Вскрытие Личинки данио гонадная ткани

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Здесь мы приводим протокол для выделения гонад ткани личиночного данио, что облегчит исследования данио половой дифференциации и обслуживание.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Хотя дикие данио обладают / ZW определением пола ZZ, одомашненные данио потеряли половую хромосому. Они используют полигенную систему определения пола, где несколько генов, распределенных по всему геному совместно определяют половые тождества отдельных рыб. В настоящее время гены участвуют в регуляции развития гонад и как они работают остаются неуловимыми. Как правило, выделение гонадной ткани является первым шагом изучить половые процессы развития. Здесь мы представляем процедуру, чтобы изолировать гонады ткани от 17 дения (дней после оплодотворения) и 25 DPF данио личинок. Изолированная гонадная ткань может быть затем изучена с помощью морфологии и экспрессии генов профилирования.

Introduction

Основным фактором , определяющим женского пола в диком данио хромосоме 4 теряется или изменяется в одомашненных данио (например , общие штаммы лаборатории) 1. Вместо этого они имеют полигенную систему определения пола сопровождается экологическими факторами, такие как температура, гипоксия, наличие пищи и плотность населения. Детальные механизмы развития данио пола до конца не изучены. Фундаментальные вопросы , такие как , когда происходит данио определение пола, что основной сигнал определения пола (ы) является / являются, и какие гены регулируют первый шаг преобразования гонад остаются не заполнено 2, 3.

В процессе развития данио пола, несколько важных этапов были признаны. На ранней стадии развития, начиная с 4 часов после оплодотворения (ч после оплодотворения) эмбриональные-клетки (ПКА) претерпевают спецификации, переход к генитальному хребту ипролиферация. PGC число и взаимные взаимодействия между зародышевыми клетками и соматическими клетками имеют важное значение для дифференциации гонад 4. В 13 денье (дней после оплодотворения), гонады находятся в недифференцированной стадии. К 17 денье, гонады развиваются в два раза потенциальных яичников у обоих будущих самок и самцов. Апоптоз-зависимый переход от яичника к семеннику начинается с 21 до 25 дения и может продолжаться в течение нескольких недель. К 35 денье, пол гонады была определена и секс конкретного производства гамет ведется в обоих яичников и семенников 5, 6, 7.

На сегодняшний день, были предложены различные гены и механизмы определения пола кандидатов. Протеомика и анализ транскриптомного выделили множество генов с половым диморфизмом экспрессией и эти гены были использованы для изучения половой дифференциации в данио 8, 9, 10. Например, в личиночной данио, ген cyp19a1a специфически экспрессируется в яичниках , но не в семенниках 11, 12. Кроме того, ген АМГА слабо выражен в овариальных фолликулах зернистых клеток, но сильно в клетках Сертоли семенников 13. В противоположность этому , ген васа непрерывно выражается в зародышевых клетках как женского и мужского данио, что делает его подходящим маркером гонад 14, 15.

Исследование гонадных уровней экспрессии генов важно понять молекулярный механизм определения пола и дифференциации , особенно в би-потенциал яичников стадии 3, 9. Однако небольшой размер личиночной данио и, соответственно, мелких гонад осложнить изоляцию gonadaл ткани для дальнейшего молекулярного анализа. Предыдущие исследования использовали расчлененные весь регион магистрального между opercula и анальной порой 16. Этот препарат, хотя, содержащие гонады, состоит из нескольких тканей и органов. Альтернативно, трансгенные животные с выражением GFP гонад специфические , такие как Vasa: были использованы EGFP для изоляции гонадной ткани с помощью флуоресцентной активированной сортировки клеток (FACS) и лазерного захвата микро-рассечение 17, 18. Но их широкое применение ограничено. Здесь мы опишем простую процедуру, чтобы изолировать гонад ткани от личиночной данио в 17 денье и 25 денье. Мы демонстрируем позицию гонад по отношению к другим органам и изолировать морфологический интактные гонады от окружающих тканей. Мы также показываем , гонады специфических генов , такие как Vasa и cyp19a1a высоко выражены в изолированных гонадах по сравнению с магистральной тканью через количественный ПЦР (КПЦР) анализа. Настоящий протокол позволяет идентификации, выделения, очистки РНК и амплификации специфических генов гонад из личиночной данио, тем самым позволяя последующего молекулярного анализа гонадной ткани 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Эксперименты рыбок данио утверждены Институциональный уходу и использованию животных комитета Fudan Университетской. Рерио были подняты и разводят в соответствии со стандартными процедурами 20.

1. Подготовка

  1. Выращивают 17 DPF и 25 DPF личиночной данио
    1. Передача 2 мужчин и 2 взрослые женщины данио (здоровые, от 3 до 6 месяцев, лаборатория Аб Стрейн) в резервуар пересечения во второй половине дня до дня пересечения. Отдельные самцы и самки с барьером. На следующее утро, обновить резервуар для воды и удалить барьер, чтобы дать им возможность спариваться. Сбор яиц в 100 Мм Петри Петри 1 до 2 ч после оплодотворения.
    2. Хранить около 40 эмбрионов в 100 мм пластины с 40 мл среды эмбриона (ЭМ) при 28,5 ° C в течение раннего периода развития (4 дня) и обновить EM два раза в день. Передача личинок в 1 л танков (40 личинок в 300 мл воды в системе) и кормить с живыми коловраток (полный питания, два раза в день) после того, как 5 денье.Поток живой артемии вместо коловратки диеты после 10 дения. Перенести рыбу в рециркуляции воды системы в 14 денье , 21.
    3. Повысить личиночный данио~d в рециркуляции водной системы до 17 дения или 25 дения. Убедитесь, что цикл свет / темнота в 14/10 ч и рН значение системы воды составляет около 7,2. Измерьте длину тела 17 дения ( от 5,5 до 6,8 мм) и 25 дения ( от 8 до 11 мм) 22 личинок.
  2. Приготовьте 2% агар для рассечения.
    1. Добавить 4 г агара к 200 мл стерильной воды. Смесь нагревают в микроволновой печи, пока он не станет прозрачным.
    2. Охлаждают раствор агара в течение приблизительно 15 мин, а затем залить его в 60 мм в диаметре чашки Петри (приблизительно 1/3 объема пластины). Хранить затвердевший агар при температуре 4 ° С.

2. Протокол 1: Рассеките гонадные ткани 17 и 25 DPF Личинки

  1. Добавить измельченный лед в бак обезболить 17 личинок DPF. Передачаанестезировали личинки до 100 мм охлажденных чашек Петри с раствором 30 мл охлажденного Рингера. Хранить рыбу инкубировали в растворе охлажденного Рингера в течение по крайней мере 15 минут, чтобы полностью обезболить личинки.
  2. Передача личинок к предварительно охлажденной агаровой пластине с небольшой пластиковой ложкой. Погрузите все тело рыбы в 10 мл охлажденный раствор Рингера и аккуратно положите его на бок.
  3. Выполните следующие действия в соответствии с видением поля 25X стерео микроскопа. Закрепить ствол рыбы с помощью пинцета для стабилизации. Rip брюшка в продольном направлении от заднего прохода к сердцу с другим пинцетом. Аккуратно снимите кожу и мышцы на одной стороне тела, чтобы выставить внутренние органы.
  4. Снимите массу органов вентральных в плавательном пузыре тщательно. Избегайте повреждение гонады, прикрепленную к плавательному пузырю.
  5. Отрезать связь между плавательным пузырем и передней тела. Вытянуть весь плавательный пузырь и гонады ткани мягко.
    Примечание: В большинстве случаевс, гонадная ткань в 17 дении содержит окружающую эпителиальную ткань и protonephridium. Они не легко отделяются друг от друга, но в 25 денье, он может быть легко отделена. Гонад также подключен к анусу. Сочленение с левой и правой гонады соединены друг с другом на заднем проходе будет отчетливо виден.
  6. Используйте пинцет, чтобы аккуратно отделить гонады ткани от плавательного пузыря и очистить окружающие ткани жировой ткани.
  7. Сразу передачи выделенной гонадной ткани на prechilled 1,5 мл центрифужной пробирки, содержащей 200 мкл раствором Рингера. Держите трубку на льду, пока все гонад ткани не отделяются от личинок.
  8. Проанализируйте гонадах 25 DPF личинок, как описано в пунктах 2.1 - 2.7.

3. Протокол 2: Анализ экспрессии генов обособленных гонадных ТКАНЕЙ

  1. Экстракт тотальной РНК из личиночных тканей гонад.
    1. Передача изолированных гонадных тканей к новому РНКазы 1.5 мл трубки и удалить раствор Рингера. Добавьте 100 мкл раствора для лизиса. Вихревой до тканей полностью лизированы.
    2. Выполните полную процедуру экстракции РНК в соответствии с инструкциями изготовителя.
    3. Добавить 1/10 объема 10х ДНКазы I буфера и 1 мкл ДНКазы I к решению РНК и осторожно перемешать. Инкубируют в течение 20 мин при 37 ° С.
    4. Добавьте 1/10 объема реагента ДНКазы инактивации в растворе РНК. Инкубируют в течение 10 мин при 70 ° С. Измерение концентрации общей РНК с использованием спектрофотометра. Хранить при -20 ° C.
  2. Выполнение первой цепи синтеза кДНК
    1. Используйте олиго (дТ) линкер праймера для выполнения первой цепи кДНК синтеза в соответствии с протоколом изготовления. Добавить 1 до 2 мкг РНК до общего объема реакционной до 20 мкл.
    2. Инкубируйте реакционный раствор в течение 90 мин при 45 ° C. Завершение реакции при нагревании при температуре 70 ° С в течение 5 мин.
    3. Добавить 1 мкл РНКазы H в кДНК такlution для удаления остатков РНК. Осторожно перемешать и центрифугировать в течение 10 с при ~ 13000 х г. Инкубируют в течение 20 мин при 37 ° С. Добавьте 20 мкл нуклеазы свободной воды. Хранить при температуре -70 ° С.
  3. Выполните флуоресцентный количественный ПЦР
    1. Выполните КПЦР в системе ЦИКЛОВАТЕЛЯ с флуоресцентным красителем. Используйте следующие ПЦР условия велосипедного: 35 циклов при 95 ° С в течение 15 с, Tm-5 ° C в течение 15 с, 68 ° С в течение 30 с. С помощью праймеров последовательностей следующим образом : АМГ (Fwd: GTGGATGGCAGCAGTACGAC; REV: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (Fwd: GTCCTGTTGTCTCCTACTGTCG; REV: CATTTGAGTTGAATATGATGCCCTG), nanos3 (вперед: GCTCGGTGTACGCCAAATCAACAT; REV: CCAAGTGAAAACACAACACCAGTGC), васа (вперед: ATCGCATAGGAAGAACTGGACGCT; REV: CCAAGTGAAAACACAACACCAGTGC) и β-актина (вперед: AGTGCGACGTGGACATCCGTA; REV: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Рассечений гонад были выполнены на Аб Стрейн личиночной данио. На рисунке 1 показана типичная гонадной ткани личиночной данио в 17 денье и 25 денье. Во-первых, кожа и мышцы одной стороны живота разрезают, чтобы обнажить внутренние органы. После удаления массы внутренних органов, плавательный пузырь вместе с гонадой остается в багажнике. Гонад был прикреплен к брюшной стороне плавательного пузыря (стрелка на рисунке 1В '). В 17 денье, то яичник был в яичнике стадии би-потенциал. Изолированные гонады содержали левые и правые гонады и была полупрозрачный (фиг.1С). В большинстве случаев он был окружен эпителиальной ткани и protonephridium (стрелка на фиг.1C). В 25 DPF гонад часто был обернут жировой ткани (рис 1D). При этом развитие йвозраст, может наблюдаться либо большой или маленький гонад. Незрелый яичник большой , как развитие вторичных ооцитов и фолликул клетка увеличивает объем гонад (рис 1E). Незрелый семенник мал из - за дегенерации и апоптоза личиночного яичника (рис 1F).

Для анализа молекулярных свойств изолированных тканей гонад, мы сначала исследовали уровни экспрессии генов АМГ, cyp19a1a, nanos3 и Васа, четырех маркеров гонад в данио, по кПЦР. Суммарную РНК экстрагировали из личиночных тканей гонад (п = 35) с использованием набора для выделения РНК. Кроме того, мы удалили голова и хвост 17 DPF личинки, и использовали ткань соединительной линии (между структурой сердца и анальной порой) для извлечения РНКА в качестве контрольной группы (n = 15). Ткани ствола включены кожу, мышцы, кости (позвонки и ребра), плавательный пузырь, почки и гонад. Олиго дТ-рrimed кДНК использовали для ПЦР в реальном времени. Результате КПЦРА показал увеличение АМГА, cyp19a1a, nanos3 и экспрессия васы уровней в 17 дении изолированной ткани гонад приблизительно 397, 342, 45 и 170 раз соответственно (рисунок 2).

Рисунок 1
Рисунок 1. Микрофотографии Типичные гонадной тканей личинок данио рерио в 17 денье и 25 денье. (А) Rip кожи и мышц одной стороны живота , чтобы выставить внутренние органы под стереомикроскопом 25X. (B) После удаления массы внутренних органов, плавательный пузырь и гонады остаются прикрепленными к стволу. (В ') Усиленный вид на красном поле на панели В , чтобы показать относительное положение плавательного пузыря и гонад. Гонад обозначен стрелкой. (С) Изо ведена гонадная ткань в 17 дении. Черные ткани в картинке (стрелка) являются эндотелиальной тканью и protonephridium прикреплен к гонаде. (DE) Большая гонад до и после удаления жировой ткани в 25 денье. (F) Небольшие гонады при 25 дении. Шкала бар: 200 мкм. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Нормированные экспрессии генов Уровни АМГ, cyp19ala, nanos3 и Васа в стволах и изолированных гонад на 17 денье. Число животных используется: контрольная группа, п = 15; гонад группа, n = 35. В тканях ствола в контрольной группе без головы и хвоста структур. группа гонад относится к изолированным гонадным тканям./files/ftp_upload/55294/55294fig2large.jpg»целевых =„_blank“> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Данио стал мощной моделью и широко используется в разработках и исследовании заболеваний, связанные с. Методы выделения органов у взрослых данио , таких как мозг, сердце, гонады и почки, были хорошо документированы 23, 24, 25. Из-за небольшого размера и динамического ремоделирование тканей гонад в личиночной данио, выделение гонадной ткани является сложной задачей. Предыдущие исследования использовали целые рассеченные ткани туловища или трансгенную Vasa: сортировку EGFP на основе клеток и лазерную микродиссекцию для изучения личиночной гонады 26. Модификации хромосомы 4 во время одомашнивания делает определение пола загадки одомашненных данио. Наш метод, описанный здесь, может обеспечить относительно чистые и ранние препараты гонад для дальнейших морфологических и молекулярных обследований, которые могут быть полезны для изучения секса-определений Мехамеханизмов надзора.

Это не так легко отделить развивающиеся гонады от других структур на ранних стадиях развития. Наш метод описывает, как выполнить рассечение. Для успешного выполнения этого протокола, некоторые важные шаги должны быть отмечены. Во-первых, условие роста личиночной данио имеет решающее значение для урожайности ожидаемых результатов. Гонад развитие личиночной данио является весьма динамичным процессом. Размер и внешний вид тканей гонад определяются этапы развития животных 27. Важно, чтобы поддерживать различную партию данио в стандартизированном состоянии. Факторы, которые могут оказать влияние на росте личинок относятся плотность населения, продолжительность светлого и темные циклы, наличие пищи и графики кормления. Стандартное измерение длины личиночной рыбы может быть использовано в качестве ориентира для определения состояния роста животных 22. Второй важный фактор для успешного изоляца гонадной тканиион хорошее понимание относительного положения и морфологических различия между гонадами и окружающими тканями. Поскольку яичник расположен на брюшной стороне плавательного пузыря, удобно сначала выделить гонады вместе с плавательным пузырем. Кроме того, дистальный конец гонад плотно прикреплен к дистальному концу кишки. Таким образом, один должен быть осторожным при удалении кишечника из гонад на дистальных концах. Для последующего анализа экспрессии гена, необходимо использовать предварительно охлажденные среды и агар, и выполнить всю процедуру быстро.

Аналогичный метод был успешно использован на Рф Кеттинг и соавт. 28. Они применили метод изоляции гонад для исследования функции пиРНКа и Piwi пути в 3-недельных личинках. Здесь мы рассекали гонады ткани от данио личинок еще в 17 дении для изучения молекулярной идентичности и экспрессия генов профиля Develoпинг данио гонад. Будущие молекулярные анализы ранее изолированной гонады ткани может быть выполнены, чтобы определить модели транскрипта, methylome и ацетилирования гистонов для выяснения механизмов, лежащих в основе развития секса в данио.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов.

Acknowledgments

Мы благодарим C Zhang для ухода рыбы. Эта работа была поддержана Национальным фондом естественных наук Китая (31171074, 31371099 и 31571067 ГПА) и Таланты проект Пуцзяна (09PJ1401900 по ГПУ).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics