Dissecção de larval Zebrafish gonadal Tissue

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Aqui, apresentamos um protocolo para isolamento de tecido gonadal dos peixes-zebra larval, o que irá facilitar as investigações de diferenciação sexual peixe-zebra e manutenção.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embora peixe-zebra selvagem possuem um / ZW sistema de determinação do sexo ZZ, peixe-zebra domesticados perderam do cromossoma sexual. Eles utilizam um sistema de determinação do sexo poligénica, onde vários genes distribuídos ao longo do genoma determinar colectivamente as identidades do sexo de cada peixe. Atualmente, os genes envolvidos na regulação do desenvolvimento das gônadas e como eles funcionam ainda imperceptíveis. Normalmente, o isolamento de tecido gonadal é o primeiro passo para examinar os processos de desenvolvimento sexuais. Aqui, nós apresentamos um processo para isolar tecido gonadal de 17 dpf (dias após a fertilização) e 25 dpf larvas de peixe-zebra. O tecido gonadal isolado pode ser posteriormente examinada por morfologia e a expressão do gene de perfis.

Introduction

O principal determinante do sexo feminino em selvagem cromossoma peixe-zebra 4 for perdido ou modificado no peixe-zebra domesticado (por exemplo estirpes de laboratório comuns) 1. Em vez disso, eles têm um sistema de determinação do sexo poligénica acompanhados por factores ambientais tais como a temperatura, a hipoxia, a disponibilidade de alimentos e densidade populacional. As modalidades específicas do desenvolvimento sexual peixe-zebra não são totalmente compreendidos. As questões fundamentais, tais como quando a determinação do sexo do peixe-zebra ocorre, o que o sinal de determinação do sexo primário (s) é / são, e que os genes regulam o primeiro passo de transformação das gónadas permanecem sem resposta 2, 3.

No processo de desenvolvimento sexual peixe-zebra, várias etapas importantes foram reconhecidos. Na fase inicial de desenvolvimento, a partir de 4 HPF (horas após a fertilização) células germinativas primordiais (PGCs) submeter a especificação, a migração para e crista genitalproliferação. Números PGC e interacções recíprocas entre as células germinativas e células somáticas são importantes para a diferenciação gonadal 4. Aos 13 dpf (dias após a fertilização), as gónadas estão em fase indiferenciada. Por 17 dpf, as gônadas desenvolver em bi-potenciais ovários em ambos os sexos futuras. A transição dependente de apoptose a partir de ovário de testículo começam em 21 a 25 dpf e pode continuar durante várias semanas. Por 35 dpf, o sexo da gónada foi determinada e a produção de gâmetas específicos do sexo está em curso em ambos os ovários e de testículos de 5, 6, 7.

Até à data, diversos genes e os mecanismos de determinação do sexo candidatos têm sido propostos. Proteomics e análise do transcriptoma isolaram muitos genes com expressão dimorfismo sexual e estes genes foram utilizados para estudar diferenciação sexual em peixes-zebra 8, 9, 10. Por exemplo, no peixe-zebra larval, o gene cyp19a1a é especificamente expresso no ovário mas não no testículo 11, 12. Além disso, o gene AMH é fracamente expressa nas células da granulosa de folículos do ovário, mas fortemente em células de Sertoli de testículos 13. Em contraste, o gene de vasa é continuamente expressa nas células germinativas de ambos peixe-zebra macho e fêmea, tornando-o um marcador adequado gonadal 14, 15.

Investigar os níveis de expressão do gene gonadais é fundamental para compreender o mecanismo molecular de determinação e diferenciação sexual, especialmente na fase de ovário bi-potencial 3, 9. No entanto, o pequeno tamanho do peixe-zebra larval e, correspondentemente, pequenas gónadas complicam o isolamento da gónadal tecido para outras análises moleculares. Estudos anteriores usados dissecado região do tronco inteiro entre o opercula e poros anal 16. Esta preparação, embora contendo gónadas, consiste em vários tecidos e órgãos. Em alternativa, os animais transgénicos com expressão da GFP específica para-gonadal, tais como vasa: EGFP foram usadas para o isolamento de tecido gonadal através de células activadas por fluorescência (FACS) e captura de laser de micro-dissecção 17, 18. Mas a sua aplicação generalizada é limitado. Aqui, descrevemos um procedimento simples para isolar o tecido gonadal dos peixes-zebra larval em 17 dpf e 25 dpf. Nós demonstramos a posição das gónadas no que diz respeito a outros órgãos e isolar as gónadas morfologicamente intactas a partir dos tecidos circundantes. Mostramos ainda mais os genes específicos de gónadas, tais como vasos e cyp19a1a são altamente expresso nas gônadas isolado em comparação com o tecido do tronco por meio de PCR quantitativa (qPCR) análise. O presente protocolo permite a identificação, o isolamento, a purificação de ARN e amplificação de genes específicos gonadais de peixe-zebra larval, permitindo assim a análise molecular subsequente de tecido gonadal 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

experiências peixe-zebra foram aprovados pelo Comitê Animal Care Institucional e Use da Universidade Fudan. Peixe-zebra foram levantadas e produzido de acordo com os procedimentos padrão 20.

1. Preparações

  1. Cultivar a 17 dpf e 25 dpf peixe-zebra larval
    1. Transferência 2 do sexo masculino e 2 do peixe-zebra adultos do sexo feminino (saudável, 3 a 6 meses de idade, a estirpe de laboratório AB) para um tanque de passagem no final da tarde do dia antes do cruzamento. Separar os machos e fêmeas com uma barreira. Na manhã seguinte, atualizar a água do tanque e remova a barreira para permitir-lhes para acasalar. Coleta de ovos em 100 mm placas de Petri de 1 a 2 horas após a fertilização.
    2. Mantenha a cerca de 40 embriões numa placa de 100 mm, com 40 mL de meio de embrião (EM) a 28,5 ° C durante o período de desenvolvimento inicial (dia 4) e atualizar a EM duas vezes por dia. Transferência das larvas para tanques 1 L (40 larvas para 300 mL de água) e sistema alimentar com rotíferos vivos (alimentação total, duas vezes por dia) após a 5 dpf.Alimente camarão de água salgada ao vivo em vez de dieta rotíferos após 10 dpf. Transferir o peixe em água do sistema de recirculação em 14 dpf 21.
    3. Elevar peixe-zebra larval no sistema de água de recirculação até 17 dpf ou 25 dpf. Assegurar o ciclo de luz / escuro de 14/10 h é e valor de pH de água do sistema é de cerca de 7,2. Medir o comprimento de corpo de 17 dpf (5,5-6,8 mm) e 25 dpf (8 a 11 mm) 22 larvas.
  2. Preparar 2% placas de agar para a dissecção.
    1. Adicionar 4 g de agar a 200 mL de água estéril. Aqueça a mistura em um forno de microondas até que fique transparente.
    2. Arrefece-se a solução de agar durante cerca de 15 min, depois despejar 60 mm de diâmetro placas de Petri (aproximadamente 1/3 do volume da chapa). Armazenar as placas de agar solidificadas a 4 ° C.

2. Protocolo 1: Dissecar o tecido gonadal de 17 e 25 dpf Larvas

  1. Adicione gelo picado para o tanque para anestesiar 17 larvas dpf. transferir olarvas anestesiados para um 100 mm refrigeradas placa de Petri com solução de 30 ml de solução fria de Ringer. Manter o peixe incubadas em solução de Ringer geladas durante pelo menos 15 min para anestesiar completamente as larvas.
  2. Transferência das larvas para uma placa de ágar pré-arrefecida com uma pequena colher de plástico. Submerge todo o corpo do peixe em 10 mL refrigeradas solução de Ringer e suavemente colocá-lo sobre o seu lado.
  3. Fazer as seguintes operações sob o campo de visão do 25X microscópio estéreo. Prender o tronco peixe com uma pinça para estabilização. Rasgar o abdômen longitudinalmente a partir do ânus para o coração com outro par de pinças. Remova cuidadosamente a pele e os músculos de um lado do corpo para expor os órgãos internos.
  4. Retire a massa de órgãos ventral à bexiga natatória com cuidado. Evitar danos na gónada ligado à bexiga natatória.
  5. Cortar a ligação entre a bexiga natatória e corpo anterior. Retire toda a bexiga natatória e tecido gonadal suavemente.
    NOTA: Na maioria dos casoss, o tecido gonadal em 17 dpf contém circundante tecido epitelial e protonephridium. Eles não são facilmente separadas uma da outra, mas a 25 dpf pode ser facilmente separada. O gonadal também está ligado ao ânus. A junção com gônada esquerda e direita ligados uns aos outros no ânus será claramente visível.
  6. Utilizar uma pinça para separar cuidadosamente o tecido gonadal da bexiga natatória e limpar os tecidos adiposos adjacentes.
  7. Imediatamente transferir o tecido gonadal isolado para um tubo de centrífuga previamente arrefecido de 1,5 ml contendo solução de 200 ul da campainha. Manter o tubo em gelo até que todos os tecidos gonadais são separados a partir das larvas.
  8. Dissecar as gónadas de 25 dpf larvas, tal como descrito nas etapas 2.1 - 2.7.

3. Protocolo 2: Analisar Gene Expression dos isolados tecidos Gonadais

  1. Extrair o ARN total a partir dos tecidos gonadais larvares.
    1. Transferir os tecidos gonadais isolado para uma nova isenta de RNase 1.5 mL de tubo e remover a solução de Ringer. Adicionar 100 de solução de lise. Vortex até que os tecidos são completamente lisadas.
    2. Executar o procedimento da extracção total de ARN de acordo com as instruções do fabricante.
    3. Adicionar 1/10 volume de 10x ADNase I de tampão e 1 mL de ADNase I para a solução de ARN e misturar suavemente. Incubar durante 20 min a 37 ° C.
    4. Adicionar 1/10 volume de reagente de inactivao de DNase à solução de ARN. Incubar durante 10 min a 70 ° C. Medir a concentração do ARN total utilizando um espectrofotómetro. Armazenar a -20 ° C.
  2. Realizar a síntese de ADNc de primeira cadeia
    1. Usar um-ligante iniciador oligo (dT) para realizar a síntese da primeira cadeia de cDNA, seguindo o protocolo do fabricante. Adicionar 1 a 2 ug de RNA para um volume total de reacção de 20 uL.
    2. Incubar a solução de reacção durante 90 minutos a 45 ° C. Terminar a reacção por aquecimento a 70 ° C durante 5 min.
    3. Adicionar 1 mL de ARNase H para o cDNA assimlução para remover o ARN residual. Misturar suavemente e centrifuga-se durante 10 s a 13000 x g ~. Incubar durante 20 min a 37 ° C. Adicionar 20 ul de água livre de nuclease. Armazenar a -70 ° C.
  3. Executar PCR quantitativa fluorescente
    1. Execute qPCR em um sistema cycler com um corante fluorescente. Use as seguintes condições de ciclos de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Use sequências iniciadoras como se segue: a HAM (Fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (Fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (Fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (Fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) e β-actina (Fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dissecções das gónadas foram realizadas na AB strain peixe-zebra larval. A Figura 1 mostra tecido gonadal típico de peixe-zebra de larvas no 17 dpf e 25 dpf. Em primeiro lugar, a pele e os músculos de um lado do abdômen é cortado para expor os órgãos internos. Depois de retirar a massa dos órgãos internos, a bexiga natatória, juntamente com a gônada permanecer no tronco. O gonadal foi ligado ao lado ventral da bexiga natatória (seta na Figura 1B '). Aos 17 dpf, a gónada estava na fase ovário bi-potencial. O gonadal isolado continha a esquerda e a direita gónada e era translúcido (Figura 1C). Na maioria dos casos, foi rodeado por tecido epitelial e protonephridium (seta na Figura 1C). Aos 25 dpf a gónada foi frequentemente envolvido por tecido adiposo (Figura 1D). Neste desenvolvimento stidade, seja grande ou pequeno gonadal podem ser observados. O ovário imaturos é grande como o desenvolvimento dos oócitos secundários, e as células foliculares aumentar o volume das gónadas (Figura 1E). O testículo imaturo é pequeno por causa da degeneração e apoptose de ovário de larvas (Figura 1F).

Para analisar as propriedades moleculares dos tecidos gonadais isolados, primeiro examinaram os níveis de expressão de genes de AMH, cyp19a1a, nanos3 e vasa, quatro marcadores gonadal de peixe-zebra, por qPCR. O ARN total foi extraído a partir de tecidos larvais gonadais (n = 35), utilizando um kit de isolamento de ARN. Em adição, removeu-se a cabeça e cauda de 17 dpf larva, e usado o tecido do tronco (entre a estrutura do coração e dos poros anal) para extrair ARN como o grupo de controlo (n = 15). O tecido do tronco incluído pele, músculo, osso (vértebras e costelas), bexiga natatória, rim e das gónadas. Oligo dT-pADNc rimed foi usada para qPCR. O resultado qPCR mostraram aumentos nos níveis de HAM, cyp19a1a, nanos3 e expressão vasa em 17 de tecido gonadal dpf isolado por cerca de 397, 342, 45 e 170 vezes, respectivamente (Figura 2).

figura 1
Figura 1. Microfotografias de tecidos gonadais típicas em larvas de peixe-zebra em 17 dpf e 25 dpf. (A) Rip a pele e os músculos de um lado do abdómen para expor os órgãos internos sob um microscópio estéreo 25X. (B) Depois de retirar a massa dos órgãos internos, a bexiga natatória e a gónada permanecem ligados ao tronco. (B ') amplificado vista da caixa vermelha no painel B para mostrar a posição relativa da bexiga natatória e a gónada. O gónada é indicada pela seta. (C) Iso lada tecido gonadal em 17 dpf. Os tecidos negros na imagem (setas) é a tecido endotelial e protonephridium ligado a gónada. (DE) Um grande gonadal antes e depois da remoção do tecido adiposo a 25 dpf. (F) Um pequeno gonadal a 25 dpf. Barras de escala: 200? m. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Níveis normalizadas Expressão genética de AMH, cyp19ala, nanos3 e vasa nos troncos e Isolado Gonads em 17 dpf. Os números de animais utilizados: grupo de controlo, n = 15; grupo gonadal, n = 35. Os tecidos tronco no grupo de controlo são, sem a cabeça e as estruturas da cauda. grupo gónada refere-se aos tecidos gonadais isolado./files/ftp_upload/55294/55294fig2large.jpg" target = '_ blank'> Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O peixe-zebra tornou-se um modelo poderoso e é amplamente utilizado no desenvolvimento e investigação relacionada com a doença. Os métodos para o isolamento de órgãos no peixe-zebra adulto, tais como tumores do cérebro, coração, gônadas e rim, foram bem documentados 23, 24, 25. Devido ao pequeno tamanho e remodelação dinâmica dos tecidos gonadais no peixe-zebra larval, o isolamento de tecido gonadal é uma tarefa difícil. Estudos anteriores utilizaram tecidos inteiros dissecado tronco ou vasa transgênico: célula com base EGFP triagem e microdissecção a laser para examinar as gônadas larvais 26. As modificações do cromossoma 4 durante domesticação torna a determinação do sexo um mistério no peixe-zebra domesticado. O nosso método descrito aqui pode proporcionar preparações de gónadas relativamente limpas e início dos anos para exames complementares morfológicas e moleculares, o que pode ser útil para explorar a Mech determinante do sexonismos.

Não é fácil separar a gônada em desenvolvimento de outras estruturas nas primeiras fases de desenvolvimento. Nosso método descreve como realizar a dissecção. Para realizar com sucesso este protocolo, alguns passos críticos precisam ser observados. Em primeiro lugar, o estado de crescimento do peixe-zebra larval é crítico para os resultados do rendimento esperado. O desenvolvimento gonadal dos peixes-zebra larval é um processo altamente dinâmico. O tamanho e a aparência dos tecidos gonadais são determinadas pelas fases de desenvolvimento dos animais 27. É importante manter diferentes lotes de peixe-zebra em condições padronizadas. Os factores que podem influenciar o crescimento de larvas incluem densidade populacional, a duração de luz e os ciclos de escuro, a disponibilidade de alimentos e esquemas de alimentação. A medida do comprimento padrão de larvas de peixes pode ser usado como um guia para determinar o estado de crescimento dos animais 22. Um segundo factor crítico para o sucesso isola tecido gonadalião é um bom conhecimento da posição relativa e diferenças morfológicas entre as gónadas e os tecidos circundantes. Porque a gónada é localizado para o lado ventral da bexiga natatória, é conveniente isolar inicialmente as gónadas juntamente com a bexiga natatória. Além disso, a extremidade distal das gónadas é rigidamente ligada à extremidade distal do intestino. Assim, tem de se ter cuidado quando se remove do intestino a partir da gónada nas extremidades distais. Para análise da expressão do gene subsequente, é essencial que se utilize meios de pré-refrigerados e placa de ágar, e realizar todo o procedimento rapidamente.

Um método semelhante foi utilizada com sucesso por RF Ketting et al. 28. Eles aplicado o método de isolamento das gónadas para investigar a função de piRNAs e da via piwi em larvas de 3 semanas de idade. Aqui, dissecados de tecido gonadal de larvas de peixe-zebra tão cedo como 17 dpf para explorar a identidade e o gene perfil de express molecular do desende ping gônada de peixe-zebra. análises moleculares futuros do tecido gonadal isolado anteriormente podem ser realizados para determinar os padrões de transcriptoma, methylome e acetilação das histonas para elucidar os mecanismos subjacentes ao desenvolvimento sexual no peixe-zebra.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes.

Acknowledgments

Agradecemos C Zhang para o cuidado de peixe. Este trabalho foi financiado pela National Science Foundation Natural da China (31171074, 31371099 e 31571067 para GP) e pelo Projeto Talentos Pujiang (09PJ1401900 para GP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics