Sequenza RNA a singola cellula di sottogruppi definiti delle cellule del Ganglio retinico

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui presentiamo un approccio combinatorio per la classificazione di tipi di cellule neuronali prima dell'isolamento e per la successiva caratterizzazione di transcriptomi a singola cellula. Questo protocollo ottimizza la preparazione di campioni per il successo RNA Sequencing (RNA-Seq) e descrive una metodologia studiata appositamente per una migliore comprensione della diversità cellulare.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La scoperta di marcatori specifici di tipo cellulare può fornire approfondimenti sulla funzione cellulare e sulle origini dell'eterogeneità cellulare. Con una recente spinta per una migliore comprensione della diversità neuronale, è importante identificare i geni la cui espressione definisce diverse sottopopolazioni di cellule. La retina serve come modello eccellente per lo studio della diversità del sistema nervoso centrale, in quanto è composto da più tipi di cellule principali. Lo studio di ogni grande classe di cellule ha prodotto marcatori genetici che facilitano l'identificazione di queste popolazioni. Tuttavia, in ciascuna di queste principali classi di cellule retiniche esistono più sottotipi di cellule e pochi di questi sottotipi hanno conosciuto marcatori genetici, anche se molti sono stati caratterizzati da morfologia o funzione. Una conoscenza di marcatori genetici per singoli sottotipi retinici consentirebbe lo studio e la mappatura di obiettivi cerebrali correlati a funzioni visive specifiche e possono anche dare un'occhiata alle reti geniche cheMantenere la diversità cellulare. I canali attuali utilizzati per identificare i marcatori genetici di sottotipi sono in grado di avere dei problemi, come la classificazione dei tipi di cellule dopo la sequenza. Questo rappresenta una sfida per l'analisi dei dati e richiede rigorosi metodi di convalida per garantire che i cluster contengano celle della stessa funzione. Proponiamo una tecnica per identificare la morfologia e la funzionalità di una cellula prima dell'isolamento e del sequenziamento, che consentirà una più facile identificazione di marcatori specifici di sottotipo. Questa tecnica può essere estesa a tipi di cellule non neuronali, così come a rare popolazioni di cellule con variazioni minori. Questo protocollo produce dati di eccellente qualità, poiché molte delle librerie hanno fornito profondità di lettura superiori a 20 milioni di letture per singole celle. Questa metodologia supera molti degli ostacoli presentati da RNA singolo-Seq e può essere adatto a ricercatori che mirano a profilare i tipi di cellule in modo semplice e altamente efficiente.

Introduction

La diversità neuronale è osservata in tutto il sistema nervoso centrale, in particolare nella retina vertebrata, un tessuto altamente specializzato costituito da 1 ipo e 6 cellule neuronali che sorgono da una popolazione di cellule progenitrici retiniche 1 , 2 , 3 . Molti sottotipi di cellule possono essere classificati funzionalmente, morfologicamente e geneticamente. L'obiettivo di questo protocollo è quello di legare la variabilità genetica dei tipi cellulari alle loro caratteristiche funzionali e / o morfologiche identificabili. Sono stati identificati alcuni geni per la classificazione delle cellule, ma molti sottotipi continuano a non identificarsi, in quanto rappresentano una piccola frazione della popolazione complessiva. L'identificazione dei geni all'interno di questi sottotipi specifici consentirà una maggiore comprensione della diversità neuronale all'interno della retina e può anche dare luce sulla diversificazione delle cellule neurali altrove. FuInoltre, studi a cellule singole consentono di scoprire nuovi tipi di cellule, che possono essere trascurati a causa della loro bassa rappresentazione tra la popolazione complessiva 4 , 5 , 6 , 7 .

Uno dei vantaggi della transcriptomics a singola cellula è che si possono scoprire marcatori o combinazioni di marcatori che definiscono un particolare sottotipo cellulare. Questi possono quindi essere utilizzati per ottenere l'accesso genetico a quel tipo di cellule per diverse manipolazioni. Ad esempio, stiamo usando questo protocollo per caratterizzare i geni specifici di una cellula di un sottogruppo di cellule del ganglio retinico che esprimono la melanopsina fotopigmenta. L'uso di un marker fluorescente nelle cellule gangliari retiniche che esprimono melanopsina consente lo studio di queste cellule, in quanto sono raggruppate insieme a causa della loro espressione di un gene noto. È interessante notare che ci sono cinque sottotipi noti di questo popu cellulareNella retina del topo 8 . Quindi, per isolare RNA dalle cellule di ogni tipo, abbiamo utilizzato classificazioni morfologiche stabilite all'interno del modello transgenico per identificare ogni sottotipo prima dell'isolamento cellulare. Questa tecnica consente la caratterizzazione delle cellule così come il loro isolamento direttamente dalla retina, senza la necessità di dissociazione tissutale, che può causare una risposta di stress all'interno delle cellule e la contaminazione dovuta a dendriti interrotti 9 .

Negli ultimi anni sono venuti alla luce una moltitudine di nuove tecniche in quanto il metodo RNA-Seq continua a svilupparsi. Questi strumenti consentono l'acquisizione di celle ottimizzate e l'efficienza dei costi più elevata mentre si avvicina alla domanda a portata di mano 4 , 7 , 10 , 11 , 12 , 13 . Tuttavia, mentreQueste tecniche sono state eccellenti pietre da scalare, ci sono un certo numero di ostacoli ancora incontrati che questo protocollo è in grado di affrontare. In primo luogo, molte delle procedure in corso isolano le cellule dal tessuto dissociato e tenteranno di utilizzare l'analisi dei componenti principali o la clustering gerarchica post-hoc per determinare la classificazione cellulare. Basandosi su questi strumenti per classificare i sottotipi non può produrre risultati affidabili e può costringere uno a trovare nuovi modi per convalidare questi dati per la correlazione di un marcatore genetico a un tipo di cellula funzionale. Il requisito per la dissociazione in altri protocolli può talvolta determinare danni ai tessuti e può causare la rottura dei processi neuronali, con conseguente perdita potenziale di mRNA. Inoltre, nelle preparazioni cellulari dissociate, le reazioni di stress possono cominciare ad influenzare i transcriptomi di queste cellule 14 . Questo protocollo supera queste sfide determinando il tipo di cellule funzionali prima dell'isolamento e meglio mantiene l'hEalth delle cellule mantenendo intatte il tessuto retinico.

Una tecnica è stata introdotta nel 2014 e consisteva nell'analisi in vivo del transcriptoma delle cellule vive 15 . Mentre questa tecnica consente l'esame del trascrittome con minima disfunzione meccanica al tessuto, manca la capacità di classificare tipi specifici di cellule all'interno del tessuto prima di esaminare i loro transcriptomi senza utilizzare un mouse reporter molto specifico. Il nostro protocollo non richiede un reporter specifico, in quanto utilizziamo il riempimento delle cellule e l'elettrofisiologia per caratterizzare le cellule prima del loro isolamento. Un'altra limitazione di questo precedente protocollo è che richiede una lunghezza d'onda specifica per eccitare l'elemento fotoattivatabile, mentre il nostro protocollo consente l'uso di un reporter fluorescente e di coloranti fluorescenti, facilmente accessibili o scelti da ciascun laboratorio singolarmente. Ancora, altri laboratori hanno sposato i due metodi di elettrOphysiology e transcriptomics per lo studio della diversità cellulare. L'uso di registrazioni di patch-clamp per caratterizzare la funzione di una cellula prima del suo isolamento è stato eseguito sui neuroni dissociati 16 e, in alcuni casi, ha preceduto l'uso di analisi microarray 17 per questi studi. Le stesse complicanze sono incontrate da quegli approcci, in quanto richiedono la dissociazione tissutale o l'uso di tecnologia microarray, che si basa sull'ibridazione di campioni alle sonde disponibili. Uno degli sviluppi più recenti è stato lo sviluppo di Patch-Seq, una tecnica che combina l'uso delle registrazioni patch-clamp e della tecnologia RNA-Seq per capire le cellule dalle fette del cervello intero 18 . Mentre questa tecnica ha le sue somiglianze con il protocollo presentato qui, è ancora importante notare che il nostro approccio consente al tessuto di rimanere intatto per la salute delle cellule. Qui presentiamo un protocollo per l'ottimizzazioneIone di questa alleanza, che genera librerie a celle singole di alta qualità per l'utilizzo di RNA-Seq per ottenere una copertura di profondità e mappatura elevata.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutte le procedure sono state approvate dal Comitato istituzionale per la cura e l'uso degli animali (IACUC) presso la Northwestern University.

1. Preparazione di soluzioni per elettrofisiologia (4 h)

  1. Creare 0,1% di H 2 O trattato con DEPC aggiungendo 1 ml di pirocarbonato dietilico (DEPC) a 999 ml di H2O purificato con osmosi inversa. Mescolare accuratamente e lasciare incubare la miscela per 1 ora a temperatura ambiente (RT). Quindi, autoclave il DEPC-miscelato H 2 O per 15 minuti su un ciclo liquido. Lasciare raffreddare l'H 2 O trattato con DEPC a RT.
  2. Rendere la soluzione extracellulare mescolando una bottiglia di medie Ames e 1,9 g (23 mM) di bicarbonato di sodio in 1 L di H 2 O. Bolle la soluzione extracellulare con
    95% O 2 /5% CO 2 e mantenerlo ad un pH di 7,3-7,4.
  3. Generare la soluzione intracellulare combinando 125mM K-gluconato, 2mM MgCl2, 10mM EGTA, 10mM HEPES e 0,1% trattato con DEPC2 O. Conservarlo in aliquote di 1 mL a -20 ° C. Aggiungere 10 μM di tracciante fluorescente all'inizio di ogni esperimento.
  4. Rendere la soluzione enzimatica aggiungendo 10.000 unità di collagenasi e 83 mg di ialuronidasi a 4.15 mL di soluzione extracellulare. La soluzione enzimatica deve essere conservata in aliquote di 50 μL a -20 ° C.

2. Preparazione del tessuto retinico (2 h)

NOTA: Tutte le procedure in questa sezione devono essere eseguite in presenza di illuminazione rossa oscura

  1. Gli animali si adattano scuro per almeno 1 h prima della dissezione. Eseguire tutte le procedure con illuminazione rosso scuro.
  2. Eutanizzare gli animali per asfissia del CO 2 e enucleare gli occhi oculari in un piatto di Petri con soluzione extracellulare precedentemente ossigenata.
  3. Spingere la cornea con un ago e tagliarla tagliandola con forbici oftalmiche al confine della cornea e della sclera 19 .
  4. Rimuovere l'obiettivo usando# 5 pinze. Facendo una leggera straccia nella sclera con le pinze e tagliate il nervo ottico dove si incontrano la retina e la sclera. Finire con cura la rimozione della sclera dalla retina.
  5. Rimuovere la vetreria trasparente usando la pinza # 5; Una volta tolto, la vetreria appare come una sostanza gelatinosa attaccata alle pinze. Fetta le retine a metà (in modo che ci siano 4 pezzi / animale) e li immagazzini in soluzione extracellulare ossigenata a RT fino all'uso.
  6. Quando è pronto a montare il tessuto nella camera di registrazione, inserire un pezzo di retina per incubare in soluzione enzimatica diluita in 500 μL di soluzione extracellulare ossigenata. Incubare in un piatto di Petri per 2 minuti a RT su un agitatore.
    1. Lavare il pezzo di retina in soluzione extracellulare ossigenata e collocare il tessuto in una camera di registrazione a fondo vetro; Utilizzare una pipetta di trasferimento di plastica con la punta tagliata per consentire la trasmissione della retina senza causare danni al tessuto.
  7. Utilizzare perIncarna di appiattire accuratamente il tessuto con lo strato fotorecettore rivolto verso il basso. Rimuovere il liquido in eccesso usando una pipetta. Ancorare il tessuto utilizzando un anello di platino con maglia in nylon.
    NOTA: Questo metodo potrebbe anche essere usato per preparare il tessuto per l'isolamento di RNA da cellule amacrine e bipolari etichettate.
  8. Riempire la camera con soluzione extracellulare ossigenata e montarla su uno stadio microscopico. Tessuto perfuso con soluzione extracellulare ossigenata a 2-4 ml / min.

3. Visualizzazione e Targeting di GFP + Cellule Gangliari Retiniche (10 min)

NOTA: Tutte le procedure in questa sezione devono essere eseguite in presenza di illuminazione rossa oscura

  1. Prima di iniziare, estrarre le micropipette di vetro (OD: 1,2 mm, ID: 0,69 mm) per le registrazioni elettrofisiologiche usando un estrattore di micropipette. Utilizzare il seguente protocollo per gli elettrodi (si prega di notare che i parametri devono essere adeguati di conseguenza per ottenere la resistenza e la volontà desideratiVariano tra gli estrattori e con vetro diverso): Calore: rampa +10; Tirare: 0; Vel: 23; Ritardo: 1; Pressione: 500; Anello di programma: 5 volte. Assicurarsi che le punte siano di diametro ~ 1 μm, con resistenze di 2-4 MΩ per il targeting di celle di grandi dimensioni e di 5-7 MΩ per il targeting di celle più piccole.
  2. Osservare lo strato di cellule gangliali utilizzando l'ottica a infrarossi differenziali a interferenze (IR-DIC) ( Figura 1A ). Identificare GFP + Cellule Gangliari Retiniche (RGCs) utilizzando l'epifluorescenza (~ 480 nm) ( Figura 1B ).
  3. Individuare la pipetta riempita con soluzione intracellulare in DIC. Applicare una leggera pressione positiva e zero gli spostamenti di tensione sull'amplificatore.
  4. Premere la micropipetta di vetro contro una cella GFP + e applicare una pressione negativa per formare una sigillatura GΩ tra la pipetta e la membrana cellulare. Applicare i passi di comando della tensione di prova ( es. 5 mV) per monitorare la resistenza del sigillamento. Dopo aver formato una tenuta stabile, rottura la membrana applicando brevi impulsi di nPer ottenere l'accesso a cellule intere.
  5. Attendere 1-2 min per i dendri della cellula per riempire con tracciante fluorescente.
    NOTA: La cellula può essere tipizzata morfologicamente esaminando la morfologia in epifluorescenza ( Figura 1C ). Nel caso di RGC esprimenti melanopsina, la stratificazione dendritica nello strato plexiformo interno viene visualizzata esaminando i dendriti riempiti di tracciante fluorescente sotto l'illuminazione epifluorescente e determinando se stratificano lontano dal soma nella sublamina OFF (M1 ipRGCs), vicino al ganglio (IPRGCs M2 & M4) o entrambi (M3 ipRGCs). Questa osservazione, combinata con la dimensione del soma (M4s presentano somi notevolmente grandi rispetto a tutti gli altri sottotipi ipRGC), consentono l'identificazione del tipo di cellule 20 , 21 , 22 . Pertanto, questa tecnica consente l'identificazione di tipo cellulare in vitro prima dell' iso RNAmento. Questo metodo potrebbe essere modificato per altri protocolli di identificazione di tipo cellulare che implicano morfologia dendritica o fisiologia cellulare.

4. Isolamento cellulare (2 min)

  1. Prima di iniziare, impostare la microcentrifuga da tavolo a 2.000 x g. Preparare un apparecchio di espulsione del campione collegando il tubo (OD: 3/32 in, ID: 1/32 in) con una siringa da 1 cc.
  2. Posizionare 0,2 mL di tubi PCR contenenti 10 μl di tampone di lisi e 1% di β-mercaptoetanolo sul ghiaccio. Preparare una siringa da 1 cc contenente H 2 O trattata con DEPC per risciacquare le punte della pipetta. Preparare un contenitore di ghiaccio secco per congelare il tampone di lisi dopo la raccolta del campione.
  3. Estrarre con cautela il contenuto citoplasmatico della pipetta cellulare applicando una pressione negativa usando una siringa da 10 ml; Tutti i contenuti citoplasmatici, compresi gli organelli, dovrebbero essere estratti se possibile.
    1. Monitorare l'estrazione in DIC visualizzando il corpo cellulare diminuendo le dimensioni. Dopo aver estratto Il contenuto citoplasmatico, sollevare con attenzione la pipetta dal tessuto e rimuovere rapidamente la pipetta dalla soluzione.
  4. Rimuovere rapidamente la pipetta dal supporto della testa e sciacquare brevemente la punta della pipetta con H 2 O trattato con DEPC utilizzando una siringa da 1 ml. Collegare la pipetta ad una siringa da 1 ml attraverso tubi aderenti per espellere il campione.
  5. Immediatamente espelle le cellule in 10 μl di tampone di lisi 1 contenente 1% di β-mercaptoetanolo in 0,2 mL di tubi PCR.
    NOTA: L'intero aspirato con le cellule dovrebbe essere espulso con delicatezza in modo da non introdurre bolle.
    1. Centrifugare brevemente il tubo in una mini centrifuga da tavolo a 2.000 xg per 10 s. Immediatamente congelare i campioni per 5 minuti su ghiaccio secco. Dopo il congelamento, conservarli a -80 ° C per un massimo di due settimane per ottenere risultati ottimali; I campioni possono durare più a lungo, ma si consiglia di elaborare il più velocemente possibile.
E "> 5. Purificazione RNA (30 min)

  1. Prima di iniziare, installare un dispositivo di separazione magnetico mediante l'inserire la parte superiore di un supporto di punta P20 o P200 invertito sul supporto magnetico a 96 pozzetti 23 .
  2. Preparare il fresco etanolo al 70% (EtOH) - è sufficiente circa 1 mL per campione. Rimuovere le branche magnetiche RNA da 4 ° C e scongelarle a RT per almeno 30 min.
    NOTA: non dovrebbero essere elaborati più di 8 campioni contemporaneamente, in quanto molti passaggi in questo protocollo si basano sull'efficienza e sulla rapida manipolazione.
  3. Una volta che le perle magnetiche sono a RT, vortex per 30 s per assicurare che la soluzione sia ben mescolata.
    NOTA: Le perline utilizzano un buffer specifico RNA per legare selettivamente l'RNA e consentono la rimozione di altri rifiuti cellulari quando utilizzati con un supporto a lastre magnetiche.
  4. Scongelare le cellule a RT per 1 min e quindi aggiungere 5 μL di H 2 O senza RNasi ad ogni campione; Pipetta su e giù. Aggiungere 22 μL di brani RNA ad ogni tubo e pipettaE completamente mescolare. Incubare i campioni a RT per 5 min per consentire all'RNA di interagire e legarsi con le perline magnetiche.
  5. Posizionare i tubi su un dispositivo separatore magnetico e lasciare sedere per 8 min; Prima di procedere, assicurarsi che il surnatante sia chiaro. Osservare le perle di un pellet e assicurarsi di non staccarla durante la pipettazione.
  6. Rimuovere il surnatante dai campioni e aggiungere 150 μl di 70% EtOH. Rimuovere l'EtOH e ripetere il lavaggio ancora due volte.
  7. Lasciare asciugare i campioni per 6 min. Controllare intermittentemente per vedere se più EtOH ha raccolto nella parte inferiore del tubo. Rimuoverlo di conseguenza.
  8. Mentre i campioni si asciugano, preparare il tampone di reazione 10X combinando 19 μL di tampone di lisi 2 e 1 μL di inibitore della RNasi (40 U / μL). Brevemente spin giù e tenerlo in ghiaccio.
  9. Una volta che i campioni sono asciutti ei granuli di perle non sono più lucidi, rimuovere i tubi dal separatore magnetico e aggiungere 9,5 μL di H 2 O senza RNasiPer reidratare i campioni. Posizionare i campioni sul ghiaccio e aggiungere 1 μl di tampone di reazione 10x a ciascun campione.

6. Trascrizione inversa (10 min)

NOTA: Prima di iniziare, scongelare i reagenti necessari per la trascrizione inversa (RT, tranne l'enzima) su ghiaccio. Questi includono: primer II, tampone 1, oligonucleotide e inibitore della RNasi.

  1. Ad ogni tubo, aggiungere 2 μL di primer II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1 N, per il quale N -1 può essere A, C o G e N può essere A, C, G o T; 12 μM). Mettere i tubi in un termociclatore che è stato preriscaldato a 72 ° C per 3 minuti.
  2. Durante l'incubazione, preparare il mix master RT. Per ogni reazione, aggiungere 4 μl di tampone 1 (250 mM Tris-HCl, pH 8,3, 375 mM KCl e 30 mM MgCl2), 1 μl di oligonucleotide (48 μM) e 0,5 μL di inibitore della RNasi (40 U / mL).
  3. Immediatamente dopo l'incubazione, posizionare i tubiGhiaccio per 2 min.
  4. Aggiungere 2 μL per reazione della transcriptasi inversa (100 U / μL) al mix master e pipettare accuratamente. Aggiungere 7,5 μL di master mix a ciascun tubo e mescolare pipettando delicatamente. Infilare brevemente i tubi per raccogliere il contenuto in basso e collocarli in un termociclatore preriscaldato con il seguente programma: 42 ° C per 90 minuti, 70 ° C per 10 minuti e tenere a 4 ° C.
  5. Conservare i tubi a -20 ° CO / N prima di procedere, anche se si consiglia di portare i campioni attraverso la fase di amplificazione prima di essere conservati per lunghi periodi di tempo; Altre fonti suggeriscono che lo stoccaggio di O / N a 4 ° C sarebbe accettabile a questo passo 24 .

7. Amplificazione del cDNA (2,5 h)

NOTA: Prima di iniziare, scollegare il tampone PCR e il primer PCR sul ghiaccio e far girare i tubi in una mini centrifuga da tavolo prima di fare il mix master del PCR.

  1. Per ogni reazione, pRecuperare un mix master masterizzato da PCR contenente 25 μl di buffer PCR, 1 μL di primer PCR (12 μM), 1 μL di DNA polimerasi e 3 μL di H 2 O senza nucleasi. Aggiungere la DNA polimerasi ultima, appena prima dell'aggiunta Di master mix ai campioni.
  2. Aggiungere 30 μL di master mix ad ogni tubo e ruotare a 2000 xg per 10 s per raccogliere il contenuto nella parte inferiore dei tubi.
  3. Posizionare i tubi in un termociclatore preriscaldato con il seguente programma: 95 ° C per 1 min; 34 cicli di 98 ° C per 10 s, 65 ° C per 30 s e 68 ° C per 3 minuti; 72 ° C per 10 min; E una tenuta a 4 ° C.
    NOTA: il numero di cicli per questo PCR è stato aumentato a 34, diverso dalle istruzioni del produttore suggerite. Dopo il test di ripetizione, questo numero di ciclo è risultato che produce risultati costantemente affidabili.
  4. Conservare i tubi a -20 ° C per un anno prima di procedere.

8. Purificazione di cDN amplificatoA (30 min)

  1. Prima di iniziare la purificazione, portare i branchi del DNA e il buffer di eluizione in RT per almeno 30 min. Preparare fresco 80% EtOH; Bisogna bastare 1 mL per campione. Aggiungere 1 μl di tampone di lisi 10X a ciascun campione.
  2. Vortice il brano del DNA per 30 s e aggiungi 50 μL di branelli del DNA ad ogni campione. Mescolare accuratamente pipettando, e poi brevemente spin giù a 2.000 xg per 10 s. Incubare i tubi a RT per 8 min.
  3. Posizionare i tubi sul dispositivo di separazione magnetica per 5 min. Pipettate leggermente il surnatante due volte e lasciate che i campioni rimangano per 2 min. Mentre i campioni sono sul dispositivo magnetico, rimuovere il surnatante e scartare.
  4. Aggiungere a ciascun campione 150 μl di 80% EtOH appena fatta e lasciarli sedere a RT per 30 s. Rimuovere l'EtOH e ripetere una volta l'EtOH.
  5. Girare brevemente i campioni e riposizionarli sul separatore magnetico per 1 minuto. Rimuovere qualsiasi EtOH residuo e lasciare asciugare i campioni per 5 minuti.
  6. Una volta che il pellet di perle non appare più lucido, ma prima che le crepe cominciano ad apparire, rimuovere il tubo dal separatore magnetico e aggiungere 17 μl di tampone di eluizione. Pipettare leggermente la pipetta su e giù per riposizionare completamente le perle.
  7. Incubare i campioni di resuspensione a RT per 2 min.
  8. Girare brevemente i campioni per raccogliere tutti i liquidi in basso e posizionarli sul separatore magnetico per 2 min. Trasferire 15 μL di supernatante trasparente in un tubo libero da RNasi da 1,5 ml e conservarlo a -20 ° C.
  9. Esaminare la qualità e la dimensione della libreria cDNA con un chip bioanalizzatore ad alta sensibilità usando 1 μL di cDNA. La dimensione ideale di una libreria cDNA è 0,3-2 Kb, con una concentrazione di almeno 10 ng / μL ( Figura 2 ).
    NOTA: Puoi scegliere di utilizzare il PCR come un modo per visualizzare i campioni per assicurare l'espressione di marcatori noti prima di procedere con il campione preparation.

9. Determinare le concentrazioni e il cDNA tagment (20 min)

  1. Prima di iniziare, portare il reagente di analisi, il buffer di diluizione e gli standard a RT per 30 min. Preparare un mix master contenente 1 μl di reagente di dosaggio e 199 μL di tampone di diluizione per reazione. Aliquota 199 μL di questa miscela in 500 μL di tubi di analisi. Aggiungere 1 μl di campione e mescolare accuratamente.
  2. Aliquota 190 μL di master mix al tubo 1 e 2. Aggiungere 10 μL di standard 1 al tubo 1 e 10 μL di standard 2 al tubo 2. Vortex tutti i tubi campione e tubi standard per 5 s; Incubare a RT per 3 min.
  3. Determinare la concentrazione di campioni con un fluorometro ad alta sensibilità. Assicurarsi che sia stata inserita la quantità corretta del campione selezionando l'opzione "calcola la soluzione di magazzino" e evidenziando "1 μL". Diluire ogni campione in un tubo separato da 1,5 ml ad una concentrazione finale di 0,2 ng / μl in H 2 O senza RNasi.
    NOTA:Mentre le istruzioni del produttore suggeriscono che si dovrebbe iniziare con 1 ng / μL di DNA totale, abbiamo utilizzato un importo di partenza più piccolo e abbiamo anche adeguato il protocollo per tenere conto di questo emendamento.
  4. In nuovi tubi PCR da 0,2 ml, pipettare 2,5 μL di tampone 2. Aggiungere 1,25 μL di cDNA al tubo appropriato per un totale di 250 pg. Infine, aggiungere a ciascun tubo 1,25 μL di miscela di tagmentazione e mescolare accuratamente la pipetta; La transposasi all'interno del mix di tagmentazione frammenterà il DNA in fili corti e incolverà gli adattatori ad una estremità di ciascun filamento, per un successivo utilizzo dello strumento di sequenziamento.
    NOTA: I volumi utilizzati per il tagmentation e l'accoppiamento indice sono una frazione dell'importo suggerito dalle istruzioni del produttore. Questo non solo consente la conservazione di reagenti, ma ha anche prodotto costantemente campioni tagmentati nella nostra esperienza.
  5. Centrifugare i tubi su un microcentrifuga di controsoffitto per 1 minuto.
  6. Posizionare i tubiIn un termociclatore preriscaldato con il seguente programma: 55 ° C per 10 min e tenore a 10 ° C.
    NOTA: La lunghezza di questa incubazione è di 10 minuti, in contrasto con la proposta di 5 minuti dalle istruzioni del produttore.
  7. Subito dopo che questo programma è completo, rimuovere i tubi e aggiungere a ciascuno 1,25 μL di buffer di neutralizzazione del tagmento. Pipettare bene per mescolare e incubare a RT per 5 min. Completare questo passaggio prontamente, poiché la trasposa rimane attiva fino a che il buffer non neutralizza l'enzima e arresta la reazione.

10. Indice di accoppiamento e di purificazione (1 h)

NOTA: Prima di iniziare, portare i rilievi del DNA e il buffer di resuspensione a RT per almeno 30 min. Decidere quali indici da utilizzare per ciascuno dei campioni.

NOTA: Questi indici saranno fissati alle rispettive estremità 5 'e 3' del DNA frammentato per l'identificazione di campioni dopo sequenziamento. Assicurati che non dueLe associazioni sono le stesse per i campioni che possono essere sequenziati insieme. Ad esempio, se il campione 1 utilizzerà indici bianchi 1 e arancione 1, il campione due deve utilizzare il bianco 1 e l'arancio 2 o il bianco 2 e l'arancio 2, ma non la stessa combinazione di indici. Questo kit contiene 4 distinti bianchi e 6 differenti indici arancioni. Tutte le diverse combinazioni possibili consentono di raggruppare fino a 24 campioni in una corsia di sequenza. Anche se in genere ci raccogliamo solo 10 campioni in una corsia, si potrebbe anche usare il kit contenente 24 indici, che consentirebbe di raggruppare 96 campioni in una singola corsia di sequenza, se lo si desidera.

  1. Ad ogni tubo aggiungere 1,25 μL dell'indice sinistro e 1,25 μL dell'indice destro per quel campione specifico. Aggiungere 3,75 μL di master mix PCR e pipetta bene per mescolare.
  2. Centrifugare in microcentrifuga da banco per 1 min.
  3. Posizionare i tubi in un termociclatore preriscaldato con il seguente programma: 72 ° C per 3 min; 95 ° C per 30 s; 12 cicli di 9576 ° C per 10 s, 50 ° C per 30 s e 72 ° C per 1 min; 72 ° C per 5 min; E una tenuta a 4 ° C.
    NOTA: Il primo passo a 95 ° C è stato modificato a partire da 98 ° C, come suggerito dalle istruzioni del produttore. Inoltre, i dettagli del ciclo sono stati regolati in modo che le temperature e le lunghezze di tempo consentissero la tagmentazione ottimale dei nostri campioni. L'incubazione finale di 72 ° C è stata aggiunta al nostro protocollo e non è stata inclusa nelle istruzioni del produttore.
  4. Girare brevemente i tubi per raccogliere i contenuti in basso. Vorticare i branchi del DNA per 30 s, quindi aggiungere 30 μL a ciascun tubo e mescolare accuratamente pipettando.
  5. Incubare i campioni a RT per 5 min.
  6. Posizionare i campioni su un separatore magnetico per 2 min. Pipettare il surnatante su e giù due volte e incubare i campioni per 1 minuto.
  7. Rimuovere e scartare il supernatante trasparente. Aggiungere 150 μl di 80% EtOH ad ogni campione e rimuovere. Ripetere una volta il lavaggio di EtOH.
  8. ConsentiteE campioni da asciugare all'aria per 10 min. Controllare in modo intermittente di vedere se alcuna EtOH ha raccolto nella parte inferiore dei tubi e rimuovere se necessario.
  9. Una volta che una crepa comincia ad apparire nel pellet del branello del DNA, rimuove il campione dal separatore magnetico e aggiungere 27,5 μl di tampone di resuspension per reidratare il pellet. Assicurarsi che il pellet sia completamente riposizionato e quindi incubare a RT per 2 min.
    NOTA: Il volume usato per il buffer di resuspension è stato modificato per tenere conto della quantità minima di materiale di partenza nel nostro protocollo e differisce dal volume suggerito nelle istruzioni del produttore.
  10. Posizionare i tubi sul separatore magnetico per 2 min. Trasferire 25 μL di supernatante trasparente in un tubo senza RNasi e conservare a -20 ° C.
    NOTA: non procedere con le istruzioni del produttore per completare la normalizzazione della libreria. I campioni sono stati preparati con successo dopo questo passaggio e sono preparati per sequenziare come è.
  11. Analizzare la tAgmentazione dei campioni utilizzando un chip bioanalizzatore e 1 μl di ciascun campione.
    NOTA: L'analisi di smear sarà condotta come prima; Tuttavia, il cDNA dovrebbe essere rilevato ad una gamma di dimensioni di 0,2-1 Kb ( figura 3 ). Le macchie inferiori a questo punto rappresentano probabilmente il degrado dei campioni, mentre i pezzi più grandi suggeriscono una modifica incompleta.

11. Raccolta di campioni (10 min)

  1. Ottieni concentrazioni di campioni di tagmentazione con il fluorometro ad alta sensibilità e determinano la concentrazione in nM.
    NOTA: Questo calcolo può essere calcolato con l'utilizzo di uno strumento di conversione Internet e si basa sulla lunghezza media del frammento dalla traccia di bioanalyzer. Per determinare la lunghezza media del frammento, osservare la traccia per ciascun campione singolarmente e determinare le dimensioni del frammento di DNA medio. Questo può anche essere calcolato quando si esamina la traccia del bioanalizzatore evidenziando l'intervallo della striscia e dell'esameE la molarità calcolata dal programma.
  2. Combina i campioni in modo tale che la piscina contenga la stessa concentrazione di ogni campione. Non diluire i campioni; La piscina dovrebbe essere solo diluita come il campione più concentrato e avrebbe idealmente una concentrazione totale di almeno 15 nM.
  3. Conservare i campioni collettivi a -20 ° C prima della sequenza; Si suggerisce che i campioni vengano sequenziati entro una settimana di pooling. Eseguire sequencing da 100 bp con end-to-end con una piattaforma HiSeq.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I tipi di cellule sono facilmente classificati dopo l'iniezione del colorante

La Figura 1 mostra un esempio di un GFP + RGC prima e dopo il riempimento del tracciante fluorescente. Questa cellula è stata identificata sulla base della sua espressione di GFP nella linea transgenica ( Figura 1A ). Una guarnizione stretta è stata formata con un elettrodo di vetro fine-tiro sul soma di questa cella. Per caratterizzare il sottotipo, il colorante fluorescente è stato iniettato nel soma e permesso di riempire tutti i processi associati ( figura 1B ). La classificazione come un ipRGC M4 è stata abilitata attraverso l'osservazione che questa cellula ha un soma molto grande e che i suoi processi terminano all'interno della sublamina ON dello strato plexiformo interno ( Figura 1C ). Come illustrazione delle differenze di stratificazione che si possono individuare in una preparazione retinica isolata, abbiamo riempito M1 (OFF-stratifyinG), M3 (bistratificati) e M4 (ON-stratificazione) ipRGCs con un tracciante fluorescente, li ha fissati e ha eseguito la rappresentazione confocale della sublamina ON e OFF ( Figura 1D ). Questa visualizzazione dei dendriti attraverso l'imaging confocale è molto simile a come i dendriti osservano in unfixed tissue in vitro quando le cellule sono riempite con un tracciante fluorescente (Schmidt e Kofuji 2009, 2010 e 2011).

Librerie cDNA da singole cellule

L'uso di un primer Oligo d (T) consente la selettiva trascrizione e amplificazione inversa di mRNA. Dopo aver generato e amplificato le librerie cDNA da ciascuna cella, sono stati utilizzati chip bioanalizzatori per valutare la qualità e la dimensione delle librerie. I risultati di questa analisi mostrano che gli sforzi cDNA ideali sono 0,5-2 Kb in un buon campione ( Figura 2A ). Alcuni campioni mostrano alcune bande o macchie sotto il segno di 300 bp, sugGestire che queste librerie sono di scarsa qualità (vedere la tabella 1 per la risoluzione dei problemi). Un esempio di una traccia di bioanalizzatore di buona qualità mostra poche o nessuna fascia di DNA sotto i 300bp e un robusto striscio tra 500bp e 2Kb (Figura 2B). Le corsie di controllo vuote devono indicare rispettivamente i marcatori inferiori e superiori a 35 e 10380 bp, nonché una linea di base stabile che non fluttua. Diverse biblioteche possono produrre dati di qualità, come si può vedere sia in Figura 2B che in 2C , che ha prodotto eccellenti profondità di lettura e elevati tassi di mappatura. Soltanto quelli campionati con forti cDNA librerie della dimensione prevista dovrebbero essere portati avanti alla tagmentazione (vedere la tabella 1 per la risoluzione dei problemi).

Il tagmentation a basso input prepara campioni di alta qualità per il sequenziamento

Questo protocollo è ottimizzato per tagmentazione con una quantità minima di materia di partenza l. Solo 250 pg funziona meglio per una riuscita tagmentazione, in quanto quantità inferiori non amplificeranno correttamente e le quantità più elevate non saranno completamente frammentate. Dopo aver completato la campionatura e l'amplificazione PCR / campione di pulizia, i campioni sono stati nuovamente analizzati su un chip bioanalizzatore. Gli spessori cDNA ideali a questo punto dovrebbero essere di 0,2-1 Kb ( Figura 3A ). La traccia dovrebbe apparire liscia e distribuita uniformemente tra queste due dimensioni ( Figura 3B ); Questa traccia corrisponde al campione nella corsia 1. Nella figura 3C è riportata una tagmentazione incompleta, che può essere risolta facilmente (vedere la tabella 1 per la risoluzione dei problemi). Abbiamo eseguito analisi dei dati sui campioni e abbiamo scoperto che questo protocollo ha prodotto campioni con eccellenti profondità di lettura, spesso superando 12 milioni di letture per campione; Media del 69,1% di mappatura; E più di 5.000 geni espressi.

/55229fig1.jpg "/>
Figura 1: Identificazione di tipi di RGC basati sull'espressione di GFP in ipRGC esprimenti Melanopsin e sulle proprietà morfologiche. ( A ) Lo strato di cellule gangliosi della retina, visualizzato utilizzando IR-DIC nella preparazione retina a tutto montaggio. ( B ) La stessa preparazione visualizzata in epifluorescenza (~ 480 nm) per identificare le cellule gangliali che esprimono GFP. ( C ) Una cellula esprimente GFP mirata per la registrazione di patch-clamp e riempita di un tracciante fluorescente. La cellula può essere identificata come un ipRGC M4 basata sulla sua grande dimensione del soma e sugli stratificanti dendriti 25 , 26 . ( D ) Immagine confocale dei dendriti ipRGC immagazzinati nella sublamina ON e / o OFF dell'IPL (M1), nella sublamina ON dell'IPL (M4) e in entrambe le sublimae ON e OFF dell'IPL (M3). IR-DIC: contrasto di interferenza differenziale a infrarossi..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Fare clic qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Analisi della qualità della libreria cDNA con una traccia di bioanalyzer. ( A) Esempio di uscita bioanalizzatrice per campioni multipli che sono stati trascritti trascrizionati, amplificati e purificati. Le linee 1-3 mostrano i frammenti di DNA perfetti, con la maggioranza del DNA più grande di 300 bp. Le librerie con macchie in questo intervallo hanno fornito costantemente eccellenti dati di sequenziamento, mostrando una media di 5.683 geni espressi per cellula. La corsia 4 rappresenta un campione che è stato trattato senza successo e quindi non produce alcun cDNA. La corsia di controllo di successo ha una linea di base costante e due picchi puliti a 35 e 10.380 bp. ( B ) Esempio di una traccia di bioanalizzatore di successo con un'elevata intensità di cDNA intorno a 2 Kb. Questo s Mear corrisponde al campione nella corsia 1. ( C ) Esempio di una traccia di bioanalizzatore di successo con il cDNA centrato su circa 500 bp. Questa traccia corrisponde al campione nella corsia 3. Fare clic qui per visualizzare una versione più grande di questa cifra.

Figura 3
Figura 3: I campioni tagmentati mostrano robuste smagliature tra 0.2 e 2 Kb. ( A ) Un esempio rappresentativo di bioanalizzatore uscito dopo tagmentazione, amplificazione e pulitura PCR. ( B ) Traccia di un campione tagmentato con successo corrispondente alla corsia 1 in (A). ( C ) Esempio di traccia per un campione con tagmentazione incompleta, chiaro dall'intensità di picco intorno a 1 Kb."> Clicca qui per visualizzare una versione più grande di questa figura.

2 "> Diluire il campione alla concentrazione di 0,4 ng / μL e riconvertire la tagmentazione
Problema Causa possibile Soluzione
Passo 3.3) Non è possibile formare la sigillatura GΩ Superficie della cella non è abbastanza pulita Pulire ulteriormente con pressione positiva
Passo 3.3) La cella sembra sgonfiare / morire Preparare la nuova pipetta e indirizzare una nuova cella
Punto 3.4) Non è possibile determinare la posizione terminale dei dendriti Alexafluor non ha avuto abbastanza tempo per diffondere in tutta la cellula o concentrazione di Alexafluor non è abbastanza alta Verificare che il tempo di guadagno e di esposizione sulla fotocamera sia abbastanza elevato. Attendere ancora 5 minuti prima di visualizzare i dendriti. Se i dendriti ancora non sono visibili, preparate la soluzione con alti livelli di Alexafluorconcentrazione.
Fase 4.1) Impossibile aspirare tutto il citoplasma
Passo 5.5) Supernatant non è chiaro dopo 8 minuti Pipettare leggermente l'intero soluzione due volte, mentre ancora sul separatore magnetico, e lasciare riposare per altri 5 minuti
Passo 5.5) Il pellet si disperde durante la pipettazione Il campione è troppo lontano dal magnete Tenere i tubi sul dispositivo di separazione magnetica durante tutte le pipettature. Estrarre la soluzione e lasciare che i perline si ri-pelletino per 5 min
Passo 5.7) Dopo 5 minuti, i campioni appaiono ancora lucidi La quantità massima di EtOH non è stata rimossa Continuare a monitorare i campioni durante l'essiccazione. Ogni 2 minuti, utilizzare una pipetta P10 e rimuovere tutti i EtOH alla base del tubo
Fase 8.9) Il pellet ha avuto fessure prima della reidratazione Consenti il ​​campione di rehydPer un totale di 4 minuti, piuttosto che 2 (punto 8.10)
Fase 8.11) Una piccola quantità di branello è stata portata avanti con il surnatante Estrarre l'intero campione nel tubo e collocare sul separatore magnetico per 1 min; Pipettare con delicatezza e assicurarsi di evitare il pallone
Fase 8.12) I frammenti del DNA sono incoerenti e la scala di fluorescenza cambia continuamente Concentrazione troppo elevata del DNA per un chip HS Controllare la concentrazione del campione e diluire tra 1 - 10 ng / μL. Riorganizzare la bioanalizzatrice
Passo 8.12) Spessore di basso peso molecolare RNA degradazione Assicurarsi di bloccare la cella gelata immediatamente dopo la raccolta. Scartare questa libreria cDNA
Fase 8.12) Base di fluttuazione del marker in corsia di controllo Contaminazione o vecchio reagente Scartare il marcatore del DNA e impiegare un nuovo tubo per la corsa di Bioanalyzer
Fase 8.12) Nessuna macchia di DNA Mancata espulsione della cella Tirare nuovi aghi con una punta leggermente più grande
Fallimento del branco di RNA Assicurarsi che le perle siano completamente riposizionate prima dell'uso e consentire ai campioni di incubarsi prima di collocare sul separatore magnetico
Fase 8.12) Sbavatura del DNA debole Non abbastanza amplificazione Impiegare più cicli PCR
Fase 8.12) Denso DNA fuori dalla gamma 500bp-2Kb Le macchie di DNA inferiori a 0,5 e superiori a 2 Kb sono probabilmente contaminanti. Scartare il campione
Fase 8.12) Spie regolarmente distanziate sulla traccia del DNA Contaminazione del campione Indossare sempre guanti freschi e fare nuovo etanolo per i risciacqui; Consigli di filtro devono essere utilizzati in ogni momento
Fase 9.3) Impossibile rilevare la concentrazione del campione sul fluorometro I campioni al di sotto del livello di rilevamento hanno troppo poco DNA per la tagmentazione e non possono essere utilizzati
Passo 10.10) I campioni non sono asciutti dopo 10 minuti Continuare a rimuovere l'eccesso di EtOH Lasciare che i campioni vengano più a lungo, controllare ogni minuto
Passo 10.13) Sbattimento sprofondato verso 2Kb Frammentazione incompleta Diluire il campione ad una concentrazione di 0,15 ng / μL, piuttosto che 0,2 ng / μL; Riavvio di tagmentazione
Passo 10.13) Sbavatura sprofondata verso 200bp Troppo piccolo ingresso del DNA Diluire il campione meno, provare una concentrazione di 0,4 ng / μL; Riavvio di tagmentazione
La reazione di tagmentazione è troppo lunga Ridurre il tempo di reazione del tagmentation a 8 min
Fase 10.13) Sottopiede debole Amplificazione impropria del DNA
Fase 11.2) La concentrazione massima disponibile della piscina è inferiore a 5 nM Individuare quale campione (s) hanno concentrazioni significativamente basse e riutilizzare la tagmentazione con nuova diluizione

Tabella 1: Soluzioni e suggerimenti per potenziali ostacoli nel protocollo. Questa tabella elenca le potenziali difficoltà che possono verificarsi durante questo protocollo e le fasi in cui si possono incontrare. Questa tabella elenca le cause possibili per molti di questi problemi, nonché soluzioni che possono aiutare a risolvere eventuali problemi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il nostro protocollo dimostra, attraverso una guida rapida e facile da usare, un metodo per preparare singole celle di classi morfologiche identificate per sequenziamenti di alta qualità, con poca lesione al campione. Nel presente manoscritto, le cellule gangliari retiniche intrinsecamente fotosensibili sono caratterizzate morfologicamente, isolate e preparate per RNA-Seq. Sforzi cellulari possono verificarsi durante la movimentazione della retina; Per questo motivo sostituiamo ogni pezzo di tessuto dopo non più di 4 ore di utilizzo. Possiamo valutare lo stato delle cellule utilizzando l'apparecchiatura elettrofisiologica per registrare da queste cellule e monitorare le loro risposte, che ci permette di garantire che le cellule siano di buona salute. Il nostro protocollo ha consentito la generazione di librerie cDNA di successo da 15 su 23 campioni elaborati, con un tasso di successo del 65%. Inoltre, la qualità dei nostri dati di sequenziamento era eccellente, in quanto il numero medio di geni espressi dalle nostre cellule variava da 2.316 a 10.353, con una media di 5.683I geni che registrano con un valore FPKM non zero. Questi numeri sono simili ai conteggi espressi espressi da altri studi dei neuroni 5 , mostrando che i nostri dati sono anche di buona qualità.

Mentre abbiamo avuto successo con questo protocollo per questi neuroni specifici, va notato che piccole modifiche a questa tecnica possono essere applicate per una serie di applicazioni diverse. Utilizzando un sistema separatore di cellule attivato con fluorescenza (FACS) all'interno di un modello separato del mouse, abbiamo isolato piccole popolazioni di cellule (1.000 -25.000) etichettate con un marker GFP dal sistema nervoso centrale. L'RNA di queste popolazioni è stato isolato e 1 μL (a o leggermente inferiore a 12 ng / μL) di questo RNA è stato utilizzato per iniziare la trascrizione inversa al punto 6.1. L'unica regolazione che deve essere fatta al protocollo dopo questa fase si verifica al punto 7.4, in cui si può scegliere di impiegare meno cicli PCR. Abbiamo utilizzato 19 cicli nei casi in cui il campione iniziale conteneva gReater di 10.000 cellule e hanno scoperto che questo produce librerie cDNA di buona qualità. Ad esempio, i campioni di cellule sono stati preparati da una popolazione FACSorted e il numero di geni espressi variava da 12.340-14.052, con una media di 13.265 geni con un valore FPKM non zero. Questa tecnica può essere applicata a vari modelli di topi per cui è presente un reporter fluorescente. A causa di questo emendamento, i ricercatori potrebbero potenzialmente studiare qualsiasi popolazione cellulare per cui un mouse reporter fluorescente è disponibile, estendendo studi oltre il campo della diversità neuronale.

Una seconda regolazione può essere fatta per le celle di profilo basate sulla funzionalità piuttosto che sulla morfologia. Questo progetto si basa su un modello transgenico, ma questa tecnica può essere applicata ai neuroni senza identificatori molecolari noti. Ad esempio, esistono oltre 30 sottotipi funzionali delle cellule del ganglio retinico attualmente identificate 27 , pochissime delle quali hanno marcatori univoco. Come questa tecnicaGià si basa su un impianto elettrofisiologico per il riempimento delle cellule, si potrebbe impiegare bloccaggio delle patch per identificare il profilo di risposta funzionale di ciascuna cellula in base al suo schema di spiking. Utilizzando registrazioni di picchi evocati dalla luce, la classificazione dei neuroni retinici potrebbe essere determinata prima dell'isolamento cellulare. Questa tecnica funziona sulle cellule del ganglio retinico, ma può essere estesa per esaminare altri neuroni retinici. Va osservato, tuttavia, che se questo protocollo è usato per digitare le cellule retiniche bipolari o amacrine nello strato nucleare interno, ad esempio, si deve prestare attenzione a fornire una pressione positiva costante alla punta dell'elettrodo per evitare di contattare le cellule come L'elettrodo passa attraverso lo strato di cellule del ganglio e lo strato plexiformo interno. Per i neuroni retinici all'interno dello strato nucleare interno, la preparazione delle sezioni retiniche prima delle registrazioni cellulari sarebbe probabilmente la cosa migliore per evitare costantemente la contaminazione. Ogni cellula sarebbe isolata e preparata come descritto qui in seguito alla clausolaPasso di ssificazione. Inoltre, proponiamo l'uso di questo protocollo per lo studio dei neuroni, ma questa tecnica può essere applicata a qualsiasi tipo di cellule che può essere caratterizzato o isolato morfologicamente mediante l'uso di un modello transgenico.

Questa tecnica può anche essere modificata per funzionare con librerie cDNA precedentemente preparate, come abbiamo generato in passato per l'ibridazione microarray 28 . Con una libreria preparata separatamente, si inizia con quantità di cDNA nell'intervallo 50-150 ng e inizia il protocollo al punto 8.4; Non sono state tentate concentrazioni più elevate e basse, anche se potrebbero funzionare. La purificazione del cDNA usando i branchi del DNA si verifica prima, seguita da tagmentazione e amplificazione PCR. Abbiamo provato questo aggiustamento con cDNA da preparazioni biblioteche, come quelle per l'ibridazione microarray 29 , e abbiamo ottenuto con successo librerie tagged per RNA-Seq.

pinnaQuesto protocollo può essere utilizzato nella valutazione del successo di una particolare induzione delle popolazioni cellulari da cellule staminali pluripotenti indotte (iPSCs). La forza trainante della differenziazione di queste cellule pluripotenti ri-programmate si basa sulla comprensione dei fattori di trascrizione che conducono i tipi di cellule a svilupparsi separatamente l'uno dall'altro. Guidare iPSC verso particolari cellule è un nuovo metodo per studiare la diversità neuronale, in quanto può essere utilizzato per generare selettivamente tipi di cellule. Questo protocollo può essere adattato per valutare la qualità della diversità tra le cellule differenziate di questo modello. Come accennato in precedenza, esistono più di 30 sottotipi funzionali delle cellule del ganglio retinico e molti sono stati fatti per generare RGC funzionali da iPSC. L'identificazione di marcatori per sottotipi di RGCs - nel nostro caso ipRGCs - consentirebbe al ricercatore di valutare il successo del loro protocollo nella produzione di vari sottotipi di RGCs. La valutazione dei tipi di celluleTra questi neuroni avrebbe beneficiato di questo protocollo e può anche servire come strumento per la continua ricerca di marcatori specifici di sottotipo, poiché questo sistema di modelli diventa prontamente disponibile.

Nel presente manoscritto descriviamo una tecnica semplice per l'isolamento e la preparazione di singole cellule per l'analisi transcriptomica. Inoltre, suggeriamo modi per modificare il protocollo in modo che questa tecnica possa essere utilizzata per una moltitudine di esperimenti con una serie di obiettivi in ​​mente. Il protocollo qui descritto è stato adattato da un protocollo descritto da Trombetta et al. 24 come regolazione delle istruzioni kit consigliate per RNA-Seq a basso ingresso. Le principali differenze si trovano nell'isolamento delle cellule e nei vari cambiamenti volumetrici che abbiamo scelto per soddisfare al meglio le esigenze di questo progetto. È importante sottolineare che il passo più importante in questo protocollo è l'isolamento delle cellule dal tessuto retinico. Questo è il punto del protocollo durinG che possono verificarsi la maggior parte degli errori e deve essere eseguita con l'attenzione più attenta. Qualsiasi quantità di contaminazione può portare a campioni inutilizzabili, mentre la perdita del citoplasma può causare una grave esaurimento delle molecole di mRNA. Questo passaggio deve essere eseguito con cura e da parte dello stesso individuo da esperimento per sperimentare per garantire che i campioni siano stati trattati con precisione.

In sintesi, questo protocollo descrive una tecnica per la classificazione, l'isolamento e la preparazione delle cellule per RNA-Seq di alta qualità. Questo è un modo efficiente e relativamente economico per ottimizzare la qualità dei dati da singole celle. Questa tecnica è versatile e può essere minimamente modificata per l'applicazione a vari studi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgments

Vorremmo riconoscere Jennifer Bair e Einat Snir, nonché l'Istituto universitario di Iowa per la genetica umana, per la loro assistenza nella preparazione e gestione di campioni.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics