Single-cell RNA-Seq af definerede subsæt af retinale Ganglion-celler

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her præsenterer vi en kombinatorisk tilgang til klassificering af neuronelle celletyper forud for isolation og til den efterfølgende karakterisering af enkeltcelletranscriptomer. Denne protokol optimerer forberedelsen af ​​prøver til vellykket RNA-sekventering (RNA-Seq) og beskriver en metodologi, der er designet specielt til forbedret forståelse af cellemangfoldighed.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Opdagelsen af ​​celletypespecifikke markører kan give indsigt i cellulær funktion og oprindelsen af ​​cellulær heterogenitet. Med et nyligt skub for den forbedrede forståelse af neuronal mangfoldighed er det vigtigt at identificere gener, hvis udtryk definerer forskellige subpopulationer af celler. Nethinden tjener som en fremragende model til undersøgelsen af ​​mangfoldigheden i centralnervesystemet, da den består af flere hovedcelletyper. Undersøgelsen af ​​hver hovedklasse af celler har givet genetiske markører, som letter identifikationen af ​​disse populationer. Imidlertid findes der flere subtypes af celler inden for hver af disse større retinale celleklasser, og få af disse subtyper har kendt genetiske markører, selv om mange er blevet karakteriseret ved morfologi eller funktion. Kendskab til genetiske markører for individuelle retinale subtyper vil muliggøre undersøgelse og kortlægning af hjernemål rettet mod specifikke visuelle funktioner og kan også give indblik i gennetværketOpretholde cellulær mangfoldighed. Nuværende veje, der bruges til at identificere de genetiske markører for subtyper, har ulemper, såsom klassificering af celletyper efter sekventering. Dette giver en udfordring for dataanalyse og kræver strenge valideringsmetoder for at sikre, at klynger indeholder celler af samme funktion. Vi foreslår en teknik til identifikation af en celles morfologi og funktionalitet forud for isolering og sekventering, hvilket vil gøre det lettere at identificere subtypespecifikke markører. Denne teknik kan udvides til ikke-neuronale celletyper såvel som sjældne populationer af celler med mindre variationer. Denne protokol giver data af fremragende kvalitet, da mange af bibliotekerne har givet læse dybder større end 20 millioner læses for enkeltceller. Denne metode overvinder mange af de forhindringer, der præsenteres af single-cell RNA-Seq og kan være egnet til forskere, der sigter mod at profilere celletyper på en ligetil og meget effektiv måde.

Introduction

Neuronal mangfoldighed observeres i hele centralnervesystemet, især i hvirveldyrets retina, et højt specialiseret væv bestående af 1 glial og 6 neuronale celletyper, der opstår fra en population af retinale stamceller 1 , 2 , 3 . Mange subtypes af celler kan klassificeres funktionelt, morfologisk og genetisk. Formålet med denne protokol er at binde celletypens genetiske variabilitet til deres identificerbare funktionelle og / eller morfologiske egenskaber. En række gener er blevet identificeret til klassificering af celler, men mange subtyper fortsætter med at gå ukarakteriseret, da de repræsenterer en lille del af den samlede population. Identifikationen af ​​gener inden for disse specifikke subtyper vil muliggøre en større forståelse af neuronal mangfoldighed i nethinden og kan også kaste lys på diversificering af neurale celler andre steder. FuEndvidere tillader enkeltcelleundersøgelser at afdække nye celletyper, som måske er blevet overset på grund af deres lave repræsentation blandt den samlede befolkning 4 , 5 , 6 , 7 .

En af fordelene ved single-cell transcriptomics er, at unikke markører eller kombinationer af markører, der definerer en bestemt cellulær subtype, kan opdages. Disse kan så bruges til at få genetisk adgang til den pågældende celletype til forskellige manipulationer. For eksempel bruger vi denne protokol til at karakterisere de celletypespecifikke gener af en delmængde af retinale ganglionceller, der udtrykker photopigment melanopsin. Brugen af ​​en fluorescerende markør i melanopsin-ekspressionende retinale ganglionceller muliggør undersøgelsen af ​​disse celler, da de klynkes sammen på grund af deres ekspression af et kendt gen. Interessant er der fem kendte undertyper af denne celle popuLation i muslinien 8 . For at isolere RNA fra celler af hver type har vi således anvendt etablerede morfologiske klassifikationer inden for den transgene model for at identificere hver subtype forud for celleisolering. Denne teknik muliggør karakterisering af celler såvel som isolering direkte fra nethinden uden behov for vævsdissociation, hvilket kan forårsage stressrespons i celler og forurening på grund af afskårne dendritter 9 .

Et væld af nye teknikker er kommet frem i de seneste år, da RNA-Seq-metoden fortsætter med at udvikle sig. Disse værktøjer giver mulighed for maksimeret celleopsamling og større omkostningseffektivitet, mens man nærmer sig spørgsmålet ved hånd 4 , 7 , 10 , 11 , 12 , 13 . Men mensDisse teknikker har været fremragende stepping stones, der er en række forhindringer stadig stødt på at denne protokol er i stand til at adressere. For det første isolerer mange af de nuværende procedurer celler fra dissocieret væv og forsøger at anvende enten hovedkomponentanalyse eller hierarkisk clustering post-hoc for at bestemme celleklassificering. At stole på disse værktøjer til at klassificere undertyper, kan ikke producere pålidelige resultater og kan tvinge en til at finde nye måder at validere disse data for korrelationen af ​​en genetisk markør til en funktionel celletype. Kravet om dissociation i andre protokoller kan undertiden resultere i vævsskade og kan forårsage at neuronale processer udskilles, hvilket resulterer i et potentielt tab af mRNA. Endvidere kan spændingsresponserne i dissocierede cellepræparater begynde at påvirke transkriptomerne af disse celler 14 . Denne protokol overvinder disse udfordringer ved at bestemme den funktionelle celletype forud for isolation, og det opretholder bedre hCellerne ved at holde retinalvævet intakt.

En teknik blev introduceret i 2014 og bestod af in vivo analysen af ​​transkriptomet af levende celler 15 . Mens denne teknik muliggør undersøgelse af transkriptomet med minimal mekanisk forstyrrelse af vævet, mangler den evnen til at klassificere specifikke celletyper inden i vævet, inden de undersøger deres transkriptomer uden at anvende en meget specifik reportermus. Vores protokol kræver ikke en bestemt reporter, da vi udnytter cellepåfyldning og elektrofysiologi til at karakterisere celler før deres isolering. En anden begrænsning af denne tidligere protokol er, at det kræver en specifik bølgelængde til at excitere det fotoaktiverbare element, mens vores protokol tillader brugen af ​​en fluorescerende reporter og fluorescerende farve, som er let tilgængelige eller kan vælges af hvert laboratorium individuelt. Stadig har andre laboratorier giftet sig med to metoder for elektrOphysiologi og transcriptomics til undersøgelse af cellulær mangfoldighed. Anvendelsen af ​​patch-clamp-optagelser til at karakterisere funktionen af ​​en celle forud for dens isolering er blevet udført på dissocierede neuroner 16 og i nogle tilfælde har den forudgået anvendelsen af ​​mikroarrayanalyse 17 til disse undersøgelser. De samme komplikationer opstår ved disse fremgangsmåder, da de kræver vævsdissociation eller anvendelse af mikroarray-teknologi, som er afhængig af hybridisering af prøver til tilgængelige prober. Et af de seneste fremskridt har været udviklingen af ​​Patch-Seq, en teknik, der kombinerer brugen af ​​patch-clamp-optagelser og RNA-Seq-teknologi til at forstå celler fra helhjerteskiver 18 . Selvom denne teknik har sine ligheder med den her præsenterede protokol, er det igen vigtigt at bemærke, at vores tilgang gør det muligt for vævet at forblive intakt for cellernes helbred. Her præsenterer vi en protokol for optimizatIon af denne alliance, som genererer højkvalitets, enkeltcellebiblioteker til brug af RNA-Seq for at opnå en høj læstdybde og kortlægningsdækning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedurer blev godkendt af Institutional Animal Care and Use Committee (IACUC) ved Northwestern University.

1. Fremstilling af opløsninger til elektrofysiologi (4 timer)

  1. Lav 0,1% DEPC-behandlet H20 ved tilsætning af 1 ml diethylpyrocarbonat (DEPC) til 999 ml omvendt osmose-oprenset H20. Bland grundigt og lad blandingen inkuberes i 1 time ved stuetemperatur (RT). Autoklaver derefter DEPC-blandet H20 i 15 minutter på en flydende cyklus. Lad den DEPC-behandlede H 2 O afkøles ved stuetemperatur.
  2. Lav den ekstracellulære opløsning ved at blande en flaske Ames 'medium og 1,9 g (23 mM) natriumbicarbonat i 1 liter H20. Boble den ekstracellulære opløsning med
    95% O 2 /5% CO 2 og opretholde den ved en pH på 7,3-7,4.
  3. Generer den intracellulære opløsning ved at kombinere 125 mM K-gluconat, 2 mM MgCl2, 10 mM EGTA, 10 mM HEPES og 0,1% DEPC-behandlet HOpbevares i 1 ml alikvoter ved -20 ° C. Tilsæt 10 μM fluorescerende sporstof i begyndelsen af ​​hvert forsøg.
  4. Lav enzymopløsning ved at tilføje 10.000 enheder kollagenase og 83 mg hyaluronidase til 4,15 ml ekstracellulær opløsning. Enzymopløsningen bør opbevares i 50 μl alikvoter ved -20 ° C.

2. Fremstilling af retinalt væv (2 timer)

BEMÆRK: Alle procedurer i dette afsnit skal udføres under dim rød belysning

  1. Mørk-tilpassede dyr i mindst 1 time før dissektion. Udfør alle procedurer under dim rød belysning.
  2. Euthanize dyrene ved CO 2- kvælning og enukle øjnene i en petriskål med tidligere oxygeneret ekstracellulær opløsning.
  3. Poke hornhinden med en nål og skær den væk ved at skære med oftalmisk saks ved grænsen til hornhinden og sclera 19 .
  4. Fjern linsen ved hjælp af# 5 tang. Forsigtigt lave en tåre i sclera med tang og skær den optiske nerve, hvor nethinden og sclera mødes. Afslut forsigtigt fjernelse af sclera fra nethinden.
  5. Fjern det gennemsigtige glasrør ved hjælp af # 5 tang Når en gang er fjernet, fremstår det glasagtige stof som et gelatineagtigt stof, der sidder fast i tangen. Skær retinierne i halvdelen (så der er 4 stykker / dyr) og opbevar dem i oxygeneret ekstracellulær opløsning ved stuetemperatur indtil brug.
  6. Når du er klar til at montere vævet i optagekammeret, skal du placere et retina for at inkubere i enzymopløsning fortyndet i 500 μl oxygeneret ekstracellulær opløsning. Inkubér i en petriskål i 2 minutter ved RT på en shaker.
    1. Vask retlinjen i oxygeneret ekstracellulær opløsning og læg vævet i et glasbundet optagekammer; Brug en plastik overførsel pipette med spidsen afskåret for at tillade nethinden at overføres uden at forårsage skade på vævet.
  7. Brugt tilCeps for at forsigtigt flade vævet med fotoreceptorlaget nedad. Fjern overskydende væske ved hjælp af en pipette. Anker vævet ved hjælp af en platinring med nylonnet.
    BEMÆRK: Denne metode kan også bruges til at fremstille vævet til isolering af RNA fra mærkede amakrine og bipolære celler.
  8. Fyld kammeret med oxygeneret ekstracellulær opløsning og monter den på et mikroskop-trin. Perfusivt væv med oxygeneret ekstracellulær opløsning ved 2-4 ml / min.

3. Visualisering og målretning af GFP + retinale Ganglion-celler (10 min)

BEMÆRK: Alle procedurer i dette afsnit skal udføres under dim rød belysning

  1. Før du begynder, skal du trække glasmikropipetter (OD: 1,2 mm, ID: 0,69 mm) til elektrofysiologiske optagelser ved hjælp af en mikropipetteudtræk. Brug følgende protokol for elektroderne (Bemærk venligst, at parametrene skal justeres i overensstemmelse hermed for at opnå den ønskede modstand og viljeVarierer på tværs af pullers og med forskellige glas): Varme: Ramp +10; Træk: 0; Vel: 23; Forsinkelse: 1; Tryk: 500; Programløkke: 5 gange. Sørg for at tipene er ~ 1 μm i diameter, med modstand på 2-4 MΩ til målretning af store celler og 5-7 MΩ til målretning af mindre celler.
  2. Overhold ganglioncellelaget ved brug af infrarød differentialinterferenskontrast (IR-DIC) optik ( figur 1A ). Identificer GFP + Retinal Ganglion Cells (RGC'er) ved anvendelse af epifluorescens (~ 480 nm) ( Figur 1B ).
  3. Find pipetten fyldt med intracellulær opløsning i DIC. Påfør et lille positivt tryk og nul eventuelle spændingsforskydninger på forstærkeren.
  4. Tryk glasmikroppetten mod en GFP + -celle og påfør negativt tryk for at danne en GΩ-tætning mellem pipetten og cellemembranen. Påfør testspændingskommandostrin ( f.eks. 5 mV) for at overvåge tætningsmodstanden. Efter dannelse af en stabil forsegling bryder membranen ved at anvende korte pulser af nEgativt tryk for at få adgang til hele cellen.
  5. Vent 1-2 min for dendritterne af cellen for at fylde med fluorescerende sporstof.
    BEMÆRK: Cellen kan morfologisk skrives ved at undersøge morfologien i epifluorescens ( figur 1C ). I tilfælde af melanopsin-udtrykkende RGC'er visualiseres dendritisk stratifikation i det indre plexiforme lag ved at undersøge dendritterne fyldt med fluorescerende sporstof under epifluorescerende belysning og bestemme, om de stratificerer langt fra summen i OFF-sublamina (M1 ipRGC'er) nær ganglionet Cellelag i ON sublamina (M2 & M4 ipRGC'er) eller begge (M3 ipRGC'er). Denne observation kombineret med soma-størrelse (M4'er har tydeligt store somer sammenlignet med alle andre ipRGC-subtyper), giver mulighed for identifikation af celletype 20 , 21 , 22 . Denne teknik tillader således identifikation af celletype in vitro forud for RNA isoning. Denne metode kunne modificeres for andre celletypeidentifikationsprotokoller, der involverer enten dendritisk morfologi eller cellulær fysiologi.

4. Cellisolering (2 min)

  1. Før bordet skal du sætte tabletopmikrocentrifugen til 2.000 x g. Forbered et prøveudvisningsapparat ved at forbinde slanger (OD: 3/32 in, ID: 1/32 in) med en 1 cc sprøjte.
  2. Anbring 0,2 ml PCR-rør indeholdende 10 μl lysisbuffer og 1% β-mercaptoethanol på is. Forbered en 1 cc sprøjte indeholdende DEPC-behandlet H 2 O for at skylle pipettespidserne. Klargør en beholder tøris for at fryse lysisbufferen efter prøveindsamling.
  3. Fjern forsigtigt cytoplasmatisk indhold af cellepipetten ved at påføre negativt tryk ved hjælp af en 10 ml sprøjte; Alt cytoplasmatisk indhold, herunder organeller, bør ekstraheres, hvis det er muligt.
    1. Overvåg ekstraktionen i DIC ved at visualisere cellekropets faldende størrelse. Efter ekstraktion Det cytoplasmatiske indhold løfter pipetten forsigtigt væk fra vævet og fjerner pipetten hurtigt fra opløsningen.
  4. Fjern pipetten hurtigt fra hovedstadholderen og skyll pipettepinden kort med DEPC-behandlet H 2 O ved hjælp af en 1 ml sprøjte. Tilslut pipetten til en 1 ml sprøjte via tætsluttende rør for at udvise prøven.
  5. Uddriv cellerne øjeblikkeligt i 10 μl lysisbuffer 1 indeholdende 1% β-mercaptoethanol i 0,2 ml PCR-rør.
    BEMÆRK: Hele aspiratet med cellerne skal udvises forsigtigt for ikke at indføre bobler.
    1. Centrifuger røret kort i en mini-centrifuge med bordplade ved 2.000 xg i 10 s. Blixfryses prøverne øjeblikkeligt i 5 minutter på tøris. Efter frysning opbevares dem ved -80 ° C i op til to uger for at opnå de bedste resultater; Prøverne kan vare længere, men det anbefales, at de behandles så hurtigt som muligt.
E "> 5. RNA oprensning (30 min)

  1. Før du begynder, skal du oprette en magnetisk separator enhed ved at binde den øverste del af en omvendt P20 eller P200 tipholder til 96-brønds magnetstativ 23 .
  2. Forbered frisk 70% ethanol (EtOH) - ca. 1 ml pr. Prøve er tilstrækkelig. Fjern RNA magnetiske perler fra 4 ° C opbevaring og optø dem ved stuetemperatur i mindst 30 minutter.
    BEMÆRK: Ikke mere end 8 prøver skal behandles ad gangen, da mange trin i denne protokol er afhængige af effektivitet og hurtig håndtering.
  3. Når de magnetiske perler er ved stuetemperatur, hvirveles i 30 sekunder for at sikre, at opløsningen er godt blandet.
    BEMÆRK: Perlerne bruger en RNA-specifik puffer til selektivt at binde RNA, og de tillader fjernelse af andet cellulært affald, når de anvendes med en magnetisk pladeholder.
  4. Optøbe celler ved stuetemperatur i 1 minut, og tilsæt derefter 5 μl RNase-fri H20 til hver prøve; Pipetter op og ned. Tilsæt 22 μL RNA perler til hvert rør og pipetteE grundigt at blande. Inkuber prøverne ved stuetemperatur i 5 minutter for at tillade RNA'et at interagere og binde med de magnetiske perler.
  5. Placer rørene på en magnetisk separator enhed og lad sidde i 8 minutter; Før du fortsætter, sørg for at supernatanten er klar. Overhold perlerne fra en pille, og sørg for ikke at løsne den under pipetteringen.
  6. Fjern supernatanten fra prøverne og tilsæt 150 μl 70% EtOH. Fjern EtOH og gentag vask to gange mere.
  7. Lad prøverne lufttørre i 6 minutter. Kontroller intermittent for at se, om mere EtOH har samlet i bunden af ​​røret. Fjern det i overensstemmelse hermed.
  8. Mens prøverne tørrer, fremstilles 10X reaktionsbuffer ved at kombinere 19 μl lysisbuffer 2 og 1 μl RNase-inhibitor (40 U / μl). Drej det kort og hold det på is.
  9. Når prøverne er tørre og perlepellets ikke længere ser blanke ud, fjern rørene fra den magnetiske separator og tilsæt 9,5 μL RNase-fri H20At rehydrere prøverne. Placer prøverne på is og tilsæt 1 μL 10x reaktionsbuffer til hver prøve.

6. Omvendt transskription (10 min)

BEMÆRK: Tøm de nødvendige reagenser til omvendt transkription (RT, bortset fra enzymet) på is, inden du begynder. Disse omfatter: primer II, buffer 1, oligonukleotid og RNase inhibitor.

  1. Til hvert rør tilsættes 2 μl primer II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1N, for hvilket N- 1 kan være A, C eller G og N kan være A, C, G eller T; 12 μM). Placer rørene i en termocykler, som er blevet forvarmet ved 72 ° C i 3 minutter.
  2. Under inkubation fremstilles RT master mix. Til hver reaktion tilsættes 4 μl buffer 1 (250 mM Tris-HCI, pH 8,3, 375 mM KCl og 30 mM MgCl2), 1 μl oligonukleotid (48 μM) og 0,5 μl RNase-inhibitor (40 U / pi).
  3. Anbring rørene straks efter inkubationenIs i 2 min.
  4. Tilsæt 2 μL pr. Reaktion af revers transkriptase (100 U / μl) til masterblandingen og pipetten grundigt. Tilsæt 7,5 μL masterblanding til hvert rør og bland ved forsigtigt pipettering. Snør hurtigt rørene for at indsamle indholdet i bunden og læg dem i en forvarmet termocykler med følgende program: 42 ° C i 90 minutter, 70 ° C i 10 minutter og et hold ved 4 ° C.
  5. Opbevar rørene ved -20 ° C / N før det fortsættes, selvom det anbefales at prøveene føres gennem forstærkningstrinnet, før de opbevares i længere tid; Andre kilder antyder O / N-opbevaring ved 4 ° C ville også være acceptabelt i dette trin 24 .

7. cDNA amplifikation (2,5 timer)

BEMÆRK: Tænk PCR-pufferen og PCR-primeren på isen, inden du begynder, og rør rørene ned i en mini-centrifuge i bordplade, inden du gør PCR-masterblandingen.

  1. For hver reaktion sReparere en PCR-masterblanding indeholdende 25 μl PCR-buffer, 1 μl PCR-primer (12 μM), 1 μl DNA-polymerase og 3 μl nukleasefrit H20. Tilsæt DNA-polymerasen sidst lige før tilsætningen Af master mix til prøverne.
  2. Tilsæt 30 μL masterblanding til hvert rør og drej ved 2.000 xg i 10 s for at indsamle indholdet i bunden af ​​rørene.
  3. Placer rørene i en forvarmet termocykler med følgende program: 95 ° C i 1 min; 34 cyklusser på 98 ° C i 10 s, 65 ° C i 30 s og 68 ° C i 3 minutter; 72 ° C i 10 minutter; Og et hold ved 4 ° C.
    BEMÆRK: Antallet af cyklusser for denne PCR er blevet øget til 34, afvigende fra den foreslåede fabrikants anvisninger. Efter gentagelse af testen viste dette cyklusnummer at producere konsekvent pålidelige resultater.
  4. Opbevar rørene ved -20 ° C i op til et år, før de fortsættes.

8. Oprensning af amplificeret cDNA (30 min)

  1. Før begyndelse rensning, bringe DNA-perlerne og elueringsbufferen til RT i mindst 30 minutter. Forbered frisk 80% EtOH; 1 ml pr. Prøve skal være tilstrækkelig. Tilsæt 1 μl 10X lysisbuffer til hver prøve.
  2. Vortex DNA-perlerne i 30 s og tilsæt 50 μL DNA-perler til hver prøve. Bland grundigt ved pipettering, og drej derefter kort dem ned ved 2.000 xg i 10 s. Inkuber rørene ved stuetemperatur i 8 minutter.
  3. Placer rørene på den magnetiske separationsanordning i 5 minutter. Sæt forsigtigt supernatanten op og ned to gange, og lad prøverne sidde i 2 minutter. Mens prøverne er på den magnetiske enhed, fjern supernatanten og kassér.
  4. Tilsæt 150 μL frisklavet 80% EtOH til hver prøve og lad dem sidde ved stuetemperatur i 30 s. Fjern EtOH og gentag EtOH-vasken en gang.
  5. Snurre prøverne kort og sæt dem tilbage på magnetisk separator i 1 minut. Fjern eventuelt resterende EtOH og lad prøverne lufttørre i 5 minutter.
  6. Når perlepellet ikke længere er blankt, men før revner begynder at dukke op, fjern røret fra den magnetiske separator og tilsæt 17 μL elueringsbuffer. Pipet forsigtigt op og ned for at resuspenge perlerne helt.
  7. Inkuber de resuspenderede prøver ved stuetemperatur i 2 minutter.
  8. Drej kort prøverne for at opsamle al væske i bunden og placere dem på magnetisk separator i 2 minutter. Overfør 15 μl klar supernatant til et 1,5 ml RNase-frit rør og opbevar det ved -20 ° C.
  9. Undersøg kvaliteten og størrelsen af ​​cDNA-biblioteket med en højfølsom bioanalysatorchip ved anvendelse af 1 μl cDNA. Den ideelle størrelse af et cDNA-bibliotek er 0,3-2 Kb, med en koncentration på mindst 10 ng / μl ( figur 2 ).
    BEMÆRK: Du kan vælge at anvende PCR som en måde at skærmprøve på for at sikre udtryk for kendte markører, inden du fortsætter med prøve preparation.

9. Bestem koncentrationer og mærkning cDNA (20 min)

  1. Før begyndelsen bringes analysereagenset, fortyndingsbufferen og standarderne til RT i 30 minutter. Forbered en masterblanding indeholdende 1 μl assayreagens og 199 μl fortyndingsbuffer pr. Reaktion. Aliquot 199 μL af denne blanding i 500 μl assay rør. Tilsæt 1 μL prøve og bland grundigt.
  2. Aliquot 190 μL master mix til rør 1 & 2. Tilsæt 10 μL standard 1 til rør 1 og 10 μL standard 2 til rør 2. Vortex alle prøve rør og standard rør i 5 s; Inkuberes ved stuetemperatur i 3 minutter.
  3. Bestem koncentration af prøver med et højfølsomt fluorometer. Sørg for, at den korrekte prøve mængde er blevet indtastet ved at vælge "beregne lagerløsning" mulighed og fremhæve "1 μL". Fortynd hver prøve i et separat 1,5 ml rør til en slutkoncentration på 0,2 ng / μl i RNase-fri H20.
    BEMÆRK:Fabrikantens anvisninger tyder på, at man skal begynde med 1 ng / μl totalt DNA, vi har brugt et mindre udgangsmængde og har også justeret protokollen til at tage højde for dette ændringsforslag.
  4. I nye 0,2 ml PCR rør, pipette 2,5 μl buffer 2. Tilsæt 1,25 μL cDNA til det passende rør til i alt 250 pg. Til sidst tilsættes 1,25 μL tagmenteringsblanding til hvert rør og pipetter grundigt for at blande; Transposasen inden i tagmenteringsblandingen vil fragmentere DNA'et i korte tråde og anneale adapterne til hver ende af hver streng for senere brug af sekventeringsinstrumentet.
    BEMÆRK: De mængder, der anvendes til tagering og indekskobling, er en brøkdel af mængden, der foreslås af producentens anvisninger. Dette giver ikke kun mulighed for bevaring af reagenser, men det har også konsekvent produceret tagmented prøver i vores erfaring.
  5. Centrifuger rørene på en mikrobølgeovn i 1 minut.
  6. Placer røreneI en forvarmet termocykler med følgende program: 55 ° C i 10 minutter og et hold ved 10 ° C.
    BEMÆRK: Længden af ​​denne inkubation er 10 minutter, i modsætning til den foreslåede 5 min fra producentens anvisninger.
  7. Straks efter at dette program er færdigt, fjern rørene og tilføj 1,25 μL tagmenterings neutraliserende buffer til hver. Pipetter godt at blande og inkubere ved stuetemperatur i 5 minutter. Afslut dette trin straks, da transposasen forbliver aktiv, indtil bufferen neutraliserer enzymet og stopper reaktionen.

10. Indekskobling og rensning (1 time)

BEMÆRK: Før begyndelsen bringes DNA-perlerne og resuspensionbufferen til RT i mindst 30 minutter. Bestem hvilke indekser der skal bruges til hver af prøverne.

BEMÆRK: Disse indekser vil blive knyttet til de respektive 5'- og 3'-ender af det fragmenterede DNA til identifikation af prøver efter sekventering. Sørg for, at ingen toParringer er de samme for prøver, der kan sekventeres sammen. Hvis eksempel 1 f.eks. Bruger indekser hvid 1 og orange 1, skal prøve 2 anvende hvid 1 og orange 2 eller hvid 2 og orange 2, men aldrig den samme kombination af indekser. Dette kit indeholder 4 forskellige hvide og 6 forskellige orange indekser. Alle de forskellige mulige kombinationer tillader op til 24 prøver at blive samlet i en sekventeringsbane. Selv om vi typisk kun samler 10 prøver i en bane, kan man også bruge sættet, der indeholder 24 indekser, hvilket ville tillade samling af 96 prøver i en enkelt sekvensbestemmelse, hvis det ønskes.

  1. Til hvert rør tilføjes 1,25 μL af det venstre indeks og 1,25 μL af det højre indeks for den pågældende prøve. Tilsæt 3,75 μL PCR master mix og pipette godt for at blande.
  2. Centrifuger i en mikrobølgeovn i bordet i 1 min.
  3. Placer rørene i en forvarmet termocykler med følgende program: 72 ° C i 3 minutter; 95 ° C i 30 s; 12 cyklusser på 9576 ° C i 10 s, 50 ° C i 30 s og 72 ° C i 1 min; 72 ° C i 5 minutter; Og et hold ved 4 ° C.
    BEMÆRK: Det første 95 ° C trin blev ændret fra 98 ° C, hvilket blev foreslået af producentens anvisninger. Også cyklusdetaljerne blev justeret, så temperaturerne og tidslængderne tillod det optimale tagmentering af vores prøver. Den endelige 72 ° C inkubation blev også tilføjet til vores protokol og blev ikke medtaget i producentens anvisninger.
  4. Snør hurtigt rørene for at indsamle indholdet i bunden. Vortex DNA-perlerne i 30 s, og tilsæt derefter 30 μl til hvert rør og bland grundigt ved pipettering.
  5. Inkuber prøverne ved stuetemperatur i 5 minutter.
  6. Anbring prøverne på en magnetisk separator i 2 minutter. Pipetter supernatanten op og ned to gange og inkuber prøver i 1 min.
  7. Fjern og kassér den klare supernatant. Tilsæt 150 μl 80% EtOH til hver prøve og fjern. Gentag EtOH-vasken en gang.
  8. Tillad thE prøver til lufttørring i 10 minutter. Kontroller intermittent for at se om EtOH har samlet i bunden af ​​rørene og fjern efter behov.
  9. Når en revne begynder at dukke op i DNA-perlepellet, fjern prøven fra den magnetiske separator og tilsæt 27,5 μl resuspensionbuffer for at rehydrere pelleten. Sørg for, at pelleten er fuldstændigt resuspenderet, og inkuber derefter ved stuetemperatur i 2 minutter.
    BEMÆRK: Volumenet, der blev brugt til resuspensionbufferen, blev ændret for at tage højde for den mindre mængde udgangsmateriale i vores protokol og adskiller sig fra det foreslåede volumen i producentens anvisninger.
  10. Placer rørene på den magnetiske separator i 2 min. Overfør 25 μl klar supernatant i et RNase-frit rør og opbevar ved -20 ° C.
    BEMÆRK: Fortsæt ikke med producentens anvisninger for at fuldføre bibliotekets normalisering. Prøverne fremstilles med succes efter dette trin og er forberedt til sekventering som det er.
  11. Analyser tAgmentering af prøverne ved anvendelse af en bioanalysatorchip og 1 μl af hver prøve.
    BEMÆRK: Analysen af ​​smears vil blive udført som tidligere; CDNA skal nu detekteres i et størrelsesområde på 0,2-1 Kb ( figur 3 ). Smører under dette punkt repræsenterer sandsynligvis nedbrydningen af ​​prøver, mens større smører tyder på ufuldstændig tagmentering.

11. Samling af prøver (10 min)

  1. Hent koncentrationer af tagmenteringsprøver med højfølsomhedsfluorometeret fra tidligere og bestem koncentrationen i nM.
    BEMÆRK: Denne beregning kan beregnes ved hjælp af et internet konverteringsværktøj og afhænger af den gennemsnitlige fragmentlængde fra bioanalyzer sporet. For at bestemme den gennemsnitlige fragmentlængde skal man observere sporet for hver prøve individuelt og bestemme størrelsen af ​​det gennemsnitlige DNA-fragment. Dette kan også beregnes ved undersøgelse af bioanalysatorsporet ved at fremhæve spredningsområdet og undersøge detE molaritet beregnet af programmet.
  2. Kombiner prøver, så puljen indeholder den samme koncentration af hver prøve. Fortynd ikke prøver; Puljen bør kun være som fortyndet som den lavest koncentrerede prøve og ville ideelt have en samlet koncentration på mindst 15 nM.
  3. Opbevar de poolede prøver ved -20 ° C inden sekventering; Det foreslås, at prøver gennemgår sekventering inden for 1 uge efter pooling. Udfør parret ende, 100 bp sekventering med en HiSeq platform.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Celletyper klassificeres let efter farvestofinjektionen

Figur 1 viser et eksempel på en GFP + RGC før og efter fluorescerende sporingsfyldning. Denne celle blev identificeret baseret på dets ekspression af GFP i den transgene linje ( figur 1A ). En tæt forsegling blev dannet med en fin-spids, trukket glaselektrode på summen af ​​denne celle. For at karakterisere subtypen blev det fluorescerende farvestof injiceret i summen og tilladt at fylde alle tilknyttede processer ( figur 1B ). Klassifikationen som en M4 ipRGC blev aktiveret ved observation af, at denne celle har en meget stor soma, og at dens processer ophører inden for ON-sublimina af det indre plexiformlag ( figur 1C ). Som en illustration af forskelle i stratificering, der kan skelnes i et isoleret retinalpræparat, fyldte vi M1 (OFF-stratifyinG), M3 (registreret) og M4 (ON-stratificerende) ipRGC'er med en fluorescerende sporingsenhed, fikseret dem og udførte konfokal billeddannelse af ON og OFF-underskærmen ( figur 1D ). Denne visualisering af dendritterne via konfokal billeddannelse ligner meget på, hvordan dendritterne ser ud i ufikseret in vitro væv, når cellerne er fyldt med fluorescerende sporstof (Schmidt og Kofuji 2009, 2010 og 2011).

CDNA biblioteker fra enkeltceller

Anvendelsen af ​​en Oligo d (T) primer tillader den selektive revers transkription og amplifikation af mRNA. Efter generering og amplifikation af cDNA-biblioteker fra hver celle blev bioanalysatorchips anvendt til at vurdere kvaliteten og størrelsen af ​​bibliotekerne. Resultaterne af denne analyse viser, at de ideelle cDNA-udstrygninger er 0,5-2 Kb i en god prøve ( Figur 2A ). Nogle prøver viser nogle få bånd eller smører under 300 bp mark, sugHævder, at disse biblioteker er af ringe kvalitet (se tabel 1 til fejlfinding). Et eksempel på et bioanalysatorspor af god kvalitet viser få eller ingen DNA-bånd under 300bp og et robust smear mellem 500bp og 2Kb (figur 2B). Tomme kontrolbaner skal vise lavere og øverste markører henholdsvis henholdsvis 35 og 10380 bp samt en stabil basislinje, som ikke svinger. Forskellige biblioteker kan producere kvalitetsdata, som det fremgår af både figur 2B og 2C , hvilket gav fremragende læste dybder og høje kortfrekvenser. Kun de prøver med stærke cDNA-biblioteker af den forventede størrelse skal overføres til tagmentation (se tabel 1 til fejlfinding).

Low-input tagmentation forbereder højkvalitets prøver til sekventering

Denne protokol er optimeret til tagering med en mindre mængde startmateriale l. Kun 250 pg virker bedst for en vellykket tagmentering, da lavere mængder ikke forstærker korrekt og højere mængder ikke vil fragmentere helt. Efter afslutning af tagmenterings- og PCR-amplifikation / prøveoprensning blev prøverne igen analyseret på en bioanalysatorchip. De ideelle cDNA-udstrygninger på dette tidspunkt skal være 0,2-1 Kb ( figur 3A ). Sporet skal forekomme glat og jævnt fordelt mellem de to størrelser ( figur 3B ); Dette spor svarer til prøven i kurve 1. Figur 3C viser en ufuldstændig tagering, som let kan løses (se tabel 1 til fejlfinding). Vi har udført dataanalyse på prøverne og konstateret, at denne protokol producerede prøver med fremragende lædedybder, der ofte overstiger 12 millioner læs pr. Prøve; Gennemsnit af 69,1% kortlægning; Og mere end 5.000 udtrykte gener.

/55229fig1.jpg "/>
Figur 1: Identifikation af RGCs-typer baseret på GFP-ekspression i melanopsin-udtrykkende ipRGC'er og på morfologiske egenskaber. ( A ) Ganglion-celle laget af nethinden, visualiseret ved anvendelse af IR-DIC i fuldmonteret nethinden præparat. ( B ) Det samme præparat visualiseret i epifluorescens (~ 480 nm) for at identificere GFP-udtrykkende ganglionceller. ( C ) En GFP-udtrykkende celle målrettet til patch-clamp-optagelse og fyldt med en fluorescerende sporstof. Cellen kan identificeres som en M4 ipRGC baseret på dens meget store soma størrelse og ON stratificerende dendritter 25 , 26 . ( D ) Konfokalt billede af ipRGC-dendritter, der er afbildet i IPL (M1) ON og / eller OFF-underlinjen, i IPL (M4) ON-underlinjen og i både IPL (M3) ON og OFF-underlinjen. IR-DIC: Infrarød differential interferens kontrast..jove.com / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Venligst klik her for at se en større version af denne figur.

Figur 2
Figur 2: Analyse af cDNA-bibliotekskvalitet med et Bioanalyzer-spor. ( A) Bioanalyzer output eksempel for flere prøver, der er blevet omvendt transkriberet, amplificeret og renset. Baner 1-3 viser de ideelle DNA-smører, med størstedelen af ​​DNA større end 300 bp. Biblioteker med smears i dette område har konsekvent givet fremragende sekvenseringsdata, hvilket viser et gennemsnit på 5.683 gener udtrykt pr. Celle. Bane 4 repræsenterer en prøve, der blev behandlet uden succes og således ikke produceret cDNA. Den succesrige kontrolbane har en konstant baseline og to rene toppe ved 35 og 10.380 bp. ( B ) Eksempel på et vellykket bioanalysatorspor med en høj intensitet af cDNA omkring 2 Kb. Dette s Møre svarer til prøven i bane 1. ( C ) Eksempel på et vellykket bioanalysator spor med cDNA centreret omkring 500 bp. Dette spor svarer til prøven i felt 3. Klik venligst her for at se en større version af denne figur.

Figur 3
Figur 3: Tagede prøver viser robuste smears mellem 0,2 og 2 Kb. ( A ) Et repræsentativt eksempel bioanalyzer output efter tagmentation, amplifikation og PCR oprydning. ( B ) Spor af en vellykket tagmenteret prøve svarende til bane 1 i (A). ( C ) Eksempel på spor for en prøve med ufuldstændig tagmentering, klar ved toppintensiteten omkring 1 Kb."> Venligst klik her for at se en større version af denne figur.

2 "> Fortynd prøve til koncentration på 0,4 ng / μl og rerun tagmentation
Problem Mulig årsag Løsning
Trin 3.3) Kan ikke danne GΩ-tætning Overfladen af ​​cellen er ikke ren nok Rengør yderligere ved brug af positivt tryk
Trin 3.3) Celle ser ud til at deflate / dø Forbered ny pipette og mål mod en ny celle
Trin 3.4) Kan ikke bestemme terminal placering af dendritter Alexafluor har ikke haft tilstrækkelig tid til at diffundere gennem cellen eller koncentrationen af ​​Alexafluor er ikke høj nok Kontrollér for at sikre, at forstærkning og eksponeringstid på kameraet er høj nok. Vent en ekstra 5 minutter før visualisering af dendritter. Hvis dendritter stadig ikke er synlige, skal du lave opløsning med højere Alexafluorkoncentration.
Trin 4.1) Kan ikke aspirere hele cytoplasma
Trin 5.5) Supernatant er ikke klart efter 8 minutter Forsigtigt pipetter hele opløsningen to gange, mens den stadig er på magnetisk separator, og lad sidde i yderligere 5 min
Trin 5.5) Pellet dispergeres under pipettering Prøven er for langt fra magnet Hold rør på magnetisk adskillelsesindretning under hele pipetteringen. Udstød opløsningen og lad perlerne pille igen i 5 minutter
Trin 5.7) Efter 5 min vises prøver stadig blanke Maksimal mængde EtOH er ikke fjernet Fortsæt med at overvåge prøver under tørring. Hver 2 min. Brug en P10 pipette og fjern alt EtOH i bunden af ​​røret
Trin 8.9) Pellet havde revner før rehydrering Tillad prøve at rehydSats for i alt 4 minutter, i stedet for 2 (trin 8.10)
Trin 8.11) Lille mængde perle blev bragt op med supernatant Skub hele prøven ud i rør og sæt den på magnetisk separator i 1 min. Pipet forsigtigt op og sørg for at undgå piller
Trin 8.12) DNA-udstrygninger er inkonsekvente, og fluorescensskala ændres løbende For høj DNA-koncentration for en HS-chip Kontroller koncentration af prøve og fortynd mellem 1 - 10 ng / μL. Rerun bioanalyzer
Trin 8.12) Smøremiddel med lav molekylvægt RNA nedbrydning Sørg for at blinse fryseren celle umiddelbart efter indsamling. Kassér dette cDNA-bibliotek
Trin 8.12) Fluktuerende markørbaseline i kontrolvej Forurening eller gammelt reagens Kassér DNA-markør og brug nyt rør til Bioanalyzer-løbe
Trin 8.12) Ingen DNA smear Manglende udvisning af celle Træk nye nåle med et lidt større spids
RNA-perlefejl Sørg for, at perlerne har været fuldt resuspenderet før brug, og lad prøverne inkuberes, før de placeres på magnetisk separator
Trin 8.12) Svagt DNA-smear Ikke nok forstærkning Brug flere PCR-cyklusser
Trin 8.12) DNA smear uden for 500bp-2Kb rækkevidde DNA-smører under 0,5 og over 2 Kb er sandsynligvis forurening. Kassér prøve
Trin 8.12) Regelmæssigt fordelte pigge på DNA-spor Forurening af prøve Brug altid friske handsker og lav ny ethanol til skylning; Filtertips skal altid bruges
Trin 9.3) Kan ikke påvise koncentration af prøve på fluorometer Prøver under detektionsniveau har for lidt DNA til tagmentering og kan ikke anvendes
Trin 10.10) Prøverne er ikke tørre efter 10 minutter Fortsæt med at fjerne overskydende EtOH Tillad prøver at lufttrykke længere, kontroller dem hvert minut
Trin 10.13) Smøre skæv mod 2Kb Ufuldstændig fragmentering Genfortyndet prøve til en koncentration på 0,15 ng / μl, snarere end 0,2 ng / μl; Rerun tagmentation
Trin 10.13) Smøre skæv mod 200bp For lidt DNA input Fortynd prøve mindre, prøv en koncentration på 0,4 ng / μL; Rerun tagmentation
Tagmenteringsreaktion for lang Reducer reaktionstid for mærkning til 8 minutter
Trin 10.13) Svage udtværinger Forkert amplifikation af DNA
Trin 11.2) Maksimal opnåelig poolkoncentration er under 5 nM Identificer hvilken prøve (r) der har signifikant lave koncentrationer og genindvinding med ny fortynding

Tabel 1: Løsninger og forslag til potentielle hindringer i protokollen. Denne tabel viser potentielle vanskeligheder, der kan opstå under denne protokol, og de trin, hvorpå man kan støde på dem. Denne tabel indeholder mulige årsager til mange af disse problemer samt løsninger, der kan hjælpe med at løse eventuelle problemer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vores protokol viser ved hjælp af en hurtig og nem at bruge vejledning en metode til at forberede enkeltceller af identificerede morfologiske klasser til højkvalitets sekventering med lidt beskadigelse af prøven. I det nuværende manuskript er iboende lysfølsomme retinale ganglionceller morphologisk karakteriseret, isoleret og fremstillet for RNA-Seq. Cellulære påvirkninger kan forekomme under retinal håndtering; Af denne grund udskifter vi hvert stykke væv efter højst 4 timers brug. Vi kan vurdere tilstanden af ​​cellerne ved hjælp af elektrofysiologi rig til at optage fra disse celler og overvåge deres svar, hvilket gør os i stand til at sikre, at cellerne har et godt helbred. Vores protokol tillod generering af succesrige cDNA-biblioteker fra 15 ud af 23 prøver behandlet, hvilket gav en succesrate på 65%. Endvidere var kvaliteten af ​​vores sekventeringsdata fremragende, da det gennemsnitlige antal gener udtrykt af vores celler varierede fra 2.316-10.353 med et gennemsnit på 5.683Gener registrerer med en ikke-nul FPKM værdi. Disse tal svarer til udtrykte gental, som findes i andre undersøgelser af neuroner 5 , hvilket viser, at vores data også er af god kvalitet.

Selv om vi har haft succes med denne protokol for disse specifikke neuroner, skal det bemærkes, at mindre ændringer af denne teknik kan anvendes til en række forskellige applikationer. Ved hjælp af fluorescensaktiveret cellesortere (FACS) inden for en separat musemodel har vi isolerede små populationer af celler (1.000-25.000) mærket med en GFP-markør fra centralnervesystemet. RNA fra disse populationer blev isoleret, og 1 μl (ved eller lidt under 12 ng / μl) af dette RNA blev anvendt til at starte revers transkriptionen i trin 6.1. Den eneste tilpasning, der skal foretages til protokollen efter dette trin, forekommer i trin 7.4, på hvilket tidspunkt man kan vælge at anvende færre PCR-cyklusser. Vi har brugt 19 cykler i tilfælde, hvor den indledende prøve indeholdt gReater end 10.000 celler og har fundet ud af, at dette producerer cDNA-biblioteker af god kvalitet. Celleprøver blev for eksempel fremstillet ud fra en FACSorteret population, og antallet af gener udtrykt varierede fra 12.340-14.052 med et gennemsnit på 13.265 gener med en ikke-nul FPKM-værdi. Denne teknik kan anvendes til forskellige musemodeller, for hvilke en fluorescerende reporter er til stede. På grund af dette ændringsforslag kunne forskere potentielt studere enhver cellepopulation, for hvilken der er en fluorescerende reportermus, der udvider undersøgelser forbi området neuronal mangfoldighed.

En anden tilpasning kan foretages til profilceller baseret på funktionalitet i stedet for bare morfologi. Dette projekt er baseret på en transgen model, men denne teknik kan anvendes til neuroner uden kendte molekylære identifikatorer. For eksempel er der over 30 funktionelle subtyper af retinale ganglionceller, der for tiden er identificeret 27 , hvoraf meget få har unikke markører. Som denne teknikAfhænger allerede af en elektrofysiologigirektorat til cellepåfyldningen, kunne man anvende patchspænde til at identificere den funktionelle responsprofil for hver celle baseret på dens spikningsmønster. Ved anvendelse af lysfremkaldte spikes optagelser kunne klassificeringen af ​​retinale neuroner bestemmes forud for celleisolering. Denne teknik virker på retinale ganglionceller, men det kan udvides til at undersøge andre retinale neuroner. Det skal imidlertid bemærkes, at hvis denne protokol anvendes til at skrive retinale bipolære eller amacrine celler i det indre nukleinslag, skal man for eksempel være forsigtig med at tilvejebringe konstant positivt tryk ved elektrodens spids for at undgå at kontakte celler som Elektroden passerer gennem ganglioncellelaget og det indre plexiformlag. For retinale neuroner inden for det indre nukleare lag vil forberedelsen af ​​retinalsektioner forud for cellulære optagelser sandsynligvis virke bedst for konsekvent at undgå forurening. Hver celle ville blive isoleret og fremstillet som beskrevet heri efter claSsification step. Desuden foreslår vi brugen af ​​denne protokol til undersøgelse af neuroner, men denne teknik kan anvendes på enhver celletype, som kan morphologisk karakteriseres eller isoleres ved brug af en transgen model.

Denne teknik kan også modificeres til at virke med tidligere fremstillede cDNA-biblioteker, som vi tidligere har genereret til mikroarray-hybridisering 28 . Med et separat forberedt bibliotek begynder man med cDNA-mængder i området 50-150 ng og starter protokollen i trin 8.4; Højere og lavere koncentrationer er ikke forsøgt, selvom de måske fungerer også. Rensning af cDNA'et under anvendelse af DNA-perler ville forekomme først efterfulgt af tagmentering og PCR-amplifikation. Vi har testet denne justering med cDNA fra bibliotekspræparater, såsom dem til mikroarray-hybridisering 29 og har succesfuldt produceret tagmenterede biblioteker for RNA-Seq.

finAllieret kan denne protokol anvendes til vurdering af succesen af ​​en bestemt induktion af cellepopulationer fra inducerede pluripotente stamceller (iPSCs). Kraften bag differentieringen af ​​disse omprogrammerede pluripotente celler er baseret på en forståelse af de transkriptionsfaktorer, der fører celletyper til at udvikle sig adskilt fra hinanden. At køre iPSCs mod bestemte celleforløb er en ny metode til at studere neuronal mangfoldighed, da den kan bruges til selektivt at generere celletyper. Denne protokol kan tilpasses til at vurdere kvaliteten af ​​mangfoldigheden blandt differentierede celler fra denne model. Som tidligere nævnt er der mere end 30 funktionelle subtyper af retinale ganglionceller, og der er blevet gjort mange forsøg på at generere funktionelle RGC'er fra iPSCs. Identifikationen af ​​markører for subtyper af RGC'er - i vores tilfælde, ipRGCs - vil give forskeren mulighed for at evaluere succesen med deres protokol ved fremstilling af forskellige undertyper af RGC'er. Evalueringen af ​​celletyperBlandt disse neuroner ville være omfattet af denne protokol og kan også tjene som et redskab til fortsat undersøgelse af subtypespecifikke markører, da dette model system bliver let tilgængeligt.

I det nuværende manuskript beskriver vi en simpel teknik til isolering og fremstilling af enkeltceller til transkriptomisk analyse. Desuden foreslår vi måder at redigere protokollen på, så denne teknik kan bruges til en lang række eksperimenter med en række mål i tankerne. Protokollen beskrevet her blev tilpasset fra en protokol beskrevet af Trombetta et al. 24 som en justering af de anbefalede kit instruktioner for lav-input RNA-Seq. De væsentligste forskelle ligger inden for celleisolering og forskellige volumetriske ændringer, som vi har valgt til bedst at passe til dette projekts behov. Det er vigtigt at fremhæve, at det vigtigste trin i denne protokol er isoleringen af ​​celler fra nethinden. Dette er punktet i protokollen durinG som de fleste fejl kan opstå, og det skal udføres med den mest omhyggelige opmærksomhed. Enhver mængde kontaminering kan resultere i ubrugelige prøver, mens tabet af cytoplasma kan forårsage en alvorlig udtømning af mRNA-molekyler. Dette trin bør udføres med omhu og af samme person fra forsøg til at eksperimentere for at sikre, at prøverne er blevet håndteret præcist.

Sammenfattende beskriver denne protokol en teknik til klassificering, isolering og fremstilling af celler til høj kvalitet RNA-Seq. Dette er en effektiv, forholdsvis billig måde at optimere kvaliteten af ​​data fra enkeltceller. Denne teknik er alsidig og kan minimeres mod til anvendelse til forskellige undersøgelser.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi vil gerne anerkende Jennifer Bair og Einat Snir, såvel som University of Iowa Institute for Human Genetics, for deres hjælp til at forberede og håndtere prøver.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics