangez-les à -80 ° C pendant jusqu'à deux semaines pour obtenir les meilleurs résultats; Les échantillons peuvent durer plus longtemps, mais il est recommandé qu'ils soient traités aussi rapidement que possible.
E "> 5. Purification de l'ARN (30 min)

  1. Avant de commencer, configurez un dispositif de séparation magnétique en tapant la partie supérieure d'un support de pointe P20 ou P200 inversé sur le support magnétique à 96 puits 23 .
  2. Préparez 70% d'éthanol frais (EtOH) - environ 1 mL par échantillon sera suffisant. Retirez les billes magnétiques de l'ARN d'un stockage de 4 ° C et les décongeler à la température ambiante pendant au moins 30 minutes.
    REMARQUE: Pas plus de 8 échantillons doivent être traités en même temps, autant de mesures dans ce protocole dépendent de l'efficacité et de la manipulation rapide.
  3. Une fois que les perles magnétiques sont à la RT, tourbillonner pendant 30 s pour s'assurer que la solution est bien mélangée.
    REMARQUE: Les perles utilisent un tampon spécifique à l'ARN pour se lier sélectivement à l'ARN, et ils permettent d'enlever d'autres déchets cellulaires lorsqu'ils sont utilisés avec un support de plaque magnétique.
  4. Décongeler les cellules à la température ambiante pendant 1 min, puis ajouter 5 μL de H 2 O sans RNase à chaque échantillon; Pipette haut et bas. Ajouter 22 μL de perles d'ARN à chaque tube et pipetteBien mélanger. Incuber les échantillons à la RT pendant 5 minutes pour permettre à l'ARN d'interagir et de se lier avec les perles magnétiques.
  5. Placez les tubes sur un séparateur magnétique et laissez reposer pendant 8 min; Avant de procéder, assurez-vous que le surnageant est clair. Observez les perles d'une pastille et assurez-vous de ne pas la détacher pendant le pipetage.
  6. Retirer le surnageant des échantillons et ajouter 150 μL d'EtOH à 70%. Retirez l'EtOH et répétez le lavage deux fois plus.
  7. Laisser sécher les échantillons pendant 6 min. Vérifiez de façon intermittente pour voir si plus d'EtOH a été collecté au bas du tube. Retirez-le en conséquence.
  8. Pendant que les échantillons sont en train de sécher, préparer un tampon de réaction 10X en combinant 19 μL de tampon de lyse 2 et 1 μL d'inhibiteur de RNase (40 U / μL). Tournez-le brièvement vers le bas et gardez-le sur la glace.
  9. Une fois que les échantillons sont secs et que les pastilles de talons n'apparaissent plus brillantes, retirez les tubes du séparateur magnétique et ajoutez 9,5 μL de H 2 O exempt de RNasePour réhydrater les échantillons. Placez les échantillons sur de la glace et ajoutez 1 μL de 10x de tampon de réaction à chaque échantillon.

6. Transcription inverse (10 min)

REMARQUE: Avant de commencer, décongeler les réactifs nécessaires pour la transcription inverse (RT, à l'exception de l'enzyme) sur la glace. Ceux-ci comprennent: l'amorce II, le tampon 1, l'oligonucléotide et l'inhibiteur de la RNase.

  1. À chaque tube, ajouter 2 μl d'amorce II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1 N, pour lequel N- 1 peut être A, C ou G et N peuvent être A, C, G ou T; 12 μM). Placer les tubes dans un thermocycleur préchauffé à 72 ° C pendant 3 min.
  2. Pendant l'incubation, préparer le mélange maître RT. Pour chaque réaction, ajouter 4 μL de tampon 1 (Tris-HCl 250 mM, pH 8,3, KCl 375 mM et 30 mM de MgCl2), 1 μL d'oligonucléotide (48 μM) et 0,5 μL d'inhibiteur de RNase (40 U / ΜL).
  3. Immédiatement après l'incubation, placez les tubes surGlace pendant 2 min.
  4. Ajouter 2 μl par réaction de la transcriptase inverse (100 U / μL) au mélange maître et à la pipette à fond. Ajouter 7,5 μL de mélange maître à chaque tube et mélanger par pipettage doux. Tournez brièvement les tubes pour collecter le contenu en bas et placez-les dans un thermocycleur préchauffé avec le programme suivant: 42 ° C pendant 90 min, 70 ° C pendant 10 minutes et une prise à 4 ° C.
  5. Stockez les tubes à -20 ° CO / N avant de procéder, bien qu'il soit recommandé que les échantillons soient transportés à travers l'étape d'amplification avant d'être conservés pendant de longues périodes; D'autres sources suggèrent que le stockage O / N à 4 ° C serait également acceptable à cette étape 24 .

7. Amplification d'ADNc (2,5 h)

REMARQUE: Avant le début, décongéler le tampon de PCR et l'amorce de PCR sur la glace et faire tourner les tubes dans une mini centrifugeuse de table avant de préparer le mélange de maître PCR.

  1. Pour chaque réaction, pRéparer un mélange de maître de PCR contenant 25 μL de tampon de PCR, 1 μL d'amorce de PCR (12 μM), 1 μL d'ADN polymérase et 3 μl d'H 2 O libre de nuclease. Ajouter l'ADN polymérase en dernier, juste avant l'addition De mélange maître aux échantillons.
  2. Ajouter 30 μL de mélange maître à chaque tube et tourner à 2 000 xg pendant 10 s pour collecter le contenu au bas des tubes.
  3. Placer les tubes dans un thermocycleur préchauffé avec le programme suivant: 95 ° C pendant 1 min; 34 cycles de 98 ° C pendant 10 s, 65 ° C pendant 30 s et 68 ° C pendant 3 min; 72 ° C pendant 10 min; Et une prise à 4 ° C.
    REMARQUE: Le nombre de cycles pour cette PCR a été augmenté à 34, ce qui diffère des instructions suggérées par le fabricant. Après le test répété, ce nombre de cycles a été trouvé pour produire des résultats toujours fiables.
  4. Conservez les tubes à -20 ° C pendant un an avant de continuer.

8. Purification du cDN amplifiéA (30 min)

  1. Avant de commencer la purification, amener les grains d'ADN et le tampon d'élution à la RT pendant au moins 30 minutes. Préparer 80% d'EtOH frais; 1 ml par échantillon devrait suffire. Ajouter 1 μL de tampon de lyse 10X à chaque échantillon.
  2. Vortez les perles d'ADN pendant 30 s et ajoutez 50 μL de billes d'ADN à chaque échantillon. Mélanger soigneusement par pipettage, puis tourner brièvement vers le bas à 2 000 xg pendant 10 s. Incuber les tubes à la RT pendant 8 min.
  3. Placez les tubes sur le dispositif de séparation magnétique pendant 5 min. Pipeter délicatement le surnageant en haut et en bas deux fois et laisser les échantillons s'asseoir pendant 2 min. Alors que les échantillons sont sur le dispositif magnétique, enlever le surnageant et le jeter.
  4. Ajouter 150 μL de 80% d'EtOH fraîchement préparé à chaque échantillon et leur permettre de s'asseoir à la température ambiante pendant 30 s. Retirez l'EtOH et répétez le lavage à l'EtOH une fois.
  5. Tourner brièvement les échantillons et les remettre sur le séparateur magnétique pendant 1 min. Retirez l'EtOH restant et laissez les échantillons sécher à l'air pendant 5 minutes.
  6. Une fois que la pastille de perles ne semble plus brillant, mais avant que les fissures ne commencent à apparaître, retirez le tube du séparateur magnétique et ajoutez 17 μl de tampon d'élution. Faites pipeter doucement et vers le haut pour réinstaller complètement les perles.
  7. Incuber les échantillons remis en suspension à la température ambiante pendant 2 min.
  8. Tournez brièvement les échantillons pour collecter tous les liquides au fond et placez-les sur le séparateur magnétique pendant 2 min. Transférer 15 μL de surnageant clair à un tube sans RNase de 1,5 mL et stocker à -20 ° C.
  9. Examinez la qualité et la taille de la banque d'ADNc avec une puce de bioanalyseur à haute sensibilité en utilisant 1 μl d'ADNc. La taille idéale d'une bibliothèque d'ADNc est de 0,3 à 2, Kb, avec une concentration d'au moins 10 ng / μL ( Figure 2 ).
    REMARQUE: Vous pouvez choisir d'utiliser la PCR comme moyen d'échantillonner des échantillons afin d'assurer l'expression de marqueurs connus avant de passer à l'exemple prLa réparation.

9. Déterminer les concentrations et l'ADNc du tag (20 min)

  1. Avant de commencer, amener le réactif de dosage, le tampon de dilution et les normes à la température ambiante pendant 30 minutes. Préparer un mélange maître contenant 1 μL de réactif de dosage et 199 μL de tampon de dilution par réaction. Aliquoter 199 μL de ce mélange dans 500 μL de tubes de dosage. Ajouter 1 μl d'échantillon et bien mélanger.
  2. Aliquote 190 μL de mélange maître au tube 1 et 2. Ajouter 10 μL de norme 1 à tube 1 et 10 μL de norme 2 à tube 2. Vortex tous les tubes à échantillon et tubes standard pendant 5 s; Incuber à la RT pendant 3 min.
  3. Déterminer la concentration des échantillons avec un fluorimètre à haute sensibilité. Assurez-vous que le montant correct de l'échantillon a été entré en sélectionnant l'option "calculer la solution stock" et mettre en surbrillance "1 μL". Diluer chaque échantillon dans un tube séparé de 1,5 ml jusqu'à une concentration finale de 0,2 ng / μL dans H 2 O sans RNase.
    REMARQUE:Alors que les instructions du fabricant suggèrent que l'on devrait commencer par 1 ng / μL de total d'ADN, nous avons utilisé un montant de départ plus petit et avons également ajusté le protocole pour tenir compte de cette modification.
  4. Dans de nouveaux tubes de PCR de 0,2 ml, pipettez 2,5 μl de tampon 2. Ajoutez 1,25 μl d'ADNc au tube approprié pour un total de 250 pg. Enfin, ajouter 1,25 μl de mélange de tagmentation à chaque tube et bien mélanger pour bien mélanger; La transposase dans le mélange de tagmentation fragmentera l'ADN en brins courts et recuit les adaptateurs à chaque extrémité de chaque brin, pour une utilisation ultérieure par l'instrument de séquençage.
    REMARQUE: les volumes utilisés pour le marquage et le couplage d'index sont une fraction du montant suggéré par les instructions du fabricant. Cela permet non seulement de conserver les réactifs, mais aussi de produire des échantillons à l'aide d'un marqueur constamment dans notre expérience.
  5. Centrifuger les tubes sur une microcentrifugeuse de comptoir pendant 1 min.
  6. Placez les tubesDans un thermocycleur préchauffé avec le programme suivant: 55 ° C pendant 10 min et une prise à 10 ° C.
    NOTE: La durée de cette incubation est de 10 minutes, par opposition aux 5 minutes proposées par les instructions du fabricant.
  7. Immédiatement après la fin de ce programme, retirez les tubes et ajoutez 1,25 μl de tampon neutralisant de tagmentation à chacun. Pipettez bien pour mélanger et incuber à la RT pendant 5 min. Complétez cette étape rapidement, car la transposition reste active jusqu'à ce que le tampon neutralise l'enzyme et arrête la réaction.

10. Couplage et purification de l'indice (1 h)

REMARQUE: Avant le début, amener les billes d'ADN et le tampon de ré-suspension à la RT pendant au moins 30 minutes. Décidez quels indices utiliser pour chacun des échantillons.

NOTE: Ces indices seront attachés aux extrémités 5 'et 3' respectives de l'ADN fragmenté pour l'identification des échantillons après le séquençage. Assurez-vous qu'aucun deuxLes jumelages sont les mêmes pour les échantillons qui peuvent être séquencés ensemble. Par exemple, si l'échantillon 1 utilise des indices blancs 1 et orange 1, l'échantillon deux doit utiliser le blanc 1 et l'orange 2 ou le blanc 2 et l'orange 2, mais jamais la même combinaison d'indices. Ce kit contient 4 indices distincts en blanc et 6 indices distincts. Toutes les différentes combinaisons possibles permettent de rassembler jusqu'à 24 échantillons dans une voie de séquençage. Même si nous ne regroupons généralement que 10 échantillons dans une voie, on pourrait également utiliser le kit contenant 24 indices, ce qui permettrait de regrouper 96 échantillons dans une seule voie de séquençage, si désiré.

  1. À chaque tube, ajouter 1,25 μL de l'indice gauche et 1,25 μL de l'index droit pour cet échantillon spécifique. Ajouter 3,75 μL de mélange maître PCR et bien mélanger pour bien mélanger.
  2. Centrifuger dans une microcentrifugeuse de comptoir pendant 1 min.
  3. Placer les tubes dans un thermocycleur préchauffé avec le programme suivant: 72 ° C pendant 3 min; 95 ° C pendant 30 s; 12 cycles de 9576; C pendant 10 s, 50 ° C pendant 30 s et 72 ° C pendant 1 min; 72 ° C pendant 5 min; Et une prise à 4 ° C.
    REMARQUE: La première étape de 95 ° C a été changée de 98 ° C, ce qui a été suggéré par les instructions du fabricant. En outre, les détails du cycle ont été ajustés de manière à ce que les températures et les longueurs de temps permettent une indication optimale de nos échantillons. L'incubation finale de 72 ° C a également été ajoutée à notre protocole et n'a pas été incluse dans les instructions du fabricant.
  4. Tournez brièvement les tubes pour collecter le contenu en bas. Vortez les perles d'ADN pendant 30 s, puis ajoutez 30 μL à chaque tube et mélanger soigneusement par pipettage.
  5. Incuber les échantillons à la température ambiante pendant 5 min.
  6. Placez les échantillons sur un séparateur magnétique pendant 2 min. Pipettez le surnageant vers le haut et vers le bas deux fois et incubez les échantillons pendant 1 min.
  7. Retirer et jeter le surnageant transparent. Ajouter 150 μL de 80% d'EtOH à chaque échantillon et enlever. Répétez le lavage au EtOH une fois.
  8. Permettez-leE échantillons pour sécher à l'air pendant 10 min. Vérifiez de façon intermittente pour voir si un EtOH a recueilli au bas des tubes et retirez si nécessaire.
  9. Une fois qu'une fissure commence à apparaître dans la pastille de cordon d'ADN, retirez l'échantillon du séparateur magnétique et ajoutez 27,5 μL de tampon de ré-suspension pour réhydrater la pastille. Assurez-vous que la pastille est complètement remis en suspension, puis incubez à TA pendant 2 min.
    REMARQUE: Le volume utilisé pour le tampon de remise en suspension a été modifié pour tenir compte de la quantité de matériau de départ plus petite dans notre protocole et diffère du volume suggéré dans les instructions du fabricant.
  10. Placez les tubes sur le séparateur magnétique pendant 2 min. Transférer 25 μL de surnageant clair dans un tube sans RNase et stocker à -20 ° C.
    REMARQUE: Ne procédez pas aux instructions du fabricant pour compléter la normalisation de la bibliothèque. Les échantillons sont préparés avec succès après cette étape et sont préparés pour le séquençage tel quel.
  11. Analyser le tAgglomération des échantillons en utilisant une puce de bioanalyseur et 1 μL de chaque échantillon.
    NOTE: L'analyse des frottis sera effectuée comme précédemment; Cependant, l'ADNc doit maintenant être détecté à une taille de 0,2-1 Kb ( Figure 3 ). Les frottis inférieurs à ce point représentent vraisemblablement la dégradation des échantillons, tandis que les frottis plus gros suggèrent une étiquetage incomplet.

11. Mise en commun des échantillons (10 min)

  1. Obtenir des concentrations d'échantillons de tagmentation avec le fluoromètre à haute sensibilité plus tôt et déterminer la concentration en nM.
    REMARQUE: Ce calcul peut être calculé avec l'utilisation d'un outil de conversion Internet et repose sur la longueur moyenne des fragments de la trace du bioanalyseur. Pour déterminer la longueur moyenne des fragments, observer la trace pour chaque échantillon individuellement et déterminer la taille du fragment d'ADN moyen. Cela peut également être calculé lors de l'examen de la trace du bioanalyseur en mettant en évidence la portée du frottis et en examinantE molarité calculée par le programme.
  2. Combinez les échantillons de telle sorte que la piscine contienne la même concentration de chaque échantillon. Ne pas diluer les échantillons; La piscine devrait être aussi diluée que l'échantillon le plus concentré et aurait idéalement une concentration totale d'au moins 15 nM.
  3. Conserver les échantillons groupés à -20 ° C avant le séquençage; Il est suggéré que les échantillons soient séquencés dans les 1 semaine suivant la mise en commun. Effectuez un séquencement de 100 paires avec une plate-forme HiSeq.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Les types de cellules sont facilement classés à la suite de l'injection de colorant

La figure 1 montre un exemple de GFP + RGC avant et après le remplissage du traceur fluorescent. Cette cellule a été identifiée en fonction de son expression de GFP dans la ligne transgénique ( figure 1A ). Une étanchéité étroite a été formée avec une électrode de verre à pointe fine sur le soma de cette cellule. Afin de caractériser le sous-type, le colorant fluorescent a été injecté dans le soma et a permis de remplir tous les processus associés ( figure 1B ). La classification en tant que M4 ipRGC a été activée par l'observation que cette cellule a un très grand soma et que ses processus se terminent dans la sublamina ON de la couche plexiforme interne ( Figure 1C ). À titre d'illustration des différences de stratification qui peuvent être discernées dans une préparation rétinienne isolée, nous avons rempli M1 (OFF-stratificationG), M3 (bistratifié), et M4 (ON-stratifying) ipRGC avec un traceur fluorescent, les a réparé et effectué l'imagerie confocal des ONT et OFF sublaminae ( Figure 1D ). Cette visualisation des dendrites par imagerie confocal est très similaire à la façon dont les dendrites se retrouvent dans un tissu in vitro non fixé lorsque les cellules sont remplies d'un traceur fluorescent (Schmidt et Kofuji 2009, 2010 et 2011).

Bibliothèques d'ADNc à partir de cellules individuelles

L'utilisation d'une amorce Oligo d (T) permet la transcription inverse sélective et l'amplification de l'ARNm. Après avoir généré et amplifié les bibliothèques d'ADNc de chaque cellule, des puces de bioanalyseur ont été utilisées pour évaluer la qualité et la taille des bibliothèques. Les résultats de cette analyse montrent que les frottis d'ADNc idéaux sont de 0,5 à 2 Kb dans un bon échantillon ( figure 2A ). Certains échantillons montrent quelques bandes ou frottis sous la marque de 300 pb, suggèrentEn estimant que ces bibliothèques sont de mauvaise qualité (voir le tableau 1 pour le dépannage). Un exemple d'une trace de bioanalyseur de bonne qualité montre peu ou pas de bandes d'ADN inférieures à 300 pb et un frottis robuste entre 500 pb et 2 Ko (figure 2B). Les voies de contrôle vides devraient afficher les marqueurs inférieurs et supérieurs à 35 et 10380 pb, respectivement, ainsi qu'une ligne de base stable qui ne fluctue pas. Diverses bibliothèques peuvent produire des données de qualité, comme le montrent les deux Figure 2B et 2C , ce qui a produit d'excellentes profondeurs de lecture et des taux de cartographie élevés. Seuls les échantillons avec des bibliothèques d'ADNc puissantes de la taille attendue doivent être transmis à la tagmentation (voir le tableau 1 pour le dépannage).

L'étiquetage à faible entrée prépare des échantillons de haute qualité pour le séquençage

Ce protocole est optimisé pour la tagmentation avec une quantité mineure de matière de départ L. Juste 250 pg fonctionne le mieux pour une étiquetage réussie, car les quantités inférieures ne s'amélioreront pas correctement et les quantités plus élevées ne se fragmenteront pas complètement. Après avoir terminé la balisation et l'amplification par PCR / nettoyage de l'échantillon, les échantillons ont encore été analysés sur une puce de bioanalyseur. Les frottis d'ADNc idéaux à ce stade devraient être de 0,2-1 Kb ( Figure 3A ). La trace devrait apparaître lisse et uniformément répartie entre ces deux tailles ( Figure 3B ); Cette trace correspond à l'échantillon dans la voie 1. La figure 3C montre une étiquetage incomplet, qui peut être résolu facilement (voir le tableau 1 pour le dépannage). Nous avons effectué une analyse des données sur les échantillons et avons constaté que ce protocole a produit des échantillons avec d'excellentes profondeurs de lecture, dépassant souvent 12 millions de lectures par échantillon; Moyennes de cartographie de 69,1%; Et plus de 5 000 gènes exprimés.

/55229fig1.jpg "/>
Figure 1: Identification des types de RGC basés sur l'expression des GFP dans les IPRGC exprimant la mélanopsine et sur les propriétés morphologiques. ( A ) La couche de ganglion-cellule de la rétine, visualisée en utilisant IR-DIC dans la préparation de la rétine à montage intégral. ( B ) La même préparation a été visualisée en épifluorescence (~ 480 nm) pour identifier les cellules ganglionnaires exprimant la GFP. ( C ) Une cellule exprimant GFP ciblée pour l'enregistrement de patch-clamp et remplie d'un traceur fluorescent. La cellule peut être identifiée comme un ipRGC M4 en fonction de sa très grande taille de soma et de ses dendrites stratifiantes 25 , 26 . ( D ) Image confocale des dendrites ipRGC imagées dans la sous-chaîne ON et / ou OFF de l'IPL (M1), dans la sous-sublimation ON de l'IPL (M4) et dans les sous-stations ON et OFF de l'IPL (M3). IR-DIC: contraste d'interférence différentiel infrarouge..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Cliquez ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Analyse de la qualité de la bibliothèque d'ADNc avec une trace de bioanalyseur. ( A) Exemple de sortie de bioanalyseur pour plusieurs échantillons qui ont été transcrits inverse, amplifié et purifié. Les lignes 1-3 montrent les frottis d'ADN idéaux, avec la majorité de l'ADN supérieur à 300 pb. Les bibliothèques avec frottis dans cette gamme ont toujours fourni d'excellentes données de séquençage, montrant une moyenne de 5 683 gènes exprimés par cellule. La voie 4 représente un échantillon qui a été traité sans succès et n'a donc pas produit d'ADNc. La voie de contrôle réussie a une ligne de base constante et deux pics propres à 35 et 10 380 pb. ( B ) Exemple d'une trace réussie de bioanalyseur avec une forte intensité d'ADNc d'environ 2 Kb. Ce s Mear correspond à l'échantillon dans la voie 1. ( C ) Exemple d'une trace de bioanalyseur réussie avec l'ADNc centré autour de 500 pb. Cette trace correspond à l'échantillon dans la voie 3. Cliquez ici pour voir une version plus grande de cette figure.

figure 3
Figure 3: échantillons étiquetés montrent des frottis robustes entre 0,2 et 2 Kb. ( A ) Un exemple représentatif de la sortie du bioanalyseur après la validation, l'amplification et le nettoyage de la PCR. ( B ) Trace d'un échantillon validé avec succès correspondant à la voie 1 dans (A). ( C ) Exemple de trace pour un échantillon avec une étiquetage incomplet, effacer par l'intensité maximale d'environ 1 Kb."> Cliquez ici pour voir une version plus grande de ce chiffre.

2 "> Diluer l'échantillon à une concentration de 0,4 ng / μL et ranger l'étiquetage
Problème Cause possible Solution
Étape 3.3) Impossible de former un joint d'étanchéité GΩ La surface de la cellule n'est pas assez propre Nettoyer davantage en utilisant une pression positive
Étape 3.3) La cellule semble dégonfler / mourir Préparez une nouvelle pipette et ciblez une nouvelle cellule
Étape 3.4) Impossible de déterminer l'emplacement terminal des dendrites Alexafluor n'a pas eu assez de temps pour se diffuser à travers la cellule ou la concentration d'Alexafluor n'est pas assez élevée Assurez-vous que le gain et le temps d'exposition sur la caméra sont suffisamment élevés. Attendez 5 minutes supplémentaires avant de visualiser les dendrites. Si les dendrites ne sont toujours pas visibles, préparez une solution avec Alexafluor plus élevéconcentration.
Étape 4.1) Impossible d'aspirer tout le cytoplasme
Étape 5.5) Le surnageant n'est pas clair après 8 minutes Pipetter doucement la solution entière deux fois, tout en restant sur le séparateur magnétique, et laisser reposer pendant encore 5 minutes
Étape 5.5) La pastille se disperse pendant le pipetage L'échantillon est trop loin de l'aimant Gardez les tubes sur le dispositif de séparation magnétique pendant toute la pipetage. Expulser la solution et permettre aux perles de rallonger pendant 5 minutes
Étape 5.7) Après 5 minutes, les échantillons apparaissent toujours brillants La quantité maximale d'EtOH n'a pas été supprimée Continuer à surveiller les échantillons pendant le séchage. Toutes les 2 minutes, utilisez une pipette P10 et retirez tous les EtOH au fond du tube
Étape 8.9) La pastille a eu des fissures avant la réhydratation Autoriser l'échantillon à réhydraterTaux pour un total de 4 min, plutôt que 2 (étape 8.10)
Étape 8.11) Une petite quantité de bourrelet a été élevée avec un surnageant Éjecter l'échantillon entier dans le tube et le placer sur le séparateur magnétique pendant 1 min; Faites pipeter doucement et assurez-vous d'éviter la pastille
Étape 8.12) Les frottis d'ADN sont incohérents et l'échelle de fluorescence change continuellement Concentration d'ADN trop élevée pour une puce HS Vérifier la concentration de l'échantillon et diluer entre 1 à 10 ng / μL. Réexaminer le bioanalyseur
Étape 8.12) Frottis à faible poids moléculaire Dégradation de l'ARN Assurez-vous de clignoter la cellule immédiatement après la collecte. Jeter cette bibliothèque d'ADNc
Étape 8.12) Ligne de référence du marqueur flottant dans la voie de contrôle Contamination ou réactif ancien Jeter le marqueur d'ADN et utiliser un nouveau tube pour un essai de bioanalyseur
Étape 8.12) Pas de frottis d'ADN Défaut d'expulser la cellule Retirer de nouvelles aiguilles avec une pointe légèrement plus grande
Échec du cordon ARN Assurez-vous que les perles ont été complètement remises en suspension avant leur utilisation et permettent aux échantillons d'incuber avant de placer sur le séparateur magnétique
Étape 8.12) Faible frottis d'ADN Pas assez d'amplification Employer plus de cycles de PCR
Étape 8.12) frottis d'ADN en dehors de la plage de 500bp-2Kb Les frottis d'ADN inférieurs à 0,5 et au-dessus de 2 Kb sont probablement contaminés. Jeter l'échantillon
Étape 8.12) Pointes régulièrement espacées sur trace d'ADN Contamination de l'échantillon Toujours porter des gants frais et fabriquer de l'éthanol neuf pour les rinçages; Les conseils de filtre devraient être utilisés en tout temps
Étape 9.3) Impossible de détecter la concentration de l'échantillon sur le fluoromètre Les échantillons au-dessous du niveau de détection ont trop peu d'ADN pour la marquage et ne peuvent être utilisés
Étape 10.10) Les échantillons ne sont pas secs après 10 min Continuer à éliminer l'EtOH en excès Autoriser les échantillons à dépasser plus longtemps, les vérifier chaque minute
Étape 10.13) frottis inclinés vers 2Kb Fragmentation incomplète Ré-diluer l'échantillon à une concentration de 0,15 ng / μL, plutôt que de 0,2 ng / μL; Réexécuter l'étiquetage
Étape 10.13) frottis faussés vers 200 pb Trop peu d'entrée d'ADN Diluez moins l'échantillon, essayez une concentration de 0,4 ng / μL; Réexécuter l'étiquetage
Réaction de la tagaison trop longue Réduire le temps de réaction de la tagmentation à 8 minutes
Étape 10.13) frottis faibles Amplification inappropriée de l'ADN
Étape 11.2) La concentration maximale admissible du pool est inférieure à 5 nM Identifiez quel (s) échantillon (s) ont des concentrations significativement faibles et réexécutez le tagmentation avec une nouvelle dilution

Tableau 1: Solutions et suggestions pour les compromis potentiels dans le protocole. Ce tableau énumère les difficultés potentielles qui peuvent survenir au cours de ce protocole et les étapes auxquelles on peut les rencontrer. Ce tableau énumère les causes possibles de plusieurs de ces problèmes, ainsi que des solutions qui peuvent aider à résoudre tout problème.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Notre protocole démontre, par un guide rapide et facile à utiliser, une méthode pour préparer des cellules individuelles de classes morphologiques identifiées pour un séquençage de haute qualité, avec peu de blessures à l'échantillon. Dans le présent manuscrit, les cellules ganglionnaires de la rétine intrinsèquement photosensibles sont morphologiquement caractérisées, isolées et préparées pour l'ARN-Seq. Des contraintes cellulaires peuvent se produire pendant la manipulation de la rétine; Pour cette raison, nous remplaçons chaque morceau de tissu après un maximum de 4 h d'utilisation. Nous pouvons évaluer l'état des cellules en utilisant la plate-forme d'électrophysiologie pour enregistrer à partir de ces cellules et pour surveiller leurs réponses, ce qui nous permet de s'assurer que les cellules sont de bonne santé. Notre protocole a permis de générer des bibliothèques d'ADNc réussies à partir de 15 échantillons traités sur 23, donnant un taux de réussite de 65%. En outre, la qualité de nos données de séquençage était excellente, car le nombre moyen de gènes exprimés par nos cellules variait de 2 316 à 10 353, avec une moyenne de 5 683Gènes s'inscrivant avec une valeur FPKM non nulle. Ces chiffres sont semblables au nombre de gènes exprimé par d'autres études sur les neurones 5 , montrant que nos données sont également de bonne qualité.

Bien que nous ayons eu du succès avec ce protocole pour ces neurones spécifiques, il convient de noter que des modifications mineures à cette technique peuvent être appliquées pour un certain nombre d'applications différentes. En utilisant un classificateur de cellules activé par fluorescence (FACS) dans un modèle de souris séparé, nous avons isolé de petites populations de cellules (1 000 à 25 000) marquées avec un marqueur GFP du système nerveux central. L'ARN de ces populations a été isolé et 1 μL (ou légèrement inférieur à 12 ng / μL) de cet ARN a été utilisé pour commencer la transcription inverse à l'étape 6.1. Le seul ajustement qui devrait être apporté au protocole après cette étape se produit à l'étape 7.4, auquel cas on peut choisir d'utiliser moins de cycles de PCR. Nous avons utilisé 19 cycles dans les cas où l'échantillon initial contenait gPlus de 10 000 cellules et ont constaté que cela produit des bibliothèques d'ADNc de bonne qualité. Par exemple, des échantillons de cellules ont été préparés à partir d'une population FACSorted et le nombre de gènes exprimés variait de 12 340 à 4 052, avec une moyenne de 13 265 gènes avec une valeur FPKM non nulle. Cette technique peut être appliquée à différents modèles de souris pour lesquels un journaliste fluorescent est présent. En raison de cet amendement, les chercheurs pourraient étudier n'importe quelle population cellulaire pour laquelle une souris journalière fluorescente est disponible, en prolongeant les études dans le domaine de la diversité neuronale.

Un deuxième ajustement peut être effectué sur les cellules de profil en fonction de la fonctionnalité plutôt que simplement de la morphologie. Ce projet repose sur un modèle transgénique, mais cette technique peut être appliquée aux neurones sans identificateurs moléculaires connus. Par exemple, il existe plus de 30 sous-types fonctionnels de cellules ganglionnaires rétiniennes actuellement identifiées 27 , dont très peu ont des marqueurs uniques. Comme cette techniqueRepose déjà sur une plate-forme d'électrophysiologie pour le remplissage cellulaire, on pourrait utiliser un serrage de patch pour identifier le profil de réponse fonctionnelle de chaque cellule en fonction de son modèle d'épingle. En utilisant des enregistrements de pointes évoqués par la lumière, la classification des neurones rétiniens pourrait être déterminée avant l'isolement cellulaire. Cette technique fonctionne sur les cellules ganglionnaires de la rétine, mais elle peut être étendue pour examiner d'autres neurones rétiniens. Il convient toutefois de noter que si ce protocole est utilisé pour taper des cellules bipolaires ou amacrines de la rétine dans la couche nucléaire intérieure, par exemple, il faut faire attention à fournir une pression positive constante à la pointe de l'électrode pour éviter de mettre en contact les cellules L'électrode passe à travers la couche de ganglion et la couche interne de plexiforme. Pour les neurones de la rétine dans la couche nucléaire interne, la préparation des sections de la rétine avant les enregistrements cellulaires devrait probablement fonctionner de manière optimale pour éviter toute contamination. Chaque cellule serait isolée et préparée comme décrit ici suite à la claÉtape de ssification. En outre, nous proposons l'utilisation de ce protocole pour l'étude des neurones, mais cette technique peut être appliquée à tout type de cellule qui peut être morphologiquement caractérisé ou isolé par l'utilisation d'un modèle transgénique.

Cette technique peut également être modifiée pour fonctionner avec des bibliothèques d'ADNc préalablement préparées, comme nous l'avons déjà fait pour l'hybridation par microarray 28 . Avec une bibliothèque préparée séparément, on commence par des quantités d'ADNc comprises entre 50 et 150 ng et commence le protocole à l'étape 8.4; Des concentrations plus élevées et plus faibles n'ont pas été tentées, même si elles peuvent également fonctionner. La purification de l'ADNc en utilisant des billes d'ADN se produirait d'abord, suivie d'une étiquetage et d'une amplification par PCR. Nous avons testé cet ajustement avec l'ADNc à partir de préparations de bibliothèques, telles que celles pour l'hybridation par microarray 29 , et ont produit avec succès des bibliothèques tagnées pour RNA-Seq.

AiletteCe protocole peut être utilisé dans l'évaluation du succès d'une induction particulière de populations cellulaires à partir de cellules souches pluripotentes induites (iPSC). La force motrice de la différenciation de ces cellules pluripotentes ré-programmées repose sur une compréhension des facteurs de transcription qui conduisent les types de cellules à se développer séparément les uns des autres. Conduire des iPSCs vers des destinataires cellulaires particuliers est une nouvelle méthode pour étudier la diversité neuronale, car elle peut être utilisée pour générer des types de cellules sélectivement. Ce protocole peut être adapté pour évaluer la qualité de la diversité parmi les cellules différenciées de ce modèle. Comme mentionné précédemment, il existe plus de 30 sous-types fonctionnels de cellules ganglionnaires de la rétine, et de nombreux efforts ont été faits pour générer des RGC fonctionnels à partir d'iPSC. L'identification des marqueurs pour les sous-types de RGC - dans notre cas, ipRGC - permettrait au chercheur d'évaluer le succès de leur protocole dans la production de divers sous-types de RGC. L'évaluation des types de cellulesParmi ces neurones, cela profiterait de ce protocole et pourrait également servir d'outil pour l'étude continue des marqueurs spécifiques aux sous-types, car ce système modèle est facilement disponible.

Dans le présent manuscrit, nous décrivons une technique simple pour l'isolement et la préparation de cellules individuelles pour l'analyse transcriptomique. De plus, nous proposons des moyens de modifier le protocole afin que cette technique puisse être utilisée pour une multitude d'expériences avec une gamme d'objectifs à l'esprit. Le protocole décrit ici a été adapté à partir d'un protocole décrit par Trombetta et al. 24 comme ajustement des instructions du kit recommandé pour l'ARN-Seq à faible entrée. Les principales différences résident dans l'isolement cellulaire et divers changements volumétriques que nous avons choisis pour répondre aux besoins de ce projet. Il est important de souligner que l'étape la plus importante dans ce protocole est l'isolement des cellules du tissu rétinien. C'est le point dans le protocole durinG dont la plupart des erreurs peuvent survenir, et cela devrait être effectué avec la plus grande attention. Toute quantité de contamination peut entraîner des échantillons inutilisables, tandis que la perte de cytoplasme peut provoquer une épuisement sévère des molécules d'ARNm. Cette étape doit être effectuée avec soin et par le même individu, de l'expérience à l'expérience pour s'assurer que les échantillons ont été manipulés avec précision.

En résumé, ce protocole décrit une technique pour la classification, l'isolement et la préparation de cellules pour l'ARN-Seq de haute qualité. Il s'agit d'un moyen efficace, relativement peu coûteux, d'optimiser la qualité des données à partir de cellules individuelles. Cette technique est polyvalente et peut être modifiée de manière minimale pour l'application à diverses études.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Nous souhaitons remercier Jennifer Bair et Einat Snir, ainsi que l'Institut de génétique humaine de l'Université de l'Iowa pour leur aide à la préparation et à la gestion des échantillons.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics