애벌레 Zebrafish의 생식소 조직의 해부

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

여기서 우리는 제브라 피쉬 섹스의 분화 및 유지 보수의 조사를 용이하게 애벌레 제브라 피쉬의 성선 조직을 분리하기위한 프로토콜을 제시한다.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

야생 제브라 피쉬는 ZZ / ZW 성 결정 시스템을 가지고 있지만, 길 들여진 제브라 피쉬는 성 염색체를 잃었다. 그들은 게놈가 공동으로 개별 물고기의 성 정체성을 결정 전반에 걸쳐 여러 유전자가 분산 polygenic 성 결정 시스템을 활용합니다. 현재 유전자는 생식소의 발달을 조절에 관여하고 작동 방법이 어려운 남아있다. 일반적으로, 성선 조직을 분리하는 것은 성 발달 과정을 조사하기위한 첫 번째 단계입니다. 여기서 우리는 zebrafish의 유충 DPF (17) DPF (일 포스트 수정) 25에서 성선 조직을 분리하는 방법을 제시한다. 분리 된 성선 조직은 연속적 형태 및 유전자 발현 프로파일 링에 의해 조사 할 수있다.

Introduction

야생 제브라 피쉬 염색체 4의 주요 여성 성 결정은 1 (즉, 일반적인 실험실 균주)를 분실하거나 들여진 제브라 피쉬에서 수정됩니다. 대신, 그들은 온도, 저산소증, 식품 가용성 및 인구 밀도 등 환경 요인에 의해 동행 polygenic 성 결정 시스템을 가지고있다. 제브라 피쉬 성 개발의 상세한 메커니즘은 완전히 이해되지 않습니다. 일차 성 판정 신호 (들) / 무엇 이러한 제브라 성 결정이 발생한 경우 등의 근본적인 문제가 있으며, 유전자 생식선 변환의 제 1 단계는, (3) 2 답변 남아 조절한다.

제브라 피쉬 성 개발의 과정에서 몇 가지 중요한 단계로 인식되고있다. 개발의 초기 단계에서, 4 HPF (시간 포스트 수정) 원시 생식 세포 (PGC와) 사양을 받아야에서 시작 생식기 능선 마이그레이션 및분아 증식. PGC 번호와 생식 세포와 체세포 사이의 상호 작용은 생식선 차별화 4 중요하다. 13 DPF (일 포스트 수정)에서, 생식선은 미분화 단계에 있습니다. 17 DPF으로 생식선 미래의 여성과 남성 모두에서 양방향 가능성이 난소로 발전. 난소에서 세포 사멸에 의존 전환은 고환에 21 ~ 25 DPF에서 시작하고 몇 주 동안 계속 사용할 수 있습니다. DPF (35)에 의해 상기 생식선의 성별 결정된 성별 별 생식 생산 7 양쪽 난소에서 진행되고, 6, 5 고환.

지금까지 다양한 후보 유전자 및 성 결정 메커니즘이 제안되었다. 단백질 체학 및 transcriptomic 분석은 성적으로 동종 이형 표현으로 많은 유전자를 격리하고 이들 유전자는 제브라 피쉬 (8)에서 성 차별을 연구하기 위해 사용되어왔다 9,10. 예를 들면, 애벌레 제브라에서 cyp19a1a 유전자 특이 아니라 고환 (11), (12) 난소 표현된다. 또한 AMH 유전자 약하게 난소 난포 과립 막 세포에서 발현되지만 강하게 정소 세르 톨리 세포 (13)이다. 반대로, 바사 유전자가 지속적으로 적합한 생식선 마커 (14), (15) 제조, 남녀 모두 지브라 피쉬의 생식 세포에서 발현된다.

생식선 유전자 발현 량을 조사하는 것은, 특히 양방향 전위 난소 단계 3, 9에 결정 성 및 분화의 분자 메커니즘을 이해하는 것이 중요하다. 그러나 애벌레 제브라 피쉬와 상응 작은 생식선의 작은 크기 gonada의 분리를 복잡하게추가로 분자 분석을위한 조직 L. 사용 이전의 연구는 opercula 항문 구멍 (16) 사이에 전체 트렁크 영역을 해부. 이 준비는 포함 생식선 있지만, 여러 조직과 기관으로 구성되어 있습니다. 대안 적으로, 바사 같은 성선 GFP 특이 식 트랜스 제닉 동물 : EGFP는 형광 활성화 세포 분류 (FACS)과 레이저 캡처 마이크로 해부 (17), (18)를 통하여 생식선 조직의 분리를 위해 사용 하였다. 그러나 그들의 광범위한 응용이 제한됩니다. 여기, 우리는 17 DPF 25 DPF에서 애벌레 제브라 피쉬에서 성선 조직을 분리하는 간단한 절차를 설명합니다. 우리는 다른 기관에 대한 생식선의 위치를 ​​보여 주변 조직에서 형태 학적 손상 생식선을 격리 할 것. 우리는 더 높은 정량 PCR을 통해 트렁크 조직 (과 비교 고립 된 생식선로 표현 등 바사와 cyp19a1a과 생식선 특정 유전자를 보여qPCR에) 분석. 본 프로토콜은 이에 생식기 조직 (19)의 연속적인 분자 분석을 가능하게 식별, 분리, 정제 및 RNA 유생 지브라 피쉬의 생식선 특정 유전자의 증폭을 허용한다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Zebrafish의 실험은 복단 대학 기관 동물 관리 및 사용위원회에 의해 승인되었습니다. Zebrafish의 표준 절차 (20)에 따라 상승과 사육되었다.

1. 준비

  1. 애벌레 zebrafish의 DPF (17) DPF 25 육성
    1. 교차 전날 늦은 오후에 건너 탱크로 전송이 남성과 두 여성 성인 제브라 피쉬 (건강, 기존 3 개월에서 6 개월, 실험실 앱 스트레인). 장벽으로 남성과 여성을 분리합니다. 다음 날 아침, 탱크의 물을 새로하고 그들이 짝짓기를 할 수 있도록 장벽을 제거합니다. 100mm 배양 접시 수정 후 1 ~ 2 시간에서 계란을 수집합니다.
    2. 초기 개발 시간 (4 일) 동안 285 ° C에서 40 mL의 배아 매체 (EM)가 100mm의 접시에 약 40 배아를 유지하고 하루 두번 EM을 새로. 1 L 탱크 (300 mL의 시스템 물 (40) 유충)에 유충을 전송하고 5 DPF 후 라이브 로티퍼 (전체 공급, 하루에 두 번)로 공급.10 DPF 후 대신 로티퍼 다이어트의 라이브 소금물 새우 피드. 21 DPF (14)에 다시 물 순환 시스템에 물고기를 전송합니다.
    3. DPF (17) 또는 DPF (25)까지 다시 순환 시스템 유충 제브라 올리기. 광 / 암 사이클을 보장하는 시스템 물 10분의 14 H하여 pH 값은 약 7.2이다. DPF (17) (5.5 ~ 6.8 mm) 및 DPF (25) 유충 22 (8 mm 내지 11)의 본체의 길이를 측정한다.
  2. 해부 2 % 한천 플레이트를 준비합니다.
    1. 200 ㎖의 멸균 수에 4g 한천 추가. 이 투명 될 때까지 전자 레인지에 가열하여 혼합합니다.
    2. 다음, 직경 60mm 페트리 접시 (플레이트의 약 1/3 부피)에 부어 약 15 분 동안 한천 용액을 냉각. 4 ℃에서 응고 한천 플레이트를 저장합니다.

2. 프로토콜 : 1 애벌레 DPF 성선의 (17)의 조직과 25 해부

  1. 17 DPF의 애벌레를 마취 탱크에 얼음 조각을 추가합니다. 전송할30 mL의 차가운 링어의 솔루션 페트리 접시 차게 100 mm의 마취 유충. 완전히 유충을 마취 적어도 15 분 동안 냉각 링거액 배양 물고기를 유지합니다.
  2. 작은 플라스틱 스푼으로 미리 냉각 된 한천 플레이트에 유충을 전송합니다. 링거액을 차게 10 mL에 전체 물고기의 몸을 담그고 부드럽게 옆으로 누워.
  3. 25X 스테레오 현미경의 비전 필드에서 다음 작업을 수행합니다. 안정화를위한 핀셋 물고기 몸통을 클램프. 핀셋의 또 다른 쌍의 심장으로 항문에서 길이 방향으로 복부를 추출. 부드럽게 내부 장기를 노출 신체의 한쪽에 피부와 근육을 제거합니다.
  4. 주의 부레에 복부 장기의 질량을 제거합니다. 부레에 부착 된 생식선의 손상을 방지.
  5. 수영 방광과 전방 몸 사이의 연결을 잘라. 전체 부레 부드럽게 성선 조직을 잡아 당깁니다.
    참고 : 대부분의 경우S는, DPF (17)의 생식선 조직은 상피 조직과 주변 protonephridium 포함한다. 그들은 쉽게 서로 분리되지 않지만, 25 그것은 쉽게 분리 할 수 ​​DPF. 생식소는 항문에 연결되어 있습니다. 항문에서 서로 접속 좌우 생식선과 접합 명확히 표시 될 것이다.
  6. 주의 부레에서 성선 조직을 분리하고 주변의 지방 조직을 정리 핀셋을 사용합니다.
  7. 즉시 200 μL 링거액을 함유하는 예냉 1.5 mL의 원심 분리 튜브로 절연 생식선 조직 옮긴다. 모든 성선 조직이 유충에서 분리 될 때까지 얼음에 튜브를 유지합니다.
  8. 2.7 - 단계 2.1에 설명 된대로 유충 DPF (25)의 생식선을 해부하다.

3. 프로토콜 2 : 절연 성선 조직의 유전자 발현 분석

  1. 애벌레 성선 조직에서 총 RNA를 추출합니다.
    1. 새의 RNase없는 일에 고립 된 성선 조직을 전송합니다.5 ㎖의 튜브는 링거액을 제거합니다. 100 μL 용해 솔루션을 추가합니다. 조직까지 소용돌이가 완전히 용해된다.
    2. 제조업체의 지침에 따라 총 RNA 추출 절차를 수행합니다.
    3. 내가 버퍼 10 배의 DNase의 1/10 볼륨과 RNA 솔루션의 DNase I의 1 μL를 추가하고 부드럽게 섞는다. 37 ° C에서 20 분 동안 인큐베이션.
    4. RNA의 솔루션에 1/10 볼륨 DNase의 불 활성화 시약을 추가합니다. 70 ° C에서 10 분 동안 인큐베이션. 분광 광도계를 사용하여 전체 RNA의 농도를 측정한다. -20 ° C에서 보관하십시오.
  2. 첫 번째 가닥 cDNA 합성을 수행
    1. 제조의 프로토콜 다음 첫 번째 가닥 cDNA 합성을 수행 할 올리고 (DT) -linker 프라이머를 사용합니다. 20 μL에 총 반응 볼륨 1 RNA의 μg의 2를 추가합니다.
    2. 45 ° C에서 90 분 동안 반응 액을 인큐베이션. 5 분 동안 70 ℃에서 가열하여 반응을 정지.
    3. cDNA를 1 μL의 RNase H를 추가하기 때문에기술인 것 잔류 RNA를 제거합니다. ~ 13,000 X g에서 10 초 동안 부드럽게 원심 분리기 섞는다. 37 ° C에서 20 분 동안 인큐베이션. 20 μL 뉴 클레아없는 물을 추가합니다. -70 ° C에서 보관하십시오.
  3. 형광 정량 PCR을 수행
    1. 형광 염료와 자전거 타는 시스템에 qPCR을 수행합니다. 15 초, 30 초 동안 68 ° C를 들어, 15 초 동안 95 ° C에서 Tm은 -5 ℃로 35주기 다음 PCR 사이클링 조건을 사용한다. (: GTCCTGTTGTCTCCTACTGTCG, REV : FWD CATTTGAGTTGAATATGATGCCCTG), cyp19a1a :; : AMH (GCGGAGAGGTGGAAGAGAGAATG FWD : 회전 GTGGATGGCAGCAGTACGAC)를 다음과 같이 프라이머 시퀀스를 사용 nanos3 (FWD : GCTCGGTGTACGCCAAATCAACAT, REV : CCAAGTGAAAACACAACACCAGTGC), 바사 (FWD : ATCGCATAGGAAGAACTGGACGCT, REV : CCAAGTGAAAACACAACACCAGTGC) 및 β 액틴 (FWD : AGTGCGACGTGGACATCCGTA; REV : GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

생식기의 해부는 앱 스트레인 애벌레 제브라 피쉬에서 수행되었다. 도 1은 DPF (17)와 DPF (25)에서 유충 지브라 피쉬의 전형적인 생식선의 조직을 보여준다. 첫째, 피부와 복부의 한 쪽의 근육은 내부 장기를 노출 절단한다. 내부 장기의 질량을 제거한 후, 함께 생식소와 부레 트렁크에 남아 있습니다. 생식선은 ( '도 1b에 화살표) 부레의 복부 측면에 부착 하였다. DPF (17)에서, 생식선은 양방향 전위 난소 스테이지였다. 분리 된 생식선은 좌우 생식선을 포함하고 (그림 1C) 반투명했다. 대부분의 경우에서, 상피 조직과 protonephridium (도 1c의 화살표)로 둘러싸여 있었다. 생식선 DPF (25)에서 주로 지방 조직 (도 1D)으로 감싸졌다. 이 개발 성에서나이는, 크고 작은 하나 생식선을 관찰 할 수있다. 미성숙 난소 보조 난자의 개발 크다 및 모낭 세포는 생식선 볼륨 (도 1E)을 증가시킨다. 미성숙 정소 때문에 유생 난소 (도 1F)의 퇴화 및 사멸 작다.

고립 된 성선 조직의 분자 특성을 분석하기 위해, 우리는 먼저 AMH, cyp19a1a, nanos3와 바사, qPCR에 의한 제브라 피쉬의 네 개의 생식선 마커의 유전자 발현 수준을 조사했다. 총 RNA는 RNA 분리 키트를 이용 유생 생식기 조직 (N = 35)에서 추출 하였다. 또, 헤드와 유충 DPF (17)의 꼬리를 제거하고, 대조군 (n = 15)로 RNA를 추출 (심장 항문 기공 구조 사이) 트렁크 조직을 사용 하였다. 트렁크 조직은 피부, 근육, 뼈 (척추와 갈비뼈), 수영 방광, 신장, 생식선을 포함했다. 올리고 DT-P맺힌 cDNA를 qPCR에 사용되었다. qPCR의 결과는 약 397, 342, 45, 170 배, 각각 (도 2)에 의해 DPF (17)에 절연 생식선 조직 AMH, cyp19a1a, nanos3 바사발현 수준의 증가를 보였다.

그림 1
도 17 및 DPF (25)의 DPF 애벌레 Zebrafish의 전형적인 성선 1. 조직의 현미경 사진. (A)는 25X 스테레오 현미경으로 내부 장기를 노출 피부와 복부의 한 쪽의 근육을 추출. 내부 장기의 질량을 제거한 후, (B)는, 부레 및 생식선 트렁크에 연결된 상태로 유지. (B ')는 부레 상기 생식선의 상대 위치를 표시 패널 B에서 빨간색 박스 뷰 증폭. 생식선은 화살표로 표시된다. (C) 이소이 DPF (17)에서 생식선 조직 lated. 그림 (화살표)에 검은 생식선 조직에 부착 된 내피 조직과 protonephridium이다. (DE) 전 25 DPF에서 지방 조직 제거 후 큰 생식선. (F) (25)에 작은 DPF 생식선. 스케일 바 : 200 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 17 DPF의 트렁크와 고립 된 생식선에서 AMH, cyp19ala, nanos3와 바사의 2 정규화 유전자 발현 수준. 동물 번호는 사용 : 대조군, N = 15; 생식선 기, n- 대조군 = 35 줄기 조직은 머리와 꼬리없는 구조이다. 생식소 그룹은 고립 된 성선 조직을 의미한다./files/ftp_upload/55294/55294fig2large.jpg "target ="_ blank "> 검색이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

제브라 피쉬는 강력한 모델이되었다 광범위하게 개발 및 질병 관련 연구에 사용됩니다. 뇌, 심장, 생식선, 신장 등의 성인 제브라 피쉬에서 기관의 분리를위한 방법은,도 23, 24, 25를 기록하고있다. 때문에 작은 크기와 애벌레 제브라 피쉬의 성선 조직의 역동적 인 리모델링에, 성선 조직의 분리가 어려운 작업입니다. 애벌레 생식선 (26)을 조사 EGFP를 기반으로 셀 정렬 및 레이저 미세 절제 : 이전의 연구는 전체 해부 트렁크 조직이나 형질 전환 바사을 사용했다. 순화 동안 4 번 염색체의 변형은 결정 성 들여진 지브라 피쉬의 비밀을 만든다. 여기에 설명 된 우리의 방법은 성 결정 MECH을 탐구하는 것이 도움이 될 수있는 추가적인 형태 학적 및 분자 시험을 상대적으로 깨끗하고 초기 생식선 준비를 제공 할 수 있습니다anisms.

초기 개발 단계에서 다른 구조의 개발 생식선을 분리하는 것은 쉽지 않다. 우리의 방법은 절개를 수행하는 방법에 대해 설명합니다. 성공적으로이 프로토콜을 수행하려면 몇 가지 중요한 단계는주의 할 필요가있다. 첫째, 애벌레 제브라 피쉬의 성장 조건은 수율 예상되는 결과에 매우 중요합니다. 애벌레 제브라 피쉬의 생식 개발은 매우 역동적 인 과정이다. 크기와 성선 조직의 모양은 동물 (27)의 개발 단계에 의해 결정됩니다. 표준화 된 상태로 제브라 피쉬의 다른 배치를 유지하는 것이 중요하다. 유충의 성장에 영향을 미칠 수있는 요인은 인구 밀도, 빛의 시간과 어두운주기, 식품 가용성 및 공급 일정을 포함한다. 애벌레 물고기의 표준 길이 측정은 동물 (22)의 성장 상태를 확인하기위한 가이드로 사용할 수 있습니다. 성공적인 생식 조직 ISOLAT에 대한 두 번째 중요한 요소이온의 상대 위치 및 생식선과 주변 조직 사이의 형태 차이에 대해 잘 알고있다. 생식선이 부레의 복부 측에 위치하기 때문에, 처음에는 부레 함께 생식선을 분리하는 것이 편리하다. 또한, 상기 생식선의 선단부 단단히 창자의 원위 단부에 부착된다. 그래서 하나는 말단부에서 생식선에서 장을 제거 할 때주의해야한다. 이후 유전자 발현 분석의 경우, 사전 냉장 미디어와 한천 플레이트를 사용하고, 신속하게 모든 절차를 수행하는 것이 필수적입니다.

유사한 방법을 성공적 르 케팅 등으로 이용되고있다. (28). 그들은 piRNAs의 기능과 3 주 된 유충의 Piwi에 경로를 조사하기위한 생식선 분리 방법을 적용 하였다. 여기서는 develo의 분자 ID 및 유전자 발현 프로파일을 조사하기 위하여 17 초 DPF로서 제브라 유충 생식선 조직을 절개핑 제브라 피쉬의 생식선. 이전 격리 된 성선 조직의 미래 분자 분석은 제브라 피쉬에 성 개발의 기초가되는 메커니즘을 규명하기 위해 사체, methylome와 히스톤 아세틸 화 패턴을 결정하기 위해 수행 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

Acknowledgments

우리는 물고기 케어 C 장 감사합니다. 이 작품은 중국 국가 자연 과학 재단 (GP로 31171074, 31371099 및 31571067)에 의해 그리고 포강 인재 프로젝트 (GP에 09PJ1401900)에 의해 지원되었다.

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics