लार्वा zebrafish जननांगों ऊतक के विच्छेदन

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

यहाँ, हम लार्वा zebrafish, जो zebrafish सेक्स भेदभाव और रखरखाव की जांच सुविधा होगी की जननांगों ऊतक अलग करने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं।

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

यद्यपि जंगली zebrafish एक ZZ / ZW सेक्स-निर्णय प्रणाली के अधिकारी, पालतू zebrafish सेक्स गुणसूत्र खो दिया है। वे एक polygenic लिंग निर्धारण प्रणाली, जहां कई जीनों वितरित भर जीनोम सामूहिक रूप से अलग-अलग मछली की सेक्स पहचान का निर्धारण का उपयोग करें। वर्तमान में, जीन जननपिंड विकास के विनियमन में शामिल और वे कैसे काम मायावी रहते हैं। आम तौर पर, जननांगों ऊतक अलग सेक्स विकास प्रक्रियाओं की जांच के लिए पहला कदम है। यहाँ, हम 17 DPF (दिनों के बाद निषेचन) और zebrafish लार्वा DPF 25 से जननांगों ऊतक अलग करने के लिए एक प्रक्रिया प्रस्तुत करते हैं। पृथक जननांगों ऊतक बाद में आकृति विज्ञान और जीन अभिव्यक्ति की रूपरेखा से जांच की जाए।

Introduction

जंगली zebrafish 4 गुणसूत्र में प्रमुख महिला सेक्स निर्धारक 1 खो दिया है या पालतू zebrafish में संशोधित किया गया है (यानी आम प्रयोगशाला उपभेदों)। इसके बजाय, वे एक polygenic लिंग निर्धारण प्रणाली जैसे तापमान, हाइपोक्सिया, भोजन की उपलब्धता और जनसंख्या घनत्व के रूप में पर्यावरणीय कारकों के साथ की है। zebrafish सेक्स विकास का विस्तृत तंत्र पूरी तरह नहीं समझा। जैसे कि जब zebrafish लिंग निर्धारण होता है के रूप में बुनियादी सवाल, प्राथमिक लिंग निर्धारण संकेत (ओं) / क्या है, और जो जीन को विनियमित जननपिंड परिवर्तन की दिशा में पहला कदम 2 जवाब देना, 3 रहते हैं।

zebrafish सेक्स विकास की प्रक्रिया में, कई महत्वपूर्ण चरणों मान्यता दी गई है। विकास के प्रारंभिक चरण में, 4 hpf (घंटे के बाद निषेचन) मौलिक जर्म कोशिकाओं (PGCs) विनिर्देश से गुजरना, से शुरू जननांग रिज करने के लिए प्रवास औरप्रसार। पीजीसी संख्या और जर्म कोशिकाओं और दैहिक कोशिकाओं के बीच पारस्परिक बातचीत जननपिंड भेदभाव 4 के लिए महत्वपूर्ण हैं। 13 DPF (दिनों के बाद निषेचन) में जननांग undifferentiated चरण में है। 17 DPF करके, जननांग भविष्य दोनों महिलाओं और पुरुषों में द्वि-संभावित अंडाशय में विकसित। वृषण को अंडाशय से apoptosis पर निर्भर संक्रमण 21 से 25 DPF पर शुरू करते हैं और कई हफ्तों के लिए जारी रख सकते हैं। 35 DPF करके, जननपिंड का लिंग निर्धारित किया गया है और सेक्स-विशेष युग्मक उत्पादन दोनों अंडाशय में चल रहा है और 5 वृषण, 6, 7।

तिथि करने के लिए, विविध उम्मीदवार जीनों और लिंग निर्धारण के तंत्र प्रस्तावित किया गया है। प्रोटिओमिक्स और transcriptomic विश्लेषण यौन dimorphic अभिव्यक्ति के साथ कई जीनों पृथक कर दिया है और इन जीनों zebrafish 8 में सेक्स भेदभाव का अध्ययन करने के लिए उपयोग किया गया है, 9, 10। उदाहरण के लिए, लार्वा zebrafish में, cyp19a1a जीन विशेष रूप से अंडाशय में व्यक्त किया है लेकिन वृषण 11, 12 में नहीं है। इसके अलावा, AMH जीन कमजोर डिम्बग्रंथि कूप ग्रान्युलोसा कोशिकाओं में व्यक्त किया है, लेकिन दृढ़ता से वृषण सर्टोली कोशिकाओं 13 में। इसके विपरीत, वासा जीन लगातार दोनों महिला और पुरुष zebrafish के जर्म कोशिकाओं में व्यक्त किया है, यह एक उपयुक्त जननपिंड मार्कर 14, 15 बना रही है।

जननांगों जीन अभिव्यक्ति के स्तर की जांच विशेष रूप से द्वि-संभावित अंडाशय चरण 3, 9 में लिंग निर्धारण और भेदभाव की आणविक तंत्र को समझने के लिए महत्वपूर्ण है। हालांकि, लार्वा zebrafish और तदनुसार छोटे जननांग के छोटे आकार gonada के अलगाव को मुश्किलआगे आणविक विश्लेषण के लिए एल ऊतक। पिछला इस्तेमाल किया पढ़ाई opercula और गुदा छेद 16 के बीच पूरे ट्रंक क्षेत्र विच्छेदित। यह तैयारी है, हालांकि जननांग युक्त, कई ऊतकों और अंगों के होते हैं। वैकल्पिक रूप से, वासा के रूप में जननपिंड विशेष GFP अभिव्यक्ति के साथ ट्रांसजेनिक जानवरों: EGFP प्रतिदीप्ति सक्रिय सेल छँटाई (FACS) और लेजर कब्जा सूक्ष्म विच्छेदन 17, 18 के माध्यम से जननांगों ऊतक अलगाव के लिए इस्तेमाल किया गया। लेकिन उनकी व्यापक प्रयोग सीमित है। यहाँ, हम 17 DPF और 25 DPF पर लार्वा zebrafish से जननांगों ऊतक अलग करने के लिए एक सरल प्रक्रिया का वर्णन। हम अन्य अंगों के संबंध में जननांग की स्थिति का प्रदर्शन और आसपास के ऊतकों से आकृति विज्ञान बरकरार जननांग को अलग। हम आगे अत्यधिक मात्रात्मक पीसीआर के माध्यम से ट्रंक ऊतक (के साथ तुलना में अलग जननांग में व्यक्त कर रहे इस तरह के वासा और cyp19a1a रूप जननपिंड-विशिष्ट जीन दिखानेqPCR) विश्लेषण। वर्तमान प्रोटोकॉल जिससे जननांगों ऊतक 19 के बाद के आणविक विश्लेषण को सक्षम करने की पहचान, अलगाव, शाही सेना शुद्धि और लार्वा zebrafish से जननांगों विशिष्ट जीन की प्रवर्धन अनुमति देता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Zebrafish प्रयोगों फूडन विश्वविद्यालय संस्थागत पशु की देखभाल और उपयोग समिति द्वारा अनुमोदित किया गया। Zebrafish उठाया और मानक प्रक्रियाओं 20 के अनुसार प्रजनन करवाए जाते थे।

1. तैयारी

  1. खेती 17 DPF और 25 लार्वा zebrafish DPF
    1. पार करने से पहले दिन देर से दोपहर में स्थानांतरण 2 पुरुष और 2 महिला वयस्क zebrafish (स्वस्थ, 3 से 6 महीने पुराने, प्रयोगशाला ऐब स्ट्रेन) एक पार टैंक के लिए। एक बाधा के साथ पुरुषों और महिलाओं को अलग करें। अगली सुबह, टैंक पानी से ताज़ा और उन्हें संभोग करने के लिए अनुमति देने के लिए बाधा को दूर। 100 म पेट्रि डिश निषेचन के बाद 1 से 2 घंटे में अंडे इकट्ठा।
    2. प्रारंभिक विकास की अवधि (4 दिन) के दौरान 28.5 डिग्री सेल्सियस पर 40 एमएल भ्रूण मध्यम (ईएम) के साथ एक 100 मिमी प्लेट में लगभग 40 भ्रूण रखें और दिन में दो बार ईएम ताज़ा करें। 1 एल टैंक (300 एमएल प्रणाली पानी के लिए 40 लार्वा) के लार्वा स्थानांतरण और 5 DPF के बाद लाइव रोटीफर्स (पूर्ण आपूर्ति, दिन में दो बार) के साथ खाते हैं।10 DPF के बाद किरीटी आहार के बजाय लाइव नमकीन चिंराट फ़ीड। 21 DPF 14 में फिर से प्रवाहित होने वाले पानी प्रणाली में मछली स्थानांतरित करें।
    3. 17 DPF या 25 DPF तक फिर से प्रवाहित होने वाले पानी प्रणाली में लार्वा zebrafish उठाएँ। प्रकाश / अंधेरे चक्र सुनिश्चित प्रणाली पानी की 14/10 ज और पीएच मान 7.2 के बारे में है। 17 DPF (5.5 6.8 मिमी) और 25 DPF (8 11 मिमी के लिए) लार्वा 22 शरीर की लंबाई का आकलन करें।
  2. विच्छेदन के लिए 2% अगर प्लेटें तैयार करें।
    1. 200 एमएल बाँझ पानी के लिए 4 जी अगर जोड़ें। एक माइक्रोवेव ओवन में मिश्रण को गर्म करें जब तक यह पारदर्शी हो जाता है।
    2. लगभग 15 मिनट के लिए अगर समाधान कूल, तो 60 मिमी व्यास पेट्री डिश (लगभग प्लेट का 1/3 मात्रा) में डाल। 4 डिग्री सेल्सियस पर ठोस अगर प्लेटों की दुकान।

2. प्रोटोकॉल 1: 17 के जननांगों ऊतक और 25 लार्वा DPF काटना

  1. टैंक में कुचल बर्फ जोड़ें 17 DPF लार्वा anesthetize। स्थानांतरणएक 100 मिमी 30 एमएल ठंड रिंगर समाधान के साथ पेट्री डिश ठंडा करने के लिए संज्ञाहरण लार्वा। मछली कम से कम 15 मिनट के लिए ठंडा रिंगर के समाधान में इनक्यूबेट पूरी तरह से लार्वा anesthetize की रखें।
  2. एक छोटे से प्लास्टिक के चम्मच से एक precooled अगर प्लेट को लार्वा स्थानांतरित करें। 10 रिंगर के समाधान ठंडा एमएल में पूरे मछली शरीर डूब और धीरे अपने पक्ष पर रखें।
  3. 25X स्टीरियो माइक्रोस्कोप की दृष्टि क्षेत्र के अंतर्गत निम्न कार्रवाई करते हैं। स्थिरीकरण के लिए चिमटी के साथ मछली ट्रंक क्लैंप। चिमटी की एक और जोड़ी के साथ दिल के लिए गुदा से अनुदैर्ध्य पेट चीर। धीरे आंतरिक अंगों को बेनकाब करने के लिए शरीर के एक तरफ त्वचा और मांसपेशियों को हटा दें।
  4. तैरना मूत्राशय ध्यान से करने के लिए उदर अंगों की बड़े पैमाने पर निकालें। जननपिंड तैरना मूत्राशय से जुड़ी को नुकसान पहुँचाए से बचें।
  5. तैरना मूत्राशय और पूर्वकाल शरीर के बीच संबंध काट दिया। पूरे तैरना मूत्राशय और जननांगों ऊतक धीरे बाहर खींच।
    नोट: सबसे मामले मेंरों, 17 DPF पर जननांगों ऊतक एपिथेलियल ऊतक और protonephridium आसपास होता है। वे आसानी से एक दूसरे से अलग नहीं हैं, लेकिन 25 में DPF यह आसानी से अलग किया जा सकता। जननपिंड भी गुदा से जुड़ा है। गुदा पर एक दूसरे से जुड़े छोड़ दिया और सही जननपिंड के साथ एक जंक्शन स्पष्ट रूप से दिखाई जाएगी।
  6. चिमटी का प्रयोग सावधानी से तैरना मूत्राशय से जननांगों ऊतक अलग और आसपास वसा ऊतकों को साफ करने के।
  7. इसके तत्काल बाद 200 μL रिंगर के समाधान युक्त एक prechilled 1.5 एमएल अपकेंद्रित्र ट्यूब को अलग जननांगों ऊतक हस्तांतरण। जब तक सभी जननांगों ऊतकों लार्वा से अलग होती है बर्फ पर ट्यूब रखें।
  8. 2.7 - कदम 2.1 में वर्णित के रूप में 25 लार्वा DPF के जननांग काटना।

3. प्रोटोकॉल 2: पृथक जननांगों ऊतकों के जीन की अभिव्यक्ति का विश्लेषण करें

  1. लार्वा जननांगों ऊतकों से कुल शाही सेना निकालें।
    1. एक नया RNase मुक्त 1 के लिए पृथक जननांगों ऊतकों में स्थानांतरित करें।5 एमएल ट्यूब और रिंगर के समाधान निकालें। 100 μL lysis समाधान जोड़ें। ऊतकों तक भंवर पूरी तरह से lysed।
    2. निर्माता के निर्देशों के अनुसार कुल शाही सेना निष्कर्षण प्रक्रिया निष्पादित करें।
    3. 10x DNase की 1/10 मात्रा मैं बफ़र और आरएनए समाधान के लिए DNase मैं के 1 μL जोड़ें और धीरे मिश्रण। 37 डिग्री सेल्सियस पर 20 मिनट के लिए सेते हैं।
    4. आरएनए समाधान के लिए 1/10 मात्रा DNase निष्क्रियता अभिकर्मक जोड़ें। 70 डिग्री सेल्सियस पर 10 मिनट के लिए सेते हैं। कुल शाही सेना एक स्पेक्ट्रोफोटोमीटर का उपयोग कर की एकाग्रता का आकलन करें। -20 डिग्री सेल्सियस पर स्टोर।
  2. प्रथम किनारा सीडीएनए संश्लेषण प्रदर्शन
    1. निर्माण के प्रोटोकॉल के बाद पहले भूग्रस्त सीडीएनए संश्लेषण प्रदर्शन करने के लिए एक oligo (डीटी) -linker प्राइमर का उपयोग करें। 20 μL के लिए कुल प्रतिक्रिया मात्रा को 1 शाही सेना के 2 के लिए माइक्रोग्राम जोड़ें।
    2. 45 डिग्री सेल्सियस पर 90 मिनट के लिए प्रतिक्रिया समाधान सेते हैं। 5 मिनट के लिए 70 डिग्री सेल्सियस पर हीटिंग द्वारा प्रतिक्रिया बर्खास्त करें।
    3. सीडीएनए के लिए 1 μL RNase एच जोड़ें ताकिअवशिष्ट शाही सेना को दूर करने के lution। पर ~ 13,000 एक्स जी 10 एस के लिए धीरे और अपकेंद्रित्र मिक्स। 37 डिग्री सेल्सियस पर 20 मिनट के लिए सेते हैं। 20 μl nuclease मुफ्त पानी जोड़ें। -70 डिग्री सेल्सियस पर स्टोर।
  3. फ्लोरोसेंट मात्रात्मक पीसीआर प्रदर्शन करना
    1. एक फ्लोरोसेंट डाई के साथ एक साइक्लर सिस्टम पर qPCR प्रदर्शन करना। 35 चक्र 95 डिग्री सेल्सियस पर 15 s के लिए 15 है, 30 s के लिए 68 डिग्री सेल्सियस के लिए TM-5 डिग्री सेल्सियस, निम्न पीसीआर साइकिल चालन की स्थिति का प्रयोग करें। इस प्रकार प्राइमर दृश्यों का उपयोग करें: AMH (अग्रेषित: GTGGATGGCAGCAGTACGAC; राजस्व: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (अग्रेषित: GTCCTGTTGTCTCCTACTGTCG; राजस्व: CATTTGAGTTGAATATGATGCCCTG), nanos3 (अग्रेषित: GCTCGGTGTACGCCAAATCAACAT; राजस्व: CCAAGTGAAAACACAACACCAGTGC), वासा (अग्रेषित: ATCGCATAGGAAGAACTGGACGCT; राजस्व: CCAAGTGAAAACACAACACCAGTGC) और β-actin (अग्रेषित: AGTGCGACGTGGACATCCGTA; राजस्व: GCACTTCCTGTGGACGATGGA) 19।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

जननांग के विच्छेदन ऐब स्ट्रेन लार्वा zebrafish पर प्रदर्शन किया गया। चित्रा 1 17 DPF और 25 DPF पर लार्वा zebrafish के विशिष्ट जननांगों ऊतक को दर्शाता है। सबसे पहले, त्वचा और पेट के एक तरफ की मांसपेशियों आंतरिक अंगों को बेनकाब करने के काटा जाता है। आंतरिक अंगों की बड़े पैमाने पर हटाने के बाद, मूत्राशय जननपिंड के साथ एक साथ तैरने के ट्रंक में रहते हैं। जननपिंड तैरना मूत्राशय के उदर पक्ष से जुड़ा था ( 'चित्रा 1 बी में तीर)। 17 DPF पर, जननपिंड द्वि संभावित अंडाशय चरण में था। पृथक जननपिंड छोड़ दिया और सही जननपिंड निहित और पारदर्शी था (चित्रा 1C)। ज्यादातर मामलों में, यह एपिथेलियल ऊतक और protonephridium (चित्रा 1C में तीर) से घिरा हुआ था। 25 जननपिंड DPF पर अक्सर वसा ऊतकों (चित्रा 1 डी) द्वारा लपेटा गया था। इस विकास सेंट परउम्र, या तो बड़े या छोटे जननपिंड देखा जा सकता है। अपरिपक्व अंडाशय माध्यमिक oocytes की विकास के रूप में बड़ा है, और कूप कोशिकाओं जननपिंड मात्रा (चित्रा 1E) में वृद्धि। अपरिपक्व वृषण अध: पतन और लार्वा अंडाशय (चित्रा 1F) के एपोप्टोसिस की वजह से छोटा है।

पृथक जननांगों ऊतकों की आणविक गुण का विश्लेषण करने के लिए, हम पहले AMH, cyp19a1a, nanos3 और वासा, zebrafish में चार जननपिंड मार्करों, qPCR द्वारा के जीन की अभिव्यक्ति के स्तर की जांच की। कुल शाही सेना लार्वा जननांगों ऊतकों (n = 35) एक आरएनए अलगाव किट का उपयोग से निकाला गया था। इसके अलावा, हम सिर और 17 लार्वा DPF की पूंछ हटा दिया, और ट्रंक ऊतक नियंत्रण समूह (n = 15) के रूप में शाही सेना निकालने के लिए इस्तेमाल (दिल और गुदा छेद की संरचना के बीच)। ट्रंक ऊतक त्वचा, मांसपेशियों, हड्डी (कशेरुकाओं और पसलियों), तैरना मूत्राशय, गुर्दे और जननपिंड शामिल थे। Oligo dT-primed सीडीएनए qPCR के लिए इस्तेमाल किया गया था। QPCR परिणाम लगभग 397, 342, 45 और 170 गुना, क्रमशः (चित्रा 2) द्वारा 17 DPF अलग जननांगों के ऊतकों में AMH, cyp19a1a, nanos3 और वासा अभिव्यक्ति के स्तर में वृद्धि देखी गई।

आकृति 1
चित्रा 17 DPF और 25 DPF पर लार्वा zebrafish में विशिष्ट जननांगों ऊतकों की 1. Microphotographs। (ए) एक 25X स्टीरियो माइक्रोस्कोप के तहत आंतरिक अंगों को बेनकाब करने के लिए त्वचा और पेट के एक तरफ की मांसपेशियों रिप। (बी) के आंतरिक अंगों की बड़े पैमाने पर हटाने के बाद, तैरना मूत्राशय और जननपिंड ट्रंक से जुड़ी रहते हैं। (बी ') तैरना मूत्राशय और जननपिंड की सापेक्ष स्थिति को दिखाने के लिए पैनल बी में लाल बॉक्स को देखते परिलक्षित होती है। जननपिंड तीर से मिलता है। (सी) इसो 17 DPF पर जननांगों ऊतक lated। चित्र (तीर) में काले ऊतकों endothelial ऊतक और protonephridium जननपिंड से जुड़ी हैं। (DE) से पहले और 25 DPF पर वसा ऊतकों को हटाने के बाद एक बड़ा जननपिंड। (एफ) 25 DPF पर एक छोटा सा जननपिंड। स्केल सलाखों: 200 सुक्ष्ममापी। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. सामान्यीकृत जीन अभिव्यक्ति 17 DPF पर ट्रंक्स और पृथक जननांग में AMH, cyp19ala, nanos3 और वासा का स्तर। जानवरों की संख्या का प्रयोग किया: नियंत्रण समूह, एन = 15; जननपिंड समूह, एन = 35. नियंत्रण समूह में ट्रंक ऊतकों सिर और पूंछ संरचनाओं के बिना कर रहे हैं। जननपिंड समूह अलग जननांगों ऊतकों को दर्शाता है।/files/ftp_upload/55294/55294fig2large.jpg "target =" _ blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

zebrafish एक शक्तिशाली मॉडल बन गया है और बड़े पैमाने पर विकास और रोग से संबंधित अनुसंधान के क्षेत्र में प्रयोग किया जाता है। इस तरह के मस्तिष्क, हृदय, जननपिंड, और गुर्दे के रूप में वयस्क zebrafish में अंगों के अलगाव के लिए विधियों, अच्छी तरह से 23, 24, 25 दर्ज किया गया है। छोटे आकार और लार्वा zebrafish में जननांगों ऊतकों के गतिशील remodeling के कारण, जननांगों ऊतक के अलगाव एक चुनौती भरा काम है। पिछले अध्ययनों से पूरे विच्छेदित ट्रंक ऊतकों या ट्रांसजेनिक वासा प्रयोग किया है: EGFP आधारित सेल छँटाई और लेजर सूक्षम लार्वा जननांग 26 जांच करने के लिए। पालतू बनाने के दौरान 4 गुणसूत्र के संशोधन लिंग निर्धारण पालतू zebrafish में एक रहस्य बना देता है। हमारे विधि यहाँ वर्णित आगे रूपात्मक और आणविक परीक्षाओं के लिए अपेक्षाकृत स्वच्छ और जल्दी जननपिंड तैयारी प्रदान कर सकते हैं, जो सेक्स का निर्धारण करने Mech पता लगाने के लिए सहायक हो सकता हैanisms।

यह प्रारंभिक विकास चरणों में अन्य संरचनाओं से विकासशील जननपिंड अलग करने के लिए आसान नहीं है। हमारे विधि बताता है कि कैसे विच्छेदन प्रदर्शन करने के लिए। सफलतापूर्वक इस प्रोटोकॉल करने के लिए, कुछ महत्वपूर्ण चरणों का उल्लेख किया जाना चाहिए। सबसे पहले, लार्वा zebrafish के विकास हालत उपज अपेक्षित परिणाम के लिए महत्वपूर्ण है। लार्वा zebrafish के जननांगों विकास एक अत्यधिक गतिशील प्रक्रिया है। आकार और जननांगों के ऊतकों की उपस्थिति जानवरों 27 के विकास के चरणों के द्वारा निर्धारित किया जाता है। यह मानकीकृत हालत में zebrafish के विभिन्न समूहों के बनाए रखने के लिए महत्वपूर्ण है। कारक है कि लार्वा के विकास को प्रभावित कर सकते जनसंख्या घनत्व, प्रकाश की अवधि और अंधेरे चक्र, भोजन की उपलब्धता और भोजन कार्यक्रम शामिल हैं। लार्वा मछली के मानक लंबाई मापन जानवरों 22 के विकास की स्थिति निर्धारित करने के लिए एक गाइड के रूप में इस्तेमाल किया जा सकता। सफल जननांगों ऊतक ISOLAT के लिए एक दूसरा महत्वपूर्ण कारकआयन रिश्तेदार की स्थिति और जननांग और आसपास के ऊतकों के बीच रूपात्मक मतभेद की अच्छी समझ है। क्योंकि जननपिंड तैरना मूत्राशय के उदर ओर स्थित है, यह शुरू में तैरने मूत्राशय के साथ एक साथ जननांग अलग करने के लिए सुविधाजनक है। इसके अलावा, जननांग के दूरस्थ सिरे कसकर पेट के दूरस्थ सिरे से जुड़ा हुआ है। तो एक जब बाहर का सिरों पर जननपिंड से पेट को दूर करने के लिए सावधान रहना पड़ता है। बाद में जीन अभिव्यक्ति विश्लेषण के लिए, यह पूर्व ठंडा मीडिया और अगर प्लेट का उपयोग करने, और जल्दी से पूरी प्रक्रिया का प्रदर्शन जरूरी है।

ऐसा ही एक विधि सफलतापूर्वक रफ केटिंग एट अल द्वारा उपयोग किया गया है। 28। वे piRNAs के समारोह और 3 सप्ताह के लार्वा में Piwi मार्ग की जांच के लिए जननपिंड अलगाव विधि लागू होता है। यहाँ, हम के रूप में जल्दी 17 DPF के रूप में zebrafish लार्वा से जननांगों ऊतक विच्छेदित विकास के आणविक पहचान और जीन अभिव्यक्ति प्रोफ़ाइल का पता लगाने केपिंग zebrafish जननपिंड। पहले पृथक जननांगों ऊतक के भविष्य आणविक विश्लेषण तंत्र zebrafish में सेक्स विकास अंतर्निहित स्पष्ट करना transcriptome, methylome और हिस्टोन एसिटिलीकरण पैटर्न निर्धारित करने के लिए किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों की घोषणा वे कोई प्रतिस्पर्धा वित्तीय हितों की है।

Acknowledgments

हम मछली की देखभाल के लिए सी जांग धन्यवाद। यह काम चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन (31171074, 31371099 और 31571067 जीपी के लिए) द्वारा और Pujiang प्रतिभा परियोजना (09PJ1401900 जीपी के लिए) द्वारा समर्थित किया गया।

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics