تشريح اليرقات الزرد الغدد التناسلية الأنسجة

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

هنا، نقدم بروتوكول لعزل الأنسجة الغدد التناسلية من الزرد اليرقات، التي من شأنها تسهيل التحقيقات في التفرقة بين جنس الزرد والصيانة.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وعلى الرغم من الزرد البرية امتلاك / ZW نظام تحديد الجنس ZZ، فقد الزرد المستأنسة كروموسوم الجنس. وهي تستخدم نظام تحديد الجنس عديدة الجينات، حيث وزعت عدة جينات في جميع أنحاء الجينوم تحدد بشكل جماعي هويات جنس الأسماك الفردية. حاليا، فإن الجينات المسؤولة عن تنظيم تطوير الغدد التناسلية وكيفية عملها يبقى بعيد المنال. عادة، عزل الأنسجة الغدد التناسلية هي الخطوة الأولى لدراسة العمليات التنموية الجنس. هنا، نقدم إجراء لعزل الأنسجة الغدد التناسلية من 17 DPF (أيام آخر الإخصاب) و 25 يرقات DPF الزرد. الأنسجة الغدد التناسلية معزولة ويمكن الاطلاع في وقت لاحق من قبل التشكل والتعبير الجيني التنميط.

Introduction

يتم فقدان المحدد الإناث رئيسيا في كروموسوم الزرد البرية 4 أو تعديلها في الزرد المستأنسة (أي سلالات مختبر المشتركة) 1. بدلا من ذلك، لديهم نظام تحديد الجنس عديدة الجينات يرافقه العوامل البيئية مثل درجة الحرارة ونقص الأكسجين، وتوافر الغذاء والكثافة السكانية. ليست مفهومة تماما آليات تفصيلية للتنمية الجنس الزرد. أسئلة أساسية مثل عندما يحدث تحديد الجنس الزرد، ما إشارة تحديد الجنس الابتدائية (ق) هو / هي، والجينات التي تنظم الخطوة الأولى من التحول الغدد التناسلية لا يزال يتعين الإجابة 2 و 3.

في عملية التنمية الجنس الزرد، وقد تم الاعتراف عدة مراحل مهمة. في مرحلة مبكرة من التنمية، بدءا من 4 HPF (آخر ساعة الإخصاب) البدائية الجرثومية خلايا (بغتش) الخضوع لمواصفات، والهجرة إلى التلال الأعضاء التناسلية وتكاثر. أرقام PGC والتفاعلات المتبادلة بين الخلايا الجرثومية والخلايا الجسدية مهمة لالغدد التناسلية التمايز 4. في 13 DPF (أيام آخر الإخصاب)، والغدد التناسلية هي في مرحلة غير متمايزة. بنسبة 17 DPF، الغدد التناسلية تتطور إلى المبايض ثنائية محتملة في كل من الإناث والذكور في المستقبل. الانتقال التي تعتمد على الخلايا من المبيض إلى الخصية يبدأ في 21-25 DPF وقد يستمر لعدة أسابيع. بنسبة 35 DPF، وقد تم تحديد جنس الغدد التناسلية وإنتاج الأمشاج مصنفة حسب الجنس جار في كلا المبيضين والخصيتين 5 و 6 و 7.

حتى الآن، وقد اقترحت الجينات وآليات تحديد الجنس مرشح متنوعة. وقد عزل البروتينات وتحليل transcriptomic العديد من الجينات مع التعبير ديمبرافيك جنسيا، وقد استخدمت هذه الجينات لدراسة التمايز بين الجنسين في الزرد 9 و 10. على سبيل المثال، في الزرد اليرقات، ويتم التعبير عن الجين cyp19a1a تحديدا في المبيض ولكن ليس في الخصية 11 و 12. وبالإضافة إلى ذلك، يتم التعبير عن الجينات AMH ضعيفة في خلايا بصيلات المحببة المبيض، ولكن بقوة في الخصية خلايا سيرتولي 13. في المقابل، أعرب الجينات الأوعية مستمر في الخلايا الجرثومية كل من الزرد الإناث والذكور، مما يجعل من الغدد التناسلية علامة مناسبة 14 و 15.

بحثت العلاقة بين مستويات التعبير الجيني الغدد التناسلية أمر بالغ الأهمية لفهم الآلية الجزيئية لتحديد الجنس والتمايز خصوصا في مرحلة المبيض ثنائية إمكانيات 3 و 9. ومع ذلك، فإن صغر حجم الزرد اليرقات والغدد التناسلية صغيرة في المقابل تعقيد عزل gonadaالأنسجة ل لمزيد من التحليل الجزيئي. الدراسات السابقة المستخدمة تشريح منطقة الجذع بأكملها بين الغطاء الخيشومي والمسام الشرج 16. هذا التحضير، على الرغم من أن تحتوي على الغدد التناسلية، ويتكون من الأنسجة والأعضاء متعددة. بدلا من ذلك، والحيوانات المعدلة وراثيا مع التعبير GFP-الغدد التناسلية معين مثل الأوعية: استخدمت EGFP لعزل الأنسجة الغدد التناسلية عن طريق مضان خلية تنشيط الفرز (FACS) والقبض على الليزر الجزئي تشريح 17 و 18. لكن تطبيقها على نطاق واسع محدودة. هنا، نحن تصف إجراء بسيط لعزل الأنسجة الغدد التناسلية من الزرد اليرقات في 17 DPF و 25 DPF. نحن لشرح موقف الغدد التناسلية فيما يتعلق الأجهزة الأخرى وعزل الغدد التناسلية سليمة شكليا من الأنسجة المحيطة بها. علينا مواصلة تظهر الجينات الغدد التناسلية معين مثل الأوعية وcyp19a1a يتم التعبير عنها بشكل كبير في الغدد التناسلية معزولة مقارنة مع الأنسجة جذع من خلال PCR الكمي (QPCR) التحليل. يسمح هذا البروتوكول تحديد الهوية، والعزلة، وتنقية RNA والتضخيم من جينات معينة الغدد التناسلية من الزرد اليرقات، وبالتالي تمكين التحليل الجزيئي لاحق من أنسجة الغدد التناسلية (19).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تمت الموافقة على التجارب الزرد من قبل لجنة رعاية الحيوان المؤسسية واستخدم جامعة فودان. وأثيرت الزرد ولدت وفقا للاجراءات المتبعة 20.

1. الاستعدادات

  1. زراعة 17 DPF و 25 DPF الزرد اليرقات
    1. نقل 2 ذكور و 2 إناث الزرد الكبار (صحية، 3-6 أشهر من العمر، والمختبرات أب سترين) إلى خزان المعبر في وقت متأخر بعد الظهر قبل يوم العبور. فصل الذكور والإناث مع الجدار. في صباح اليوم التالي، وتجديد خزان المياه وإزالة الحاجز للسماح لهم للتزاوج. جمع البيض في 100 ملم أطباق بتري 1-2 ساعة بعد الإخصاب.
    2. والحفاظ على حوالي 40 الأجنة في لوحة 100 ملم مع 40 مل الجنين المتوسطة (EM) في 28.5 درجة مئوية خلال فترة النمو المبكر (4 أيام) وتحديث EM مرتين في اليوم. نقل اليرقات إلى 1 الدبابات L (40 اليرقات إلى 300 مل من الماء النظام) وتغذية مع الدوارات الحية (العرض الكامل، مرتين في اليوم) بعد 5 DPF.تغذية الأرتيميا العيش بدلا من اتباع نظام غذائي حيدة الخلية والروتيفر بعد 10 DPF. نقل الأسماك إلى تعميم-إعادة نظام المياه في 14 DPF 21.
    3. رفع الزرد اليرقات في نظام المياه تعميم إعادة حتى 17 DPF أو 25 DPF. ضمان دورة الخفيفة / مظلمة هو 14/10 ساعة ودرجة الحموضة قيمة المياه النظام حوالي 7.2. قياس طول الجسم من 17 DPF (5،5-6،8 مم) و 25 DPF (8-11 ملم) يرقات 22.
  2. إعداد 2٪ لوحات أجار للتشريح.
    1. إضافة 4 ز أجار إلى 200 مل من الماء المعقم. تسخين الخليط في فرن الميكروويف حتى يتحول شفافة.
    2. تبريد حل أجار لمدة 15 دقيقة، ثم سكبه في 60 مم أطباق بتري (حوالي 1/3 حجم لوحة). تخزين لوحات أجار طدت في 4 درجات مئوية.

2. بروتوكول 1: تشريح الأنسجة الغدد التناسلية بين 17 و 25 يرقات DPF

  1. إضافة الثلج المجروش في خزان لتخدير 17 يرقات DPF. نقلاليرقات تخدير إلى 100 ملم المبردة طبق بيتري مع حل 30 مل البرد رينغر. الحفاظ على الأسماك المحتضنة في حل رينغر مبردة لمدة 15 دقيقة على الأقل لتخدير كامل اليرقات.
  2. نقل اليرقات إلى لوحة آغار precooled مع ملعقة صغيرة من البلاستيك. غمر جسم السمكة بالكامل في 10 مل المبردة حل قارع الأجراس ووضع برفق على جانبها.
  3. هل العمليات التالية تحت مجال الرؤية من 25X المجهر ستيريو. المشبك جذع السمك مع ملاقط لتحقيق الاستقرار. مزق البطن طوليا من فتحة الشرج إلى القلب مع زوج آخر من الملقط. إزالة بلطف الجلد والعضلات على جانب واحد من الجسم لكشف الأعضاء الداخلية.
  4. إزالة كتلة من أجهزة بطني إلى المثانة السباحة بعناية. تجنب إتلاف الغدد التناسلية تعلق على المثانة السباحة.
  5. قطع الاتصال بين المثانة السباحة والجسم الأمامي. سحب المثانة السباحة بأكملها والأنسجة الغدد التناسلية بلطف.
    ملاحظة: في معظم الحالاتالصورة، أنسجة الغدد التناسلية في 17 DPF تحتوي المحيطة الأنسجة الطلائية وprotonephridium. لا ينفصلون بسهولة عن بعضها البعض، ولكن في 25 DPF يمكن فصلها بسهولة. توصيل الغدد التناسلية أيضا إلى فتحة الشرج. وهناك تقاطع مع الغدد التناسلية اليسار واليمين متصلة مع بعضها البعض في فتحة الشرج تكون مرئية بشكل واضح.
  6. استخدام ملاقط لفصل بعناية أنسجة الغدد التناسلية من المثانة السباحة وتنظيف الأنسجة الدهنية المحيطة بها.
  7. على الفور نقل أنسجة الغدد التناسلية معزولة إلى prechilled 1.5 مل أنبوب الطرد المركزي التي تحتوي على حل 200 ميكرولتر رينغر. الحفاظ على أنبوب على الجليد حتى يتم فصل جميع أنسجة الغدد التناسلية من اليرقات.
  8. تشريح الغدد التناسلية من 25 يرقات DPF كما هو موضح في الخطوات 2،1-2،7.

3. بروتوكول 2: تحليل التعبير الجيني في أنسجة الغدد التناسلية المعزولة

  1. استخراج الحمض النووي الريبي مجموع من أنسجة الغدد التناسلية اليرقات.
    1. نقل أنسجة الغدد التناسلية معزولة إلى ريبونوكلياز خالية الجديد 1.5 مل أنبوب وإزالة حل رينغر. إضافة 100 ميكرولتر حل تحلل. وهي lysed دوامة حتى الأنسجة تماما.
    2. تنفيذ الإجراء مجموع استخراج الحمض النووي الريبي وفقا لتعليمات الشركة الصانعة.
    3. إضافة 10/01 حجم 10X الدناز أنا العازلة و 1 ميكرولتر من الدناز الأول لهذا الحل RNA وتخلط بلطف. احتضان لمدة 20 دقيقة عند 37 درجة مئوية.
    4. إضافة 10/01 حجم الدناز تعطيل كاشف إلى حل RNA. احتضان لمدة 10 دقيقة في 70 ° C. قياس تركيز الحمض النووي الريبي مجموع باستخدام مقياس الطيف الضوئي. تخزين في درجة حرارة -20 درجة مئوية.
  2. أداء التوليف [كدنا حبلا أولا
    1. استخدام بنسبة ضئيلة (DT) -linker التمهيدي لأداء أول حبلا التوليف [كدنا بعد بروتوكول تصنيع. إضافة 1-2 ميكروغرام من الحمض النووي الريبي لإجمالي حجم رد الفعل إلى 20 ميكرولتر.
    2. احتضان محلول التفاعل لمدة 90 دقيقة في 45 ° C. إنهاء رد فعل عن طريق التسخين عند 70 درجة مئوية لمدة 5 دقائق.
    3. إضافة 1 ميكرولتر ريبونوكلياز H إلى [كدنا ذلكlution لإزالة RNA المتبقية. المزيج بلطف وأجهزة الطرد المركزي لمدة 10 ق في ~ 13000 ز س. احتضان لمدة 20 دقيقة عند 37 درجة مئوية. إضافة 20 ميكرولتر المياه مجانا نوكلياز. تخزين في -70 ° C.
  3. أداء الفلورسنت PCR الكمي
    1. أداء QPCR على نظام cycler على مع صبغة الفلورسنت. استخدام الظروف الدراجات PCR التالية: 35 دورة في 95 درجة مئوية لمدة 15 ثانية، TM-5 درجة مئوية لمدة 15 ثانية، 68 درجة مئوية لمدة 30 ثانية. استخدام تسلسل التمهيدي على النحو التالي: AMH (إعادة توجيه: GTGGATGGCAGCAGTACGAC، مراجعة: GCGGAGAGGTGGAAGAGAGAATG)، cyp19a1a (إعادة توجيه: GTCCTGTTGTCTCCTACTGTCG، مراجعة: CATTTGAGTTGAATATGATGCCCTG)، nanos3 (إعادة توجيه: GCTCGGTGTACGCCAAATCAACAT، مراجعة: CCAAGTGAAAACACAACACCAGTGC)، الأوعية (إعادة توجيه: ATCGCATAGGAAGAACTGGACGCT، مراجعة: CCAAGTGAAAACACAACACCAGTGC) و β-الأكتين (إعادة توجيه: AGTGCGACGTGGACATCCGTA، مراجعة: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

تم إجراء تشريح الغدد التناسلية على أب سترين الزرد اليرقات. ويبين الشكل 1 أنسجة الغدد التناسلية نموذجية من الزرد اليرقات في 17 DPF و 25 DPF. أولا، يتم قطع الجلد والعضلات من جانب واحد من البطن لكشف الأعضاء الداخلية. بعد إزالة كتلة من الأعضاء الداخلية، والمثانة السباحة جنبا إلى جنب مع الغدد التناسلية تبقى في الجذع. كان يعلق على الغدد التناسلية إلى الجانب البطني من المثانة السباحة (السهم في الشكل 1B). في 17 DPF، كان الغدد التناسلية في مرحلة المبيض ثنائية المحتملة. ترد الغدد التناسلية عزل اليسار والغدد التناسلية الصحيح وكان شفاف (الشكل 1C). في معظم الحالات، كان محاطا الأنسجة الطلائية وprotonephridium (السهم في الشكل 1C). في 25 DPF على الغدد التناسلية كثيرا ما كانت ملفوفة بواسطة الأنسجة الدهنية (1D الشكل). في هذا التطور الواحدالعمر، ويمكن ملاحظة الغدد التناسلية إما كبيرة أو صغيرة. المبيض غير ناضج كبير إلى تطوير البويضات الثانوية، وخلايا بصيلات زيادة حجم الغدد التناسلية (الشكل 1E). الخصية غير ناضجة صغيرة بسبب تحللها وموتها المبيض اليرقات (الشكل 1F).

لتحليل الخصائص الجزيئية للأنسجة الغدد التناسلية معزولة، علينا أولا فحص مستويات التعبير الجيني من AMH، cyp19a1a، nanos3 والأوعية، وأربع علامات الغدد التناسلية في الزرد، من خلال QPCR. تم استخراج الحمض النووي الريبي مجموع من أنسجة اليرقات الغدد التناسلية (ن = 35) باستخدام عدة RNA العزلة. وبالإضافة إلى ذلك، فإننا إزالة الرأس والذيل من 17 DPF يرقة، واستخدام الأنسجة الجذع (بين بنية القلب والمسام الشرج) لاستخراج RNA باسم المجموعة الضابطة (ن = 15). وتشمل الأنسجة جذع الجلد والعضلات والعظام (الفقرات والأضلاع)، المثانة السباحة والكلى والغدد التناسلية. بنسبة ضئيلة DT-صوقد استخدم rimed كدنا] لQPCR. أظهرت نتيجة QPCR الزيادات في مستويات AMH، cyp19a1a، nanos3 والتعبير الأوعية في 17 أنسجة الغدد التناسلية DPF معزولة قبل ما يقرب من 397، 342 و 45 و 170 أضعاف، على التوالي (الشكل 2).

شكل 1
الشكل 1. Microphotographs من الأنسجة الغدد التناسلية النموذجية في اليرقات الزرد في 17 DPF و 25 DPF. (A) مزق الجلد والعضلات من جانب واحد من البطن لكشف الأعضاء الداخلية تحت المجهر ستيريو 25X. (B) بعد إزالة كتلة من الأعضاء الداخلية، والمثانة السباحة والغدد التناسلية لا تزال تعلق على الجذع. (B ') تضخيم ضوء مربع أحمر في لوحة B لإظهار الوضع النسبي للمثانة السباحة والغدد التناسلية. يشار إلى الغدد التناسلية التي كتبها السهم. (C) ايزو lated أنسجة الغدد التناسلية في 17 DPF. الأنسجة السوداء في الصورة (السهام) هي الأنسجة البطانية وprotonephridium تعلق على الغدد التناسلية. (DE) والغدد التناسلية كبير قبل وبعد إزالة الأنسجة الدهنية في 25 DPF. (F) والغدد التناسلية صغير في 25 DPF. الحانات الحجم: 200 ميكرون. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. تطبيع مستويات التعبير الجيني من AMH، cyp19ala، nanos3 والأوعية في جذوع ومبايض معزولة في 17 DPF. أعداد الحيوانات المستخدمة: المجموعة الضابطة، ن = 15؛ مجموعة الغدد التناسلية، ن = 35. الأنسجة الجذع في السيطرة على المجموعة هي من دون الرأس والهياكل الذيل. تشير مجموعة الغدد التناسلية للأنسجة الغدد التناسلية معزولة./files/ftp_upload/55294/55294fig2large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

أصبح الزرد نموذج قوي ويستخدم على نطاق واسع في مجال التنمية والبحوث المتعلقة بالمرض. وقد الطرق لعزل الأجهزة في الزرد الكبار مثل المخ والقلب والغدد التناسلية، والكلى، وموثقة جيدا 23 و 24 و 25. نظرا لصغر حجم وإعادة الديناميكية للأنسجة الغدد التناسلية في الزرد اليرقات، والعزلة من أنسجة الغدد التناسلية هي مهمة صعبة. الدراسات السابقة استخدمت كلها تشريح الأنسجة الجذع أو الأوعية المعدلة وراثيا: الفرز خلية مقرها EGFP وتسليخ مجهري بالليزر لفحص الغدد التناسلية اليرقات 26. التعديلات من كروموسوم 4 خلال تدجين يجعل تحديد الجنس لغزا في الزرد المستأنسة. أسلوبنا هو موضح هنا يمكن أن توفر الاستعدادات الغدد التناسلية نظيفة ومبكرة نسبيا لمزيد من الفحوص المورفولوجية والجزيئية، التي يمكن أن تكون مفيدة لاستكشاف الميكانيكية المحدد للجنسanisms.

ليس من السهل لفصل الغدد التناسلية تطوير من الهياكل الأخرى في وقت مبكر من مراحل التنمية. يصف أسلوبنا كيفية إجراء تشريح. لتنفيذ هذا البروتوكول بنجاح، تحتاج إلى الإشارة إلى بعض الخطوات الحاسمة. أولا، حالة نمو اليرقات الزرد أمر بالغ الأهمية لالمتوقع العائد النتائج. تطوير الغدد التناسلية من الزرد اليرقات هي عملية ديناميكية للغاية. يتم تحديد حجم ومظهر من أنسجة الغدد التناسلية من مراحل تطور الحيوانات (27). فمن المهم للحفاظ على دفعات مختلفة من الزرد في حالة موحدة. وتشمل العوامل التي قد تؤثر على نمو يرقات الكثافة السكانية، ومدة الضوء ودورات المظلمة، وتوافر الغذاء وجداول التغذية. قياس الطول القياسي من الأسماك اليرقات يمكن أن تستخدم كدليل لتحديد حالة نمو الحيوانات 22. العامل الحاسم الثاني لنجاح isolat أنسجة الغدد التناسليةايون هو الفهم الجيد للموقف النسبي والاختلافات الشكلية بين الغدد التناسلية والأنسجة المحيطة بها. لأنه يقع في الغدد التناسلية إلى الجانب البطني من المثانة السباحة، وأنها مريحة لعزل البداية الغدد التناسلية جنبا إلى جنب مع المثانة السباحة. وبالإضافة إلى ذلك، يتم إرفاق نهاية البعيدة للالغدد التناسلية بإحكام إلى النهاية البعيدة من الأمعاء. لذا على المرء أن يكون حذرا عند إزالة القناة الهضمية من الغدد التناسلية في نهايات البعيدة. لتحليل التعبير الجيني لاحقة، لا بد من استخدام وسائل الإعلام قبل المبردة ولوحة آغار، وتنفيذ الإجراء بأكمله بسرعة.

وقد تم بنجاح استخدام أسلوب مماثل من قبل رف كيتينغ وآخرون. 28. طبقوا طريقة العزل التناسلية للتحقيق وظيفة piRNAs ومسار PIWI في اليرقات البالغة من العمر 3 أسابيع. هنا، نحن تشريح الأنسجة الغدد التناسلية من اليرقات الزرد في وقت مبكر من 17 DPF لاستكشاف الهوية والجينات الشخصية التعبير الجزيئي للdeveloبينغ الغدد التناسلية الزرد. يمكن إجراء التحليلات الجزيئية المستقبلية للأنسجة الغدد التناسلية معزولة السابقة لتحديد Transcriptome على، methylome وأستلة هيستون أنماط لتوضيح الآليات الكامنة وراء تطور الجنس في الزرد.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب تعلن أنه ليس لديهم مصالح مالية المتنافسة.

Acknowledgments

نشكر C تشانغ لرعاية الأسماك. وأيد هذا العمل من قبل مؤسسة العلوم الطبيعية الوطنية الصينية (31171074، 31371099 و31571067 لGP) ومشروع المواهب بوجيانج (09PJ1401900 لGP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics