Single-cell RNA-Seq de subgrupos definidos de células de gânglio retiniano

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos uma abordagem combinatória para classificar tipos de células neuronais antes do isolamento e para a caracterização subsequente de transcriptomas de célula única. Este protocolo otimiza a preparação de amostras para o bem sucedido RNA Sequencing (RNA-Seq) e descreve uma metodologia projetada especificamente para a compreensão melhorada da diversidade celular.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Laboissonniere, L. A., Sonoda, T., Lee, S. K., Trimarchi, J. M., Schmidt, T. M. Single-cell RNA-Seq of Defined Subsets of Retinal Ganglion Cells. J. Vis. Exp. (123), e55229, doi:10.3791/55229 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A descoberta de marcadores específicos de tipo de célula pode fornecer insight sobre a função celular e as origens da heterogeneidade celular. Com um impulso recente para a compreensão melhorada da diversidade neuronal, é importante identificar genes cuja expressão define várias subpopulações de células. A retina serve como um excelente modelo para o estudo da diversidade do sistema nervoso central, pois é composta de vários tipos de células principais. O estudo de cada uma das principais classes de células produziu marcadores genéticos que facilitam a identificação dessas populações. No entanto, existem vários subtipos de células dentro de cada uma destas classes de células principais da retina, e poucos destes subtipos têm marcadores genéticos conhecidos, embora muitos tenham sido caracterizados por morfologia ou função. Um conhecimento dos marcadores genéticos para os subtipos retinais individuais permitiria o estudo e mapeamento de alvos cerebrais relacionados com funções visuais específicas e também pode dar uma visão das redes genéticas queManter a diversidade celular. As vias actuais utilizadas para identificar os marcadores genéticos de subtipos possuem inconvenientes, tais como a classificação de tipos de células após sequenciação. Isso representa um desafio para a análise de dados e requer métodos de validação rigorosos para garantir que os clusters contenham células da mesma função. Propomos uma técnica para identificar a morfologia e a funcionalidade de uma célula antes do isolamento e seqüenciamento, o que permitirá a identificação mais fácil de marcadores subtipo-específicos. Esta técnica pode ser alargada a tipos de células não neuronais, bem como a raras populações de células com pequenas variações. Este protocolo produz dados de excelente qualidade, uma vez que muitas bibliotecas forneceram profundidades de leitura superiores a 20 milhões de leituras para células individuais. Esta metodologia supera muitos dos obstáculos apresentados por Single-cell RNA-Seq e pode ser adequado para pesquisadores com o objetivo de perfil tipos de células de uma maneira simples e altamente eficiente.

Introduction

A diversidade neuronal é observada em todo o sistema nervoso central, particularmente na retina dos vertebrados, um tecido altamente especializado consistindo em 1 tipo glial e 6 tipos de células neuronais que surgem de uma população de células progenitoras da retina 1 , 2 , 3 . Muitos subtipos de células podem ser classificados funcionalmente, morfologicamente e geneticamente. O objectivo deste protocolo é ligar a variabilidade genética dos tipos de células às suas características funcionais e / ou morfológicas identificáveis. Vários genes foram identificados para a classificação de células, mas muitos subtipos continuam a não ser caracterizados, uma vez que representam uma pequena fracção da população total. A identificação de genes dentro destes subtipos específicos permitirá uma maior compreensão da diversidade neuronal dentro da retina e também pode lançar luz sobre a diversificação de células neurais em outro lugar. FuAlém disso, os estudos monocelulares permitem a descoberta de novos tipos de células, que podem ter sido negligenciadas devido à sua baixa representação entre a população global 4 , 5 , 6 , 7 .

Um dos benefícios da transcriptômica monocelular é que marcadores únicos ou combinações de marcadores que definem um subtipo celular particular podem ser descobertos. Estes podem então ser utilizados para obter acesso genético a esse tipo de célula para diferentes manipulações. Por exemplo, estamos usando este protocolo para caracterizar os genes específicos do tipo celular de um subconjunto de células ganglionares retinianas que expressam a fotopigmentação melanopsina. O uso de um marcador fluorescente em células de gânglio retiniano que expressam melanopsina permite o estudo destas células, uma vez que são agrupadas em conjunto devido à sua expressão de um gene conhecido. Curiosamente, existem cinco subtipos conhecidos desta célula popuLação na retina do rato 8 . Assim, para isolar ARN de células de cada tipo, utilizamos classificações morfológicas estabelecidas dentro do modelo transgénico para identificar cada subtipo antes do isolamento celular. Esta técnica permite a caracterização das células bem como o seu isolamento directamente a partir da retina, sem a necessidade de dissociação do tecido, o que pode causar uma resposta ao stress dentro das células e contaminação devido a dendrites cortados 9 .

Uma multidão de novas técnicas vieram à luz nos últimos anos como o método RNA-Seq continua a desenvolver. Estas ferramentas permitem maximizar a aquisição de células e maior eficiência de custos ao abordar a questão 4 , 7 , 10 , 11 , 12 , 13 . No entanto, enquantoEstas técnicas têm sido excelentes pedras, há uma série de obstáculos ainda encontrou que este protocolo é capaz de endereço. Primeiro, muitos dos procedimentos atuais isolam as células de tecido dissociado e tentam usar a análise de componentes principais ou agrupamento hierárquico pós-hoc para determinar a classificação celular. Confiar nestas ferramentas para classificar subtipos pode não produzir resultados fiáveis ​​e pode forçar um a encontrar novas formas de validar estes dados para a correlação de um marcador genético para um tipo de célula funcional. O requisito para dissociação em outros protocolos pode por vezes resultar em danos ao tecido e pode causar processos neuronais a ser cortado, resultando em uma perda potencial de mRNA. Al� disso, em prepara�es de c�ulas dissociadas, as respostas de tens� podem começar a afectar os transcriptomas destas c�ulas 14 . Este protocolo supera estes desafios, determinando o tipo de célula funcional antes do isolamento, e mantém melhor a hA conservação do tecido retiniano intacto.

Uma técnica foi introduzida em 2014 e consistiu na análise in vivo do transcriptoma de células vivas 15 . Embora esta técnica permita o exame do transcriptoma com uma interrupção mecânica mínima no tecido, carece da capacidade de classificar tipos de células específicos dentro do tecido antes de examinar os seus transcriptomas sem utilizar um rato repórter muito específico. Nosso protocolo não requer um repórter específico, pois utilizamos preenchimento celular e eletrofisiologia para caracterizar as células antes do seu isolamento. Outra limitação deste protocolo anterior é que requer um comprimento de onda específico para excitar o elemento fotoactivável, enquanto que o nosso protocolo permite a utilização de um repórter fluorescente e corante fluorescente, que estão prontamente disponíveis ou podem ser escolhidos individualmente por cada laboratório. Ainda, outros laboratórios casaram os dois métodos de elétrFisiologia e transcriptômica para o estudo da diversidade celular. O uso de gravações de patch-clamp para caracterizar a função de uma célula antes do seu isolamento foi realizado em neurónios dissociados 16 e, em alguns casos, precedeu o uso de análise de microarranjos 17 para estes estudos. As mesmas complicações são encontradas por essas abordagens, pois requerem dissociação de tecidos ou o uso de tecnologia de microarray, que depende da hibridização de amostras para sondas disponíveis. Um dos avanços mais recentes tem sido o desenvolvimento de Patch-Seq, uma técnica que combina o uso de gravações patch-clamp e tecnologia RNA-Seq para entender as células de todo o cérebro fatias [ 18] . Embora esta técnica tenha suas semelhanças com o protocolo apresentado aqui, é novamente importante notar que nossa abordagem permite que o tecido permaneça intacto para a saúde das células. Aqui, apresentamos um protocolo para otimizarDessa aliança, que gera bibliotecas de célula única de alta qualidade para o uso de RNA-Seq para obter uma alta profundidade de leitura e cobertura de mapeamento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os procedimentos foram aprovados pelo Comitê Institucional de Cuidados e Uso de Animais (IACUC) da Northwestern University.

1. Preparação de soluções para electrofisiologia (4 h)

  1. Fazer 0,1% de H 2 O tratado com DEPC por adição de 1 mL de pirocarbonato de dietilo (DEPC) a 999 mL de H 2 O purificado por osmose reversa. Misture bem e deixe a mistura incubar durante 1 h à temperatura ambiente (RT). Em seguida, autoclave o H 2 O misturado com DEPC durante 15 min num ciclo de líquido. Deixar arrefecer a H 2 O tratada com DEPC à temperatura ambiente.
  2. Fazer a solução extracelular misturando uma garrafa de meio de Ames e 1,9 g (23 mM) de bicarbonato de sódio em 1 L de H2O. Bolha a solução extracelular com
    95% de O 2 /5% de CO2 e mantê-lo a um pH de 7,3-7,4.
  3. Gere a solução intracelular combinando 125 mM de K-gluconato, 2 mM de MgCl2, 10 mM de EGTA, 10 mM de HEPES e 0,1% de DEPC tratado com H2 O. Armazenar em alíquotas de 1 mL a -20 ° C. Adicionar 10 μM de marcador fluorescente no início de cada experiência.
  4. Faça a solução enzimática adicionando 10.000 unidades de colagenase e 83 mg de hialuronidase a 4.15 mL de solução extracelular. A solução enzimática deve ser armazenada em alíquotas de 50 μL a -20 ° C.

2. Preparação de tecido retiniano (2 h)

NOTA: Todos os procedimentos nesta seção devem ser executados sob iluminação vermelha escura

  1. Adaptar escuro os animais durante pelo menos 1 h antes da dissecção. Execute todos os procedimentos sob iluminação de vermelho escuro.
  2. Eutanizar os animais por asfixia com CO 2 e enuclear os globos oculares em uma placa de Petri com solução extracelular previamente oxigenada.
  3. Empurrar a córnea com uma agulha e cortá-la cortando com tesoura oftálmica na borda da córnea e esclera 19 .
  4. Remova a lente usando# 5 pinças. Gentilmente fazer uma lágrima na esclera com a pinça e cortar o nervo óptico onde a retina ea esclera se encontram. Cuidadosamente terminar removendo a esclera da retina.
  5. Remova o vítreo transparente usando pinças # 5; Uma vez removido, o vítreo aparece como uma substância gelatinosa presa à pinça. Cortar as retinas ao meio (de modo que haja 4 pedaços / animal) e armazená-las em solução extracelular oxigenada à RT até o uso.
  6. Quando estiver pronto para montar o tecido na câmara de registo, coloque um pedaço de retina para incubar em solução de enzima diluída em 500 μL de solução extracelular oxigenada. Incubar em uma placa de Petri por 2 min à RT em um agitador.
    1. Lave o pedaço de retina em solução extracelular oxigenada e coloque o tecido em uma câmara de gravação de fundo de vidro; Use uma pipeta de transferência de plástico com a ponta cortada para permitir que a retina seja transferida sem causar danos ao tecido.
  7. Use paraCeps para aplainar cuidadosamente o tecido com a camada fotorreceptor voltada para baixo. Remova o excesso de fluido usando uma pipeta. Ande o tecido usando um anel de platina com malha de nylon.
    NOTA: Este método também pode ser utilizado para preparar o tecido para o isolamento de RNA de amacrina marcada e células bipolares.
  8. Encha a câmara com solução extracelular oxigenada e monte-a em um estágio de microscópio. Perfundir o tecido com solução extracelular oxigenada a 2-4 mL / min.

3. Visualização e Focalização de GFP + Células de Gânglio Retinais (10 min)

NOTA: Todos os procedimentos nesta seção devem ser executados sob iluminação vermelha escura

  1. Antes de começar, puxe as micropipetas de vidro (OD: 1,2 mm, ID: 0,69 mm) para gravações eletrofisiológicas usando um extrator de micropipeta. Utilize o seguinte protocolo para os eléctrodos (por favor, note que os parâmetros devem ser ajustados em conformidade para obter a resistência desejada eVariar entre os extratores e com vidro diferente): Calor: Rampa +10; Puxar: 0; Vel: 23; Atraso: 1; Pressão: 500; Programa loop: 5 vezes. Certifique-se de que as pontas são de 1 μm de diâmetro, com resistências de 2-4 MΩ para direcionamento de células grandes e de 5-7 MΩ para direcionamento de células menores.
  2. Observe a camada de células ganglionares usando a óptica de contraste de interferência diferencial de infravermelho (IR-DIC) ( Figura 1A ). Identificar GFP + células de gânglio retiniano (RGCs) usando epifluorescência (~ 480 nm) ( Figura 1B ).
  3. Localize a pipeta cheia com solução intracelular em DIC. Aplique uma leve pressão positiva e zero quaisquer deslocamentos de tensão no amplificador.
  4. Pressione a micropipeta de vidro contra uma célula GFP + e aplique pressão negativa para formar uma vedação GΩ entre a pipeta ea membrana celular. Aplicar etapas de comando de tensão de teste ( por exemplo, 5 mV) para monitorar a resistência do vedante. Depois de formar uma vedação estável, rompa a membrana aplicando breves pulsos de nPressão negativa para ganhar acesso de célula inteira.
  5. Aguarde 1-2 min para os dendritos da célula para preencher com marcador fluorescente.
    NOTA: A célula pode ser morfologicamente tipificada examinando a morfologia em epifluorescência ( Figura 1C ). No caso de RGCs que expressam melanopsina, a estratificação dendrítica na camada plexiforme interna é visualizada examinando os dendritos cheios com marcador fluorescente sob iluminação epifluorescente e determinando se estratificam longe do soma na sublamina OFF (M1 ipRGCs), próximo ao gânglio Camada celular na sublamina ON (M2 & M4 ipRGCs), ou ambos (M3 ipRGCs). Esta observação, combinada com o tamanho do soma (M4s têm somas distintamente grandes comparadas com todos os outros subtipos de ipRGC), permitem a identificação do tipo de célula 20 , 21 , 22 . Assim, esta técnica permite a identificação do tipo de célula in vitro antes do iso do RNALação. Este m�odo pode ser modificado para outros protocolos de identifica�o de tipos de c�ulas envolvendo morfologia dendr�ica ou fisiologia celular.

4. Isolamento celular (2 min)

  1. Antes de começar, coloque a microcentrífuga de mesa em 2.000 x g. Prepare um aparelho de expulsão de amostras conectando a tubulação (OD: 3/32 in, ID: 1/32 in) com uma seringa de 1 cc.
  2. Colocar tubos de PCR de 0,2 mL contendo 10 μL de tampão de lise e 1% de β-mercaptoetanol em gelo. Preparar uma seringa de 1 cc contendo H2O tratada com DEPC para enxaguar as pontas da pipeta. Preparar um recipiente de gelo seco para congelar o tampão de lise após a coleta da amostra.
  3. Extrair cuidadosamente o conteúdo citoplasmático da pipeta celular aplicando pressão negativa utilizando uma seringa de 10 ml; Todo o conteúdo citoplasmático, incluindo organelas, deve ser extraído se possível.
    1. Monitorar a extração em DIC, visualizando o corpo celular decrescente em tamanho. Depois de extrair O conteúdo citoplasmático, levantar a pipeta cuidadosamente fora do tecido e rapidamente remover a pipeta da solução.
  4. Retire rapidamente a pipeta do suporte da cabeça e enxágüe a ponta da pipeta brevemente com H 2 O tratada com DEPC usando uma seringa de 1 mL. Conecte a pipeta a uma seringa de 1 mL através de tubulação apertada para expelir a amostra.
  5. Expulsar imediatamente as células em 10 μL de tampão de lise 1 contendo 1% de β-mercaptoetanol em tubos de PCR de 0,2 mL.
    NOTA: O aspirado inteiro com as células deve ser expelido suavemente para não introduzir bolhas.
    1. Centrifugar rapidamente o tubo numa mini centrífuga de mesa a 2.000 xg durante 10 s. Congelar imediatamente as amostras durante 5 min em gelo seco. Após o congelamento, guarde-os a -80 ° C por até duas semanas para obter melhores resultados; As amostras podem durar mais tempo, mas recomenda-se que sejam processadas o mais rapidamente possível.
E "> 5. Purificação de RNA (30 min)

  1. Antes de começar, configure um dispositivo separador magnético, tapando a parte superior de um suporte de ponta invertida P20 ou P200 para o suporte magnético de 96 poços 23 .
  2. Preparar etanol fresco a 70% (EtOH) - aproximadamente 1 mL por amostra será suficiente. Remover as esferas magnéticas de RNA de armazenamento a 4 ° C e descongelá-los à temperatura ambiente durante pelo menos 30 min.
    NOTA: Não mais do que 8 amostras devem ser processadas ao mesmo tempo, como muitos passos neste protocolo dependem de eficiência e manipulação rápida.
  3. Uma vez que as pérolas magnéticas estão à temperatura ambiente, agite durante 30 s para assegurar que a solução está bem misturada.
    NOTA: As esferas utilizam um tampão específico de ARN para ligar selectivamente o ARN e permitem a remoção de outros resíduos celulares quando utilizados com um suporte de placa magnética.
  4. Descongelar as células à RT durante 1 min, e depois adicionar 5 μL de H 2 O isenta de ARNase a cada amostra; Pipeta para cima e para baixo. Adicionar 22 μL de esferas de RNA a cada tubo e pipettE completamente misturar. Incubar as amostras à RT durante 5 min para permitir que o RNA interaja e se ligue com as esferas magnéticas.
  5. Coloque os tubos em um separador magnético e deixe descansar por 8 min; Antes de prosseguir, assegurar que o sobrenadante esteja limpo. Observe os grânulos de uma pastilha e certifique-se de não destacá-la durante a pipetagem.
  6. Remover o sobrenadante das amostras e adicionar 150 μL de EtOH a 70%. Remover o EtOH e repetir a lavagem duas vezes mais.
  7. Deixar as amostras secarem ao ar durante 6 min. Verificar intermitentemente para ver se mais EtOH tem coletado na parte inferior do tubo. Remova-o adequadamente.
  8. Enquanto as amostras estão a secar, preparar tampão de reacção 10X combinando 19 μL de tampão de lise 2 e 1 μl de Inibidor de RNase (40 U / μL). Girar brevemente para baixo e mantê-lo no gelo.
  9. Uma vez que as amostras estão secas e os grânulos de grânulo não mais aparecem brilhantes, remova os tubos do separador magnético e adicione 9,5 μL de H 2 O livre de RNasePara rehidratar as amostras. Colocar as amostras em gelo e adicionar 1 μL de tampão de reacção 10x a cada amostra.

6. Transcrição reversa (10 min)

NOTA: Antes de iniciar, descongelar os reagentes necessários para a transcrição reversa (RT, excepto para a enzima) em gelo. Estes incluem: iniciador II, tampão 1, oligonucleótido e inibidor de RNase.

  1. A cada tubo adiciona-se 2 μL de iniciador II (AAGCAGTGGTATCAACGCAGAGTACT (30) N -1 N, para o qual N- 1 pode ser A, C ou G e N pode ser A, C, G ou T; 12 μM). Coloque os tubos num termociclador que tenha sido pré-aquecido a 72 ° C durante 3 min.
  2. Durante a incubação, preparar a mistura mestre RT. Para cada reacção, adicionar 4 μL de tampão 1 (Tris-HCl 250 mM, pH 8,3, KCl 375 mM e MgCl2 30 mM), 1 μL de oligonucleótido (48 μM) e 0,5 μL de inibidor de RNase (40 U / ΜL).
  3. Imediatamente após a incubação, colocar os tubosGelo durante 2 min.
  4. Adicionar 2 μL por reação da transcriptase reversa (100 U / μL) à mistura principal e pipeta completamente. Adicionar 7,5 μL de mistura principal a cada tubo e misturar por pipetagem suave. Girar brevemente os tubos para recolher o conteúdo no fundo e colocá-los num termociclador pré-aquecido com o seguinte programa: 42 ° C durante 90 min, 70 ° C durante 10 min e uma retenção a 4 ° C.
  5. Armazenar os tubos a -20 ° C / N antes de prosseguir, embora se recomenda que as amostras sejam transportadas através do passo de amplificação antes de serem armazenadas por longos períodos de tempo; Outras fontes sugerem armazenamento O / N a 4 ° C também seria aceitável neste passo 24 .

7. Amplificação de cDNA (2,5 h)

NOTA: Antes de iniciar, descongelar o tampão de PCR eo iniciador de PCR no gelo e girar os tubos para baixo em uma mini centrífuga de mesa antes de fazer a mistura principal de PCR.

  1. Para cada reação, pReparar uma mistura principal de PCR contendo 25 μL de tampão de PCR, 1 μL de iniciador de PCR (12 μM), 1 μL de DNA polimerase e 3 μL de H 2 O livre de nuclease. Adicionar a ADN polimerase em último lugar, imediatamente antes da adição Mistura mestre para as amostras.
  2. Adicionar 30 μL de mistura principal a cada tubo e centrifugar a 2000 xg durante 10 s para recolher o conteúdo na parte inferior dos tubos.
  3. Colocar os tubos num termociclador pré-aquecido com o seguinte programa: 95 ° C durante 1 min; 34 ciclos de 98 ° C durante 10 s, 65 ° C durante 30 s, e 68 ° C durante 3 min; 72 ° C durante 10 min; E uma retenção a 4 ° C.
    NOTA: O número de ciclos para esta PCR foi aumentado para 34, diferindo das instruções do fabricante sugeridas. Depois de repetir o teste, este número de ciclo foi encontrado para produzir resultados consistentemente fiáveis.
  4. Armazenar os tubos a -20 ° C por até um ano antes de prosseguir.

8. Purificação de cDN amplificadoA (30 min)

  1. Antes de iniciar a purificação, levar as esferas de ADN e o tampão de eluição à RT durante pelo menos 30 min. Preparar 80% de EtOH fresco; 1 mL por amostra deve ser suficiente. Adicionar 1 μL de tampão de lise 10X a cada amostra.
  2. Vortex as esferas de ADN durante 30 s e adicione 50 μL de esferas de ADN a cada amostra. Misture bem pipetando e, em seguida, gire-os rapidamente para baixo a 2.000 xg por 10 s. Incubar os tubos à TA durante 8 min.
  3. Colocar os tubos no dispositivo de separação magnética durante 5 min. Pipetar cuidadosamente o sobrenadante para cima e para baixo duas vezes e deixar as amostras para sentar durante 2 min. Enquanto as amostras estão no dispositivo magnético, remova o sobrenadante e descarte.
  4. Adicionar 150 μL de EtOH 80% fresco a cada amostra e deixar-se sentar à temperatura ambiente durante 30 s. Remover o EtOH e repetir a lavagem EtOH uma vez.
  5. Girar brevemente as amostras e colocá-las novamente no separador magnético durante 1 min. Remova qualquer restante EtOH e deixe as amostras ao ar seco durante 5 min.
  6. Uma vez que o grânulo do grânulo não aparece mais brilhante, mas antes que as fissuras comecem a aparecer, retire o tubo do separador magnético e adicione 17 μL de tampão de eluição. Pipie suavemente para cima e para baixo para ressuspender as contas completamente.
  7. Incubar as amostras ressuspensas à RT durante 2 min.
  8. Girar brevemente as amostras para recolher todo o líquido no fundo e colocá-las no separador magnético durante 2 min. Transfira 15 μL de sobrenadante claro para um tubo livre de 1,5 mL de RNase e guarde-o a -20 ° C.
  9. Examine a qualidade eo tamanho da biblioteca de cDNA com um chip de bioanalyzer de alta sensibilidade usando 1 μL de cDNA. O tamanho ideal de uma biblioteca de cDNA é 0,3-2 Kb, com uma concentração de pelo menos 10 ng / μL ( Figura 2 ).
    NOTA: Você pode optar por empregar PCR como uma forma de amostras de tela para garantir a expressão de marcadores conhecidos antes de prosseguir com amostra prSeparação.

9. Determinar concentrações e ADNc de marcação (20 min)

  1. Antes de começar, leve o reagente de ensaio, o tampão de diluição e os padrões à RT durante 30 min. Preparar uma mistura principal contendo 1 μL de reagente de ensaio e 199 μL de tampão de diluição por reacção. Alíquota de 199 μL desta mistura em tubos de ensaio de 500 μL. Adicione 1 μL de amostra e misture bem.
  2. Alíquota de 190 μL de mistura principal para o tubo 1 e 2. Adicionar 10 μL do padrão 1 ao tubo 1 e 10 μL do padrão 2 ao tubo 2. Vórtice todos os tubos de amostra e tubos padrão durante 5 s; Incubar à TA durante 3 min.
  3. Determine a concentração de amostras com um fluorómetro de alta sensibilidade. Certifique-se de que a quantidade de amostra correta tenha sido introduzida selecionando a opção "calcular solução de estoque" e destacando "1 μL". Diluir cada amostra num tubo separado de 1,5 mL até uma concentração final de 0,2 ng / μL em H 2 O livre de ARNase.
    NOTA:Considerando que as instruções do fabricante sugerem que se deve começar com 1 ng / μL de ADN total, utilizámos um montante de partida mais pequeno e também ajustámos o protocolo para ter em conta esta alteração.
  4. Em novos tubos de PCR de 0,2 mL, pipetar 2,5 μL de tampão 2. Adicionar 1,25 μL de cDNA ao tubo apropriado para um total de 250 pg. Finalmente, adicione 1,25 μL de mistura de marcação a cada tubo e pipetar cuidadosamente para misturar; A transposase dentro da mistura de marcação fragmentará o ADN em cadeias curtas e recozirá os adaptadores a cada extremidade de cada cadeia, para utilização posterior pelo instrumento de sequenciação.
    NOTA: Os volumes utilizados para a codificação e acoplamento de índice são uma fração da quantidade sugerida pelas instruções do fabricante. Isto não só permite a conservação de reagentes, mas também tem consistentemente produzido amostras marcadas em nossa experiência.
  5. Centrifugar os tubos em uma microcentrífuga de bancada durante 1 min.
  6. Coloque os tubosNum termociclador pré-aquecido com o seguinte programa: 55 ° C durante 10 min e uma retenção a 10 ° C.
    NOTA: O comprimento desta incubação é de 10 min, em oposição aos 5 min propostos a partir das instruções do fabricante.
  7. Imediatamente após a conclusão deste programa, remova os tubos e adicione 1,25 μL de tampão de neutralização de marcação a cada um. Pipetar bem para misturar e incubar à TA durante 5 min. Completar este passo prontamente, como a transposase permanece ativa até que o tampão neutraliza a enzima e pára a reação.

10. Acoplamento Indexado e Purificação (1 h)

NOTA: Antes de começar, leve as esferas de ADN e o tampão de ressuspensão à RT durante pelo menos 30 min. Decida quais índices usar para cada uma das amostras.

NOTA: Estes índices serão ligados às respectivas extremidades 5 'e 3' do ADN fragmentado para a identificação das amostras após sequenciação. Certifique-se que não há doisOs emparelhamentos são os mesmos para amostras que podem ser sequenciadas em conjunto. Por exemplo, se a amostra 1 usar os índices branco 1 e laranja 1, a amostra dois deve usar branco 1 e laranja 2 ou branco 2 e laranja 2, mas nunca a mesma combinação de índices. Este kit contém 4 diferentes índices brancos e 6 diferentes laranja. Todas as combinações possíveis diferentes permitem que até 24 amostras sejam agrupadas em uma pista de seqüenciamento. Embora tipicamente apenas juntem 10 amostras numa pista, também se pode usar o kit contendo 24 índices, o que permitiria o agrupamento de 96 amostras numa única via de sequenciação, se desejado.

  1. Para cada tubo, adicione 1,25 μL do índice esquerdo e 1,25 μL do índice direito para essa amostra específica. Adicionar 3,75 μL de mistura-mãe de PCR e pipetar bem para misturar.
  2. Centrifugar numa microcentrífuga de bancada durante 1 min.
  3. Colocar os tubos num termociclador pré-aquecido com o seguinte programa: 72 ° C durante 3 min; 95 ° C durante 30 s; 12 ciclos de 9576; C durante 10 s, 50 ° C durante 30 s, e 72 ° C durante 1 min; 72 ° C durante 5 min; E uma retenção a 4 ° C.
    NOTA: O primeiro passo de 95 ° C foi alterado de 98 ° C, o que foi sugerido pelas instruções do fabricante. Além disso, os detalhes do ciclo foram ajustados de forma que as temperaturas e os comprimentos de tempo permitiram a tagimetria ótima de nossas amostras. A incubação final a 72 ° C também foi adicionada ao nosso protocolo e não foi incluída nas instruções do fabricante.
  4. Gire rapidamente os tubos para coletar o conteúdo na parte inferior. Vortex as esferas de ADN durante 30 s, e depois adicione 30 μL a cada tubo e misture bem por pipetagem.
  5. Incubar as amostras à TA durante 5 min.
  6. Colocar as amostras num separador magnético durante 2 min. Pipetar o sobrenadante para cima e para baixo duas vezes e incubar as amostras durante 1 min.
  7. Remover e descartar o sobrenadante claro. Adicionar 150 μL de EtOH a 80% a cada amostra e remover. Repita a lavagem com EtOH uma vez.
  8. PermitirE as amostras foram secas ao ar durante 10 min. Verificar intermitentemente para ver se qualquer EtOH coletou na parte inferior dos tubos e remover, se necessário.
  9. Uma vez que uma fissura começa a aparecer no grânulo de pérolas de ADN, retire a amostra do separador magnético e adicione 27,5 μL de tampão de ressuspensão para rehidratar o grânulo. Certifique-se de que o sedimento é completamente ressuspenso, e depois incubar à RT durante 2 min.
    NOTA: O volume utilizado para o tampão de ressuspensão foi modificado para considerar a menor quantidade de material de partida no nosso protocolo e difere do volume sugerido nas instruções do fabricante.
  10. Coloque os tubos no separador magnético durante 2 min. Transferir 25 μL de sobrenadante transparente para um tubo livre de ARNase e armazenar a -20 ° C.
    NOTA: Não prossiga com as instruções do fabricante para completar a normalização da biblioteca. As amostras são preparadas com sucesso após este passo e são preparadas para sequenciação tal como estão.
  11. Analise o tAgmentação das amostras utilizando um chip de bioanalyzer e 1 μL de cada amostra.
    NOTA: A análise dos esfregaços será realizada como anteriormente; Contudo, o ADNc deve agora ser detectado numa gama de tamanho de 0,2-1 Kb ( Figura 3 ). Os esfregaços abaixo deste ponto provavelmente representam a degradação das amostras, enquanto esfregaços maiores sugerem uma marcação incompleta.

11. Agrupamento de Amostras (10 min)

  1. Obter concentrações de amostras de marcação com o fluorómetro de alta sensibilidade anterior e determinar a concentração em nM.
    NOTA: Este cálculo pode ser calculado com o uso de uma ferramenta de conversão de Internet e depende do comprimento médio do fragmento do rastreio do bioanalyzer. Para determinar o comprimento médio dos fragmentos, observar o traço para cada amostra individualmente e determinar o tamanho do fragmento de ADN médio. Isto também pode ser calculado quando se examina o traço do bioanalyzer, destacando-se a extensão do esfregaço e examinandoE molaridade calculada pelo programa.
  2. Combine amostras de modo a que o conjunto contenha a mesma concentração de cada amostra. Não diluir as amostras; O tanque deve ser apenas tão diluído quanto a amostra concentrada mais baixa e, idealmente, ter uma concentração total de pelo menos 15 nM.
  3. Armazenar as amostras reunidas a -20 ° C antes da sequenciação; Sugere-se que as amostras passem por seqüenciamento dentro de uma semana após o agrupamento. Execute o sequenciamento de 100 pares de pares com uma plataforma HiSeq.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Os tipos de células são facilmente classificados seguindo a injeção de corante

A Figura 1 mostra um exemplo de um GFP + RGC antes e depois do preenchimento do marcador fluorescente. Esta célula foi identificada com base na sua expressão de GFP na linha transgénica ( Figura 1A ). Formou-se um vedante apertado com um eléctrodo de vidro puxado com ponta fina no soma desta célula. Para caracterizar o subtipo, o corante fluorescente foi injetado no soma e deixado preencher todos os processos associados ( Figura 1B ). A classificação como um ipRGC M4 foi habilitada através da observação de que esta célula tem um soma muito grande e que seus processos terminam dentro da sublamina ON da camada plexiforme interna ( Figura 1C ). Como uma ilustração das diferenças na estratificação que pode ser discernida em uma isolada retiniana preparação, preenchemos M1 (OFF-stratifyinG), M3 (bistratificado) e M4 (ON-estratificação) ipRGCs com um marcador fluorescente, fixa-los, e realizou imagens confocal de ON e OFF sublaminae ( Figura 1D ). Esta visualização dos dendritos através de imagem confocal é muito semelhante à forma como os dendritos aparecem em tecido in vitro não- fixado quando as células são preenchidas com um marcador fluorescente (Schmidt e Kofuji 2009, 2010 e 2011).

Bibliotecas de cDNA de células individuais

A utilização de um iniciador Oligo d (T) permite a transcrição reversa selectiva e a amplificação de mRNA. Depois de gerar e amplificar as bibliotecas de cDNA de cada célula, foram utilizados chips bioanalyzer para avaliar a qualidade e o tamanho das bibliotecas. Os resultados desta análise mostram que os esfregaços de cDNA ideais são 0,5-2 Kb numa boa amostra ( Figura 2A ). Algumas amostras mostram algumas bandas ou esfregaços abaixo da marca de 300 bp, sugGendo que essas bibliotecas são de má qualidade (consulte a Tabela 1 para solução de problemas). Um exemplo de um rasto de bioanalyzer de boa qualidade mostra poucas ou nenhuma banda de DNA abaixo de 300 pb e um esfregaço robusto entre 500 pb e 2 Kb (Figura 2B). As vias de controle vazias devem exibir os marcadores inferior e superior a 35 & 10380 pb, respectivamente, assim como uma linha de base estável que não flutua. Várias bibliotecas podem produzir dados de qualidade, como pode ser visto tanto pela Figura 2B como pela 2C , o que produziu excelentes profundidades de leitura e altas taxas de mapeamento. Apenas as amostras com bibliotecas de ADNc fortes do tamanho esperado devem ser levadas até à marcação (ver Tabela 1 para resolução de problemas).

Low-input tagmentation prepara amostras de alta qualidade para seqüenciamento

Este protocolo é otimizado para tagmentação com uma quantidade menor de material de partida eu. Apenas 250 pg funciona melhor para uma bem sucedida tagmentação, uma vez que quantidades mais baixas não amplificarão adequadamente e quantidades maiores não se fragmentarão completamente. Depois de completar a marcação e amplificação por PCR / limpeza da amostra, as amostras foram novamente analisadas num chip de bioanalyzer. Os esfregaços de cDNA ideais neste ponto devem ser de 0,2-1 Kb ( Figura 3A ). O traço deve aparecer liso e uniformemente distribuído entre esses dois tamanhos ( Figura 3B ); Este traço corresponde à amostra na pista 1. A Figura 3C mostra uma tagmentação incompleta, que pode ser facilmente resolvida (consulte a Tabela 1 para resolução de problemas). Realizamos análise de dados nas amostras e verificamos que esse protocolo produziu amostras com excelentes profundidades de leitura, superando com freqüência 12 milhões de leituras por amostra; Médias de 69,1% de mapeamento; E mais de 5.000 genes expressos.

/55229fig1.jpg "/>
Figura 1: Identificação de tipos de RGCs baseados na expressão de GFP em ipRGCs que expressam melanopsina e em Propriedades Morfológicas. ( A ) A camada de células ganglionares da retina, visualizada utilizando IR-DIC na preparação de retina de montagem completa. ( B ) A mesma preparação foi visualizada em epifluorescência (~ 480 nm) para identificar as células ganglionares que expressam GFP. ( C ) Uma célula que expressa GFP alvo para a gravação de patch-clamp e preenchido com um marcador fluorescente. A célula pode ser identificada como um M4 ipRGC com base no seu tamanho de soma muito grande e ON estratificando dendrites 25 , 26 . ( D ) Imagem confocal de dendritos ipRGC formados na sublamina ON e / ou OFF do IPL (M1), na sublamina ON do IPL (M4) e nas sublaminas ON e OFF do IPL (M3). IR-DIC: contraste de interferência diferencial infravermelho..jpeg / files / ftp_upload / 55229 / 55229fig1large.jpg "target =" _ blank "> Clique aqui para ver uma versão ampliada desta figura.

Figura 2
Figura 2: Análise da qualidade da biblioteca de cDNA com um rastreio de bioanalyzer. ( A) Exemplo de saída do bioanalizador para amostras múltiplas que foram transcritas, amplificadas e purificadas de modo inverso. As pistas 1-3 mostram os esfregaços de ADN ideais, com a maior parte do ADN maior do que 300 pb. As bibliotecas com esfregaços nesta gama proporcionaram consistentemente excelentes dados de sequenciação, mostrando uma média de 5.683 genes expressos por célula. A pista 4 representa uma amostra que foi processada sem êxito e assim não produziu ADNc. A pista de controlo bem sucedida tem uma linha de base constante e dois picos limpos a 35 e 10 380 pb. ( B ) Exemplo de um rastreio de bioanalyzer bem sucedido com uma elevada intensidade de cDNA em torno de 2 Kb. Isso é Mear corresponde à amostra na pista 1. ( C ) Exemplo de um rastreio de bioanalizador bem sucedido com o cDNA centrado em torno de 500 pb. Este traço corresponde à amostra na pista 3. Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Amostras marcadas mostram manchas resistentes entre 0,2 e 2 Kb. ( A ) Um exemplo representativo de saída do bioanalizador após a marcação, amplificação e limpeza de PCR. ( B ) Rastreio de uma amostra marcada com sucesso correspondente à pista 1 em (A). ( C ) Exemplo de rastreio para uma amostra com marcação incompleta, clara pela intensidade de pico em torno de 1 Kb."> Clique aqui para ver uma versão ampliada desta figura.

2 "> Diluir a amostra a uma concentração de 0,4 ng / μL e repetir a rotulagem
Problema Possível causa Solução
Etapa 3.3) Não é possível formar o selo GΩ A superfície da célula não está suficientemente limpa Limpe ainda mais usando pressão positiva
Passo 3.3) A célula parece deflacionar / morrer Prepare uma nova pipeta e alveje uma nova célula
Passo 3.4) Não é possível determinar a localização dos dendritos Alexafluor não teve tempo suficiente para difundir em toda a célula ou concentração de Alexafluor não é alta o suficiente Verifique se o ganho eo tempo de exposição na câmera estão altos o suficiente. Aguarde mais 5 minutos antes de visualizar os dendritos. Se as dendrites ainda não estiverem visíveis, prepare a solução com maior Alexafluorconcentração.
Passo 4.1) Impossível aspirar todo o citoplasma
Passo 5.5) O sobrenadante não está claro após 8 minutos Pipetar cuidadosamente a solução inteira duas vezes, enquanto ainda no separador magnético, e deixar repousar por mais 5 min
Passo 5.5) Pellet dispersa durante a pipetagem A amostra está muito longe do ímã Manter os tubos no dispositivo de separação magnética durante toda a pipetagem. Expulsar a solução e permitir que as pérolas re-pellet por 5 min
Etapa 5.7) Após 5 min, as amostras ainda parecem brilhantes A quantidade máxima de EtOH não foi removida Continuar a monitorizar as amostras durante a secagem. A cada 2 min, use uma pipeta P10 e remova todo o EtOH na parte inferior do tubo
Passo 8.9) As pastilhas apresentaram rachaduras antes da reidratação Permitir que a amostra rehydPara um total de 4 min, em vez de 2 (Passo 8.10)
Passo 8.11) Pequena quantidade de pérola foi trazida com o sobrenadante Ejectar toda a amostra de volta para o tubo e colocar no separador magnético por 1 min; Pipet-se suavemente e certifique-se de evitar pellet
Passo 8.12) Os esfregaços de ADN são inconsistentes e a escala de fluorescência muda continuamente Concentração de ADN demasiado elevada para um chip HS Verificar a concentração da amostra e diluir entre 1 - 10 ng / μL. Reexibir bioanalisador
Passo 8.12) Esfregaço de baixo peso molecular Degradação de RNA Certifique-se de flash congelar a célula imediatamente após a coleta. Descarte esta biblioteca de cDNA
Passo 8.12) Flutuante da linha de base do marcador na pista de controlo Contaminação ou reagente antigo Descartar marcador de DNA e empregar novo tubo para Bioanalyzer executar
Passo 8.12) Nenhum esfregaço de ADN Falha na expulsão da célula Puxe as agulhas novas com uma ponta ligeiramente maior
RNA Bead Failure Certifique-se de que as pérolas foram completamente ressuspensas antes da utilização e deixe as amostras incubar antes de colocar no separador magnético
Passo 8.12) Frac�o de ADN fraco Amplificação insuficiente Empregar mais ciclos de PCR
Passo 8.12) Exame de ADN fora da gama de 500bp-2Kb Os esfregaços de DNA abaixo de 0,5 e acima de 2 Kb são prováveis ​​contaminação. Descartar amostra
Passo 8.12) Espigas regularmente espaçadas no traço de ADN Contaminação da amostra Sempre use luvas frescas e faça novo etanol para enxaguamentos; As pontas do filtro devem ser usadas sempre
Passo 9.3) Não foi possível detectar a concentração da amostra no fluorómetro As amostras abaixo do nível de detecção têm muito pouco ADN para a marcação e não podem ser utilizadas
Passo 10.10) As amostras não estão secas após 10 min Continuar a remover o excesso de EtOH Permitir que as amostras de ardry mais tempo, verificá-los a cada minuto
Passo 10.13) Mancha inclinada em direcção a 2Kb Fragmentação incompleta Re-diluir a amostra para uma concentração de 0,15 ng / μL, em vez de 0,2 ng / μL; Rerun tagmentation
Passo 10.13) Mancha inclinada para 200 pb Entrada de DNA muito pequena Diluir a amostra menos, tente uma concentração de 0,4 ng / μL; Rerun tagmentação
Reação de marcação muito longa Reduza o tempo de reação da marcação para 8 min
Passo 10.13) Fatias fracas Amplificação inadequada de DNA
Passo 11.2) A concentração máxima de pool obtida é inferior a 5 nM Identificar quais amostras têm concentrações significativamente baixas e repetir a rotulagem com nova diluição

Tabela 1: Soluções e sugestões para possíveis impedimentos no Protocolo. Esta tabela lista possíveis dificuldades que podem ocorrer durante este protocolo e as etapas em que um pode encontrá-los. Esta tabela lista possíveis causas para muitos destes problemas, bem como soluções que podem ajudar a resolver quaisquer problemas.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nosso protocolo demonstra, através de um guia rápido e fácil de usar, um método para preparar células únicas de classes morfológicas identificadas para seqüenciamento de alta qualidade, com pouca lesão na amostra. No presente manuscrito, as células ganglionares retinianas intrinsecamente fotossensíveis são morfologicamente caracterizadas, isoladas e preparadas para RNA-Seq. Podem ocorrer tensões celulares durante a manipulação da retina; Por esta razão, substituímos cada pedaço de tecido após não mais de 4 h de uso. Podemos avaliar o estado das células usando o equipamento eletrofisiológico para registrar a partir dessas células e monitorar suas respostas, o que nos permite assegurar que as células são de boa saúde. O nosso protocolo permitiu a geração de bibliotecas de cDNA bem sucedidas de 15 de 23 amostras processadas, obtendo uma taxa de sucesso de 65%. Além disso, a qualidade de nossos dados de seqüenciamento foi excelente, pois o número médio de genes expressos por nossas células variou de 2.316-10.353, com uma média de 5.683Genes com um valor FPKM não nulo. Estes números são semelhantes às expressas contagens de genes encontrados por outros estudos de neurônios 5 , mostrando que os nossos dados também são de boa qualidade.

Embora tenhamos tido sucesso com este protocolo para estes neurónios específicos, deve notar-se que pequenas alterações a esta técnica podem ser aplicadas para uma série de aplicações diferentes. Usando o Classificador de Células activado por Fluorescência (FACS) dentro de um modelo de rato separado, isolámos pequenas populações de células (1.000- 25.000) marcadas com um marcador GFP do sistema nervoso central. O ARN destas populações foi isolado, e 1 μL (a ou ligeiramente abaixo de 12 ng / μL) deste ARN foi utilizado para iniciar a transcrição reversa no passo 6.1. O único ajuste que deve ser feito para o protocolo após este passo ocorre no passo 7.4, em que um ponto pode optar por empregar menos ciclos de PCR. Foram utilizados 19 ciclos nos casos em que a amostra inicial continha gMais de 10.000 células e descobriram que isso produz bibliotecas de cDNA de boa qualidade. Por exemplo, as amostras de c�ulas foram preparadas a partir de uma popula�o FACSorted, e o n�ero de genes expressos variou de 12.340-14.052, com uma m�ia de 13.265 genes com um valor FPKM n� zero. Esta técnica pode ser aplicada a vários modelos de ratinho para os quais está presente um repórter fluorescente. Devido a esta emenda, os pesquisadores poderiam potencialmente estudar qualquer população celular para a qual um repórter fluorescente mouse está disponível, estendendo estudos passado o campo de diversidade neuronal.

Um segundo ajuste pode ser feito para as células de perfil com base na funcionalidade em vez de apenas morfologia. Este projecto baseia-se num modelo transgénico, mas esta técnica pode ser aplicada a neurónios sem identificadores moleculares conhecidos. Por exemplo, existem mais de 30 subtipos funcionais de células ganglionares da retina actualmente identificadas 27 , muito poucas das quais têm marcadores únicos. Como esta técnicaJá se baseia em um equipamento de eletrofisiologia para o enchimento de células, pode-se usar pinçamento de patch para identificar o perfil de resposta funcional de cada célula com base no seu padrão de espícula. Utilizando gravações de pico evocadas pela luz, a classificação dos neurônios da retina pode ser determinada antes do isolamento celular. Esta técnica funciona em células ganglionares da retina, mas pode ser estendido para examinar outros neurônios da retina. Deve notar-se, no entanto, que se este protocolo é utilizado para digitar células retinianas bipolares ou amacrinas na camada nuclear interna, por exemplo, deve-se ter cuidado para proporcionar pressão positiva constante na ponta do eléctrodo para evitar o contacto com células como Eletrodo passa através da camada de células ganglionares e da camada plexiforme interna. Para os neurónios da retina dentro da camada nuclear interna, a preparação de secções da retina antes das gravações celulares provavelmente funcionaria melhor para evitar consistentemente a contaminação. Cada célula seria isolada e preparada tal como descrito aqui seguindo a claSificação. Além disso, propomos o uso deste protocolo para o estudo de neurônios, mas esta técnica pode ser aplicada a qualquer tipo de célula que possa ser morfologicamente caracterizada ou isolada através do uso de um modelo transgênico.

Esta técnica também pode ser modificada para trabalhar com bibliotecas de cDNA previamente preparadas, como temos gerado no passado para microarray hybridization [ 28] . Com uma biblioteca preparada separadamente, começa-se com quantidades de cDNA na gama de 50-150 ng e inicia-se o protocolo no passo 8.4; As concentrações mais altas e mais baixas não foram tentadas, embora possam funcionar também. A purificação do ADNc utilizando pérolas de ADN ocorreria primeiro, seguido por marcação e amplificação por PCR. Testámos este ajustamento com cDNA a partir de preparações de bibliotecas, tais como aquelas para hibridização de microarray 29 e produziram com êxito bibliotecas marcadas para RNA-Seq.

AletaEste protocolo pode ser utilizado na avaliação do sucesso de uma indução particular de populações de células induzidas de Células-Tronco Pluripotentes (iPSCs). A força motriz por trás da diferenciação dessas células pluripotentes reprogramadas depende de uma compreensão dos fatores de transcrição que levam os tipos de células a se desenvolverem separadamente umas das outras. Conduzir iPSCs em direção a destinos particulares de células é um novo método para estudar a diversidade neuronal, uma vez que pode ser usado para gerar seletivamente tipos de células. Este protocolo pode ser adaptado para avaliar a qualidade da diversidade entre células diferenciadas deste modelo. Como mencionado anteriormente, existem mais de 30 subtipos funcionais de células ganglionares da retina, e muitos esforços têm sido feitos para gerar RGCs funcionais a partir de iPSCs. A identificação de marcadores para subtipos de RGCs - no nosso caso, ipRGCs - permitiria ao pesquisador avaliar o sucesso de seu protocolo na produção de vários subtipos de RGCs. A avaliação de tipos de célulasEntre estes neurónios beneficiariam deste protocolo e podem também servir como uma ferramenta para a investigação continuada de marcadores subtipo-específicos como este sistema modelo torna-se prontamente disponível.

No presente trabalho, descrevemos uma técnica simples para o isolamento e preparação de células únicas para análise transcriptômica. Além disso, sugerimos maneiras de editar o protocolo para que esta técnica possa ser usada para uma infinidade de experimentos com uma gama de objetivos em mente. O protocolo aqui descrito foi adaptado a partir de um protocolo descrito por Trombetta et al. 24 como um ajuste das instruções do kit recomendado para RNA-Seq de baixa entrada. As principais diferenças estão dentro do isolamento celular e várias mudanças volumétricas que escolhemos para melhor atender às necessidades deste projeto. É importante destacar que o passo mais importante neste protocolo é o isolamento de células do tecido da retina. Este é o ponto no protocolo durinG que a maioria dos erros podem ocorrer, e deve ser realizada com a maior atenção. Qualquer quantidade de contaminação pode resultar em amostras inutilizáveis, enquanto a perda de citoplasma pode causar uma grave depleção de moléculas de mRNA. Esta etapa deve ser realizada com cuidado e pelo mesmo indivíduo de experimento a experimento para garantir que as amostras tenham sido manipuladas com precisão.

Em resumo, este protocolo descreve uma técnica para a classificação, isolamento e preparação de células para RNA-Seq de alta qualidade. Trata-se de uma forma eficiente e relativamente barata de optimizar a qualidade dos dados a partir de células individuais. Esta técnica é versátil e pode ser minimamente modificada para aplicação em vários estudos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Gostaríamos de agradecer Jennifer Bair e Einat Snir, bem como o Instituto de Genética Humana da Universidade de Iowa, por sua ajuda na preparação e manuseio de amostras.

Materials

Name Company Catalog Number Comments
Ames' Medium Sigma Aldrich A1420-10X1L
Sodium Bicarbonate Sigma Aldrich S8875
K-gluconate Spectrum Chemical PO178
EGTA Sigma Aldrich E4378
HEPES Sigma Aldrich H3375
Diethyl pyrocarbonate (DEPC) Sigma Aldrich D5758
Alexa Fluor 594 Hydrazide Invitrogen A10442
Collagenase Worthington Biochemical  LS005273
Hyaluronidase Worthington Biochemical  LS002592
Petri dish (35 mm diameter) Thermo Fisher Scientific 153066
Ophthalmologic scissors Fine Science Tools 15000-00
#5 Forceps Fine Science Tools 11252-30
Microplate Shaker Fisher Scientific 13-687-708
Glass Micropipette Sutter BF120-69-10
Micropipette Puller Sutter P-1000 horizontal pipette puller
1 mL syringe Fisher Scientific 14-823-2F
Flexible tubing Fisher Scientific 14-171
TCL lysis buffer Qiagen 1031576 Lysis Buffer 1
β-mercaptoethanol Sigma Aldrich M3148
RNase-free Water Qiagen 129112
0.2 mL PCR tubes Eppendorf 30124359
Ethyl Alcohol, Pure Sigma Aldrich E7023 Ethanol
Analog Vortex Mixer Thermo Fisher Scientific 02215365 Vortex
Mini Centrifuge Thermo Fisher Scientific 05-090-100
Agencourt RNAClean XP Beads Beckman Coulter A63987 RNA magnetic beads
MagnaBlot II Magnetic Separator Promega V8351 Magnetic stand
1.5 mL MCT Graduated Tubes Thermo Fisher Scientific 05-408-129
Smart-Seq v4 Ultra Low Input RNA Kit Clontech 634888 Reagents for Reverse Transcription and PCR Amplification
10x Lysis Buffer Lysis Buffer 2
5x Ultra Low First-strand Buffer Buffer 1
3' SMART-Seq CDS Primer II A Primer II
SMART-Seq v4 Oligonucleotide Oligonucleotide
SMARTScribe Rverse Transcriptase Reverse Transcriptase (RT)
2x SeqAmp PCR Buffer PCR Buffer
PCR Primer II A PCR Primer
SeqAmp DNA Polymerase DNA Polymerase
Mastercycler pro S Eppendorf 950030020 Thermocycler
Agencourt AMPure XP Beads Beckman Coulter A63881 DNA magnetic beads
2100 Bioanalyzer Agilent Technologies G2939AA
HS Bioanalyzer Chips & Reagents Agilent Technologies 5067-4626
Qubit HS Assay Kit Thermo Fisher Scientific Q32851 For the calculation of sample concentrations
Qubit Assay Tubes Thermo Fisher Scientific Q32856
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866
Nextera XT DNA Sample Preparation Kit Illumina FC-131-1024 Reagents for Tagmentation and Index Coupling
TD Buffer Buffer 2
ATM Tagmentation Mix
NT Buffer Tagmentation Neutralizing Buffer
NPM PCR Master Mix
Nextera XT Index Kit Illumina FC-131-1001 Indices for Tagmentation
N501 White 1
N502 White 2
N701 Orange 1
N702 Orange 2
HiSeq 2500 Illumina SY-401-2501 For completing sequencing of samples

DOWNLOAD MATERIALS LIST

References

  1. Austin, C., Cepko, C. L. Specification of Cell Fate in the Vertebrate Retina. Neural Cell Specif. 3, 139-143 (1995).
  2. Masland, R. H. The Neuronal Organization of the Retina. Neuron. 76, (2), 266-280 (2012).
  3. Rodieck, R. The First Steps in Seeing. Sinauer Associates, Inc. Sunderland, MA. (1998).
  4. Chiu, I. M., et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. Elife. 3, e04660 (2014).
  5. Tasic, B., et al. Adult mouse cortical cell taxonomy revealed by single cell transcriptomics. Nat. Neurosci. 19, (2), 335-346 (2016).
  6. Trapnell, C. Defining cell types and states with single-cell genomics. Genome Res. 25, (10), 1491-1498 (2015).
  7. Zeisel, A., et al. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science. 347, (6226), 1138-1142 (2015).
  8. Schmidt, T. M., Do, M. T. H., Dacey, D., Lucas, R., Hattar, S., Matynia, A. Melanopsin-Positive Intrinsically Photosensitive Retinal Ganglion Cells: From Form to Function. J. Neurosci. 31, (45), 16094-16101 (2011).
  9. Eberwine, J., Miyashiro, K., Kacharmina, J. E., Job, C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc. Natl. Acad. Sci. 98, (13), 7080-7085 (2001).
  10. Darmanis, S., et al. A survey of human brain transcriptome diversity at the single cell level. Proc. Natl. Acad. Sci. 112, (23), 7285-7290 (2015).
  11. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  12. Usoskin, D., et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, (1), 145-153 (2015).
  13. Poulin, J. F., Zou, J., Drouin-Ouellet, J., Kim, K. Y. A., Cicchetti, F., Awatramani, R. B. Defining midbrain dopaminergic neuron diversity by single-cell gene expression profiling. Cell. Rep. 9, (3), 930-943 (2014).
  14. Gross, A., Schoendube, J., Zimmermann, S., Steeb, M., Zengerle, R., Koltay, P. Technologies for Single-Cell Isolation. Int. J. Mol. Sci. 16, 16897-16919 (2015).
  15. Lovatt, D., et al. Transcriptome in vivo analysis (TIVA) of spatially defined single cells in live tissue. Nat Methods. 11, (2), 190-196 (2014).
  16. Qiu, S., et al. Single-neuron RNA-Seq: Technical feasibility and reproducibility. Front. Genet. 3, (124), 1-8 (2012).
  17. Subkhankulova, T., Yano, K., Robinson, H. P. C., Livesey, F. J. Grouping and classifying electrophysiologically-defined classes of neocortical neurons by single cell, whole-genome expression profiling. Front. Mol. Neurosci. 3, (10), 1-11 (2010).
  18. Fuzik, J., et al. Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat. Biotechnol. 34, (2), 175-183 (2016).
  19. Schmidt, T. M., Kofuji, P. An isolated retinal preparation to record light response from genetically labeled retinal ganglion cells. J. Vis. Exp. (47), e2367 (2011).
  20. Schmidt, T. M., Kofuji, P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci. 29, (2), 476-482 (2009).
  21. Schmidt, T. M., Kofuji, P. Structure and Function of Bistratified Intrinsically Photosensitive Retinal Ganglion Cells in the Mouse. J Comp Neurol. 519, (8), 1492-1504 (2011).
  22. Schmidt, T. M., Kofuji, P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci. 30, (48), 16262-16271 (2010).
  23. Clontech Laboratories I. SMARTerTM Ultra Low RNA Kit for Illumina® Sequencing. (2013).
  24. Trombetta, J. J., Gennert, D., Lu, D., Satija, R., Shalek, A. K., Regev, A. Preparation of single-cell RNA-Seq libraries for next generation sequencing. Curr. Protoc. Mol. Biol. 4, (22), 1-17 (2014).
  25. Ecker, J. L., et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: Cellular diversity and role in pattern vision. Neuron. 67, (1), 49-60 (2010).
  26. Schmidt, T. M., et al. A Role for Melanopsin in Alpha Retinal Ganglion Cells and Contrast Detection. Neuron. 82, (4), 781-788 (2014).
  27. Sanes, J. R., Masland, R. H. The Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification. Annu. Rev. Neurosci. 38, 221-246 (2014).
  28. Goetz, J. J., Trimarchi, J. M. Single-cell Profiling of Developing and Mature Retinal Neurons. J. Vis. Exp. e3824 (2012).
  29. Trimarchi, J. M., et al. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. J. Comp. Neurol. 502, 1047-1065 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics