Dissection de tissu gonadique Larval Zebrafish

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Nous présentons ici un protocole pour isoler gonades des larves de poisson zèbre, ce qui facilitera les enquêtes de la différenciation sexuelle et l'entretien du poisson zèbre.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bien que le poisson zèbre sauvage possède un ZZ / ZW système de détermination du sexe, ont perdu domestiqué zebrafish le chromosome sexuel. Ils utilisent un système de détermination du sexe polygénique, où plusieurs gènes répartis dans le génome déterminent collectivement l'identité sexuelle des individus. À l'heure actuelle, les gènes impliqués dans la régulation du développement des gonades et comment ils fonctionnent demeurent insaisissables. Normalement, l'isolement gonades est la première étape pour examiner les processus de développement sexuels. Nous présentons ici une procédure pour isoler gonades de 17 dpf (jours de la fécondation) et 25 dpf larves de poisson zèbre. Le tissu gonadique isolé peut ensuite être examiné par le profilage de la morphologie et de l'expression génique.

Introduction

Le principal déterminant du sexe féminin dans le chromosome 4 est sauvage zebrafish perdu ou modifié dans le poisson zèbre domestique (c. -à- souches de laboratoire communes) 1. , Ils ont plutôt un système de détermination du sexe polygénique accompagnée par des facteurs environnementaux tels que la température, l'hypoxie, la disponibilité alimentaire et de la densité de la population. ne sont pas pleinement compris les mécanismes détaillés de développement sexuel poisson zèbre. Des questions fondamentales telles que lors de la détermination du sexe se produit, ce poisson zèbre le signal primaire de détermination du sexe (s) est / sont et quels gènes régulent la première étape de la transformation des gonades reste à répondre 2, 3.

Dans le processus de développement sexuel poisson zèbre, plusieurs étapes importantes ont été reconnues. Au début du stade de développement, à partir de 4 HPF (heures de fécondation) des cellules germinales primordiales (PGC) sont soumises à la spécification, la migration vers la crête génitale etprolifération. Les nombres de PGC et les interactions réciproques entre les cellules germinales et les cellules somatiques sont importantes pour la différenciation des gonades 4. A 13 dpf (jours de la fécondation), les gonades sont au stade indifférencié. Par 17 dpf, les gonades se développent dans les ovaires bi potentiel dans les deux futures femmes et les hommes. La transition dépendant de l'apoptose de l'ovaire à testiculaire commencent à 21 à 25 dpf et peut se poursuivre pendant plusieurs semaines. Par 35 dpf, le sexe de la gonade a été déterminée et la production de gamètes spécifique du sexe est en cours dans les deux ovaires et les testicules 5, 6, 7.

À ce jour, divers gènes candidats et les mécanismes de détermination du sexe ont été proposées. Protéomique et l' analyse de transcriptome ont isolé plusieurs gènes dont l' expression dimorphisme sexuel et ces gènes ont été utilisés pour étudier la différenciation sexuelle chez le poisson zèbre 8, 9, 10. Par exemple, chez le poisson zèbre larvaire, le gène cyp19a1a est exprimé spécifiquement dans l'ovaire , mais pas dans le testicule 11, 12. De plus, le gène de l' AMH est faiblement exprimé dans les cellules granuleuses des follicules ovariens, mais fortement dans les cellules de Sertoli testiculaires 13. En revanche, le gène de vasa est exprimé en continu dans les cellules germinales à la fois le poisson zèbre mâle et femelle, ce qui en fait un marqueur de gonade approprié 14, 15.

Enquête sur les niveaux d'expression du gène gonadiques est essentiel pour comprendre le mécanisme moléculaire de la détermination du sexe et de la différenciation en particulier au stade de l' ovaire bi-potentiel 3, 9. Cependant, la petite taille du poisson zèbre larvaire et des gonades de façon correspondante de petits compliquer l'isolement des gonadal tissu pour une analyse plus poussée moléculaire. Des études antérieures utilisées toute la région du tronc disséqués entre les opercules et pores anal 16. Cette préparation, bien que contenant gonades, se compose de plusieurs tissus et organes. En variante, des animaux transgéniques avec expression de GFP spécifique de gonade tels que vasa: EGFP ont été utilisés pour l' isolement des tissus gonadiques par tri cellulaire activé par fluorescence (FACS) et des micro-dissection par capture laser 17, 18. Mais leur application à grande échelle est limitée. Ici, nous décrivons une procédure simple pour isoler gonades des larves de poisson zèbre à 17 dpf et 25 dpf. Nous démontrons la position des gonades par rapport à d'autres organes et d'isoler les gonades des tissus environnants morphologiquement intacts. Nous montrons en outre les gènes spécifiques gonades tels que Vasa et cyp19a1a sont fortement exprimés dans les gonades isolées par rapport au tissu du tronc par PCR quantitative (analyse qPCR). Le présent protocole permet l' identification, l' isolement, la purification de l' ARN et l' amplification de gènes spécifiques des gonades de poisson zèbre larvaire, ce qui permet une analyse moléculaire ultérieure du tissu gonadique 19.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

des expériences ont été approuvées par le poisson-zèbre le soin des animaux Université Fudan Comité institutionnel. Zebrafish ont été soulevées et élevés selon des procédures standard 20.

1. Préparation

  1. Cultiver 17 dpf et 25 dpf zebrafish larvaire
    1. Transfert 2 hommes et 2 femmes adultes poisson zèbre (santé, 3 à 6 mois, la souche de laboratoire AB) à un réservoir de passage dans l'après-midi avant le jour de passage. Séparer les hommes et les femmes avec une barrière. Le lendemain matin, rafraîchir l'eau du réservoir et enlever la barrière pour leur permettre de s'accoupler. Recueillir des œufs à 100 mm des boîtes de Petri 1 à 2 h après la fécondation.
    2. Gardez environ 40 embryons dans une plaque de 100 mm avec 40 ml de milieu d'embryon (EM) à 28,5 ° C au cours de la première période de développement (4 jours) et rafraîchir l'EM deux fois par jour. Transfert des larves à 1 réservoirs L (40 larves à 300 ml d'eau du système) et alimenter avec rotifères en direct (alimentation complète, deux fois par jour) après 5 dpf.Nourrissez les crevettes de saumure en direct au lieu de l'alimentation des rotifères après 10 dpf. Transférer le poisson dans le système d'eau de recirculation à 14 dpf 21.
    3. Élever des larves de poisson zèbre dans le système d'eau en recirculation a 17 dpf ou 25 dpf. Assurer que le cycle lumière / obscurité est 14/10 h et valeur pH de l'eau du système est d'environ 7,2. Mesurer la longueur de corps de 17 dpf (5.5 à 6.8 mm) et 25 dpf (8 à 11 mm) 22 larves.
  2. Préparer 2% des plaques d'agar pour la dissection.
    1. Ajouter 4 g d'agar à 200 ml d'eau stérile. Faire chauffer le mélange dans un four à micro-ondes jusqu'à ce qu'il devienne transparent.
    2. On refroidit la solution de gélose pendant environ 15 min, puis le verser dans de 60 mm de diamètre des boîtes de Petri (environ 1/3 du volume de la plaque). Conserver les plaques d'agar solidifiées à 4 ° C.

2. Protocole 1: Disséquer le gonades de 17 et 25 dpf Larves

  1. Ajouter de la glace pilée dans le réservoir pour anesthésier 17 larves de dpf. transférer lalarves anesthésié à une boîte de Petri réfrigérées 100 mm avec une solution de 30 ml à froid Ringer. Gardez le poisson dans la incubée solution de Ringer refroidie pendant au moins 15 min pour anesthésier complètement les larves.
  2. Transfert des larves à une plaque de gélose prérefroidi avec une petite cuillère en plastique. Immerger le corps entier de poisson dans 10 ml réfrigérées solution de Ringer et le poser délicatement sur le côté.
  3. Les opérations suivantes dans le champ de vision du microscope stéréo 25X. Fixer le tronc de poisson avec des pincettes pour la stabilisation. Extraire l'abdomen longitudinalement à partir de l'anus vers le cœur avec une autre paire de pinces à épiler. Retirez délicatement la peau et les muscles d'un côté du corps pour exposer les organes internes.
  4. Retirer la masse des organes ventrales à la vessie natatoire soigneusement. Evitez d'endommager la gonade attachée à la vessie natatoire.
  5. Coupez la connexion entre la vessie natatoire et le corps antérieur. Tirer sur toute la vessie natatoire et le tissu gonadique doucement.
    NOTE: Dans la plupart des cass, le tissu gonadique à 17 dpf contient entourant le tissu épithélial et protonephridium. Ils ne sont pas facilement séparés les uns des autres, mais à 25 dpf il peut être facilement séparés. La gonade est également reliée à l'anus. Une jonction avec gonades gauche et à droite reliés entre eux à l'anus sera clairement visible.
  6. Utiliser des pinces pour séparer soigneusement le tissu gonadique de la vessie natatoire et nettoyer les tissus adipeux environnants.
  7. Transférer immédiatement le tissu gonadique isolé à un prérefroidi tube de centrifugation de 1,5 ml contenant une solution de 200 ul Ringer. Gardez le tube sur la glace jusqu'à ce que tous les tissus gonadiques sont séparés des larves.
  8. Disséquer les gonades de 25 dpf larves comme décrit dans les étapes 2.1 - 2.7.

3. Protocole 2: analyser l'expression génique des tissus isolés gonadiques

  1. Extrait ARN total des tissus gonadiques larves.
    1. Transférer les tissus gonadiques isolés à une nouvelle RNase 1.tube 5 ml et retirer la solution de Ringer. Ajouter 100 ul d'une solution de lyse. Vortex jusqu'à ce que les tissus sont complètement lysées.
    2. Effectuez la procédure totale d'extraction d'ARN selon les instructions du fabricant.
    3. Ajouter 1/10 du volume de la DNase I 10x tampon et 1 ul de DNase I à la solution d'ARN et mélanger doucement. Incuber pendant 20 min à 37 ° C.
    4. Ajouter 1/10 de volume réactif d'inactivation de DNase à la solution d'ARN. Incuber pendant 10 min à 70 ° C. Mesurer la concentration de l'ARN total en utilisant un spectrophotomètre. Conserver à -20 ° C.
  2. Effectuer la synthèse d'ADNc du premier brin
    1. Utiliser une amorce lieur oligo (dT) pour effectuer la synthèse d'ADNc du premier brin suivant le protocole du fabricant. Ajouter de 1 à 2 ug d'ARN à un volume réactionnel total de 20 ul.
    2. Incuber la solution réactionnelle pendant 90 minutes à 45 ° C. Terminer la réaction par chauffage à 70 ° C pendant 5 min.
    3. Ajouter 1 pi de RNase H à l'ADNc de manièrelution pour éliminer l'ARN résiduel. Mélanger doucement et centrifuger pendant 10 s à ~ 13 000 x g. Incuber pendant 20 min à 37 ° C. Ajouter 20 ul nucléase d'eau libre. Stocker à -70 ° C.
  3. Effectuer une PCR quantitative fluorescent
    1. Effectuer qPCR sur un système cycleur avec un colorant fluorescent. Utiliser les conditions de cycle de PCR suivantes: 35 cycles à 95 ° C pendant 15 s, Tm-5 ° C pendant 15 s, 68 ° C pendant 30 s. Utilisation des séquences d' amorces comme suit: AMH (FWD: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (FWD: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (FWD: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) et β-actine (Fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dissections des gonades ont été effectuées sur la souche AB zebrafish des larves. La figure 1 représente un tissu gonadique typique des larves de poisson zèbre à 17 dpf et 25 dpf. Tout d'abord, la peau et les muscles d'un côté de l'abdomen est coupé pour exposer les organes internes. Après avoir enlevé la masse des organes internes, la vessie natatoire en même temps que la gonade restent dans le coffre. Le gonades a été attaché à la face ventrale de la vessie natatoire (flèche sur la figure 1B). A 17 dpf, la gonade était au stade de l'ovaire bi-potentiel. La gonade isolé contenait la gauche et la droite et la gonade était translucide (Figure 1C). Dans la plupart des cas, il était entouré de tissu épithélial et protonephridium (flèche dans la figure 1C). A 25 dpf la gonade était souvent enveloppé par les tissus adipeux (figure 1D). A ce développement stâge, que ce soit grand ou petit gonades peut être observée. L'ovaire immature est grand que le développement des ovocytes secondaires, et les cellules des follicules augmenter le volume des gonades (figure 1E). Le testiculaire immature est faible en raison de la dégénérescence et l' apoptose de l'ovaire des larves (figure 1F).

Pour analyser les propriétés moléculaires des tissus gonadiques isolés, nous avons d' abord examiné les niveaux d'expression des gènes de l' AMH, cyp19a1a, nanos3 et vasa, quatre marqueurs gonadiques chez le poisson zèbre, par qPCR. L'ARN total a été extrait des tissus gonadiques larvaires (n = 35) en utilisant un kit d'isolement d'ARN. En outre, nous avons retiré la tête et de la queue de 17 dpf larve, et utilisé le tissu du tronc (entre la structure du cœur et des pores anal) pour extraire l'ARN en tant que groupe témoin (n = 15). Le tissu du tronc compris la peau, les muscles, les os (vertèbres et des côtes), la vessie natatoire, rein et gonades. Oligo dT-primed ADNc a été utilisé pour la qPCR. Le résultat a montré une augmentation de qPCR AMH, cyp19a1a, nanos3 et les niveaux d' expression de vasa dans 17 le tissu gonadique dpf isolé d'environ 397, 342, 45 et 170 fois, respectivement (Figure 2).

Figure 1
Figure 1. microphotographies des tissus typiques gonadique chez des larves de poisson zèbre à 17 dpf et 25 dpf. (A) Rip la peau et les muscles d'un côté de l'abdomen pour exposer les organes internes au microscope stéréo 25X. (B) Après avoir retiré la masse des organes internes, de la vessie natatoire et la gonade restent attachés au tronc. (B ') vue amplifiée de la boîte rouge dans la partie B pour indiquer la position relative de la vessie natatoire et la gonade. La gonade est indiquée par la flèche. (C) Iso lated tissu gonadique à 17 dpf. Les tissus noirs dans l'image (flèches) sont le tissu endothelial et protonephridium attaché à gonade. (DE) Un grand gonades avant et après le retrait du tissu adipeux à 25 dpf. (F) Un petit gonades à 25 dpf. Barres d'échelle: 200 um. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2. Expression génique Normalisé AMH, cyp19ala, nanos3 et Vasa dans les Trunks et les gonades isolés à 17 dpf. Le nombre d'animaux utilisés: groupe témoin, n = 15; groupe des gonades, n = 35. Les tissus du tronc dans le groupe de contrôle ne présentent pas la tête et les structures de la queue. groupe gonade se réfère aux tissus gonadiques isolés./files/ftp_upload/55294/55294fig2large.jpg » target = « _ blank »> S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le poisson zèbre est devenu un modèle puissant et est largement utilisé dans le développement et la recherche liée à la maladie. Les méthodes d'isolement des organes chez le poisson zèbre adulte tels que le cerveau, le cœur, gonades, et les reins, ont été bien documentés 23, 24, 25. En raison de la petite taille et le remodelage dynamique des tissus gonadiques du poisson zèbre larvaire, l'isolement des gonades est une tâche difficile. Des études antérieures utilisées entières tissus du tronc disséqué ou Vasa transgénique: le tri de cellules à base EGFP et microdissection laser pour examiner les gonades des larves 26. Les modifications du chromosome 4 au cours de la domestication rend la détermination du sexe d'un mystère dans le poisson zèbre domestique. Notre méthode décrite ici peut fournir des préparations de gonades relativement propres et au début pour d'autres examens morphologiques et moléculaires, ce qui peut être utile pour explorer le mech déterminant le sexenismes.

Il est difficile de séparer les gonades en développement d'autres structures au début des étapes de développement. Notre méthode décrit comment effectuer la dissection. Pour réaliser avec succès ce protocole, certaines étapes critiques doivent être notées. Tout d'abord, la condition de la croissance des larves de poisson zèbre est essentielle pour donner les résultats escomptés. Le développement des gonades de larves de poisson zèbre est un processus très dynamique. La taille et l' apparence des tissus gonadiques sont déterminés par les étapes de développement des animaux 27. Il est important de maintenir différents lots de poisson zèbre dans un état standard. Les facteurs qui peuvent influer sur la croissance des larves comprennent la densité de la population, la durée de la lumière et les cycles sombres, la disponibilité des aliments et des horaires d'alimentation. La mesure de la longueur standard des larves de poissons peut être utilisé comme guide pour déterminer l'état de croissance des animaux 22. Un second facteur critique pour le tissu gonadique succès isolation est une bonne compréhension de la position relative et des différences morphologiques entre les gonades et les tissus environnants. Parce que la gonade est situé à la face ventrale de la vessie natatoire, il convient d'isoler d'abord les gonades en même temps que la vessie natatoire. En outre, l'extrémité distale des gonades est étroitement fixé à l'extrémité distale du tube digestif. Donc, on doit faire attention lors du retrait du tube digestif de la gonade aux extrémités distales. Pour une analyse ultérieure de l'expression des gènes, il est essentiel d'utiliser des supports pré-réfrigérés et plaque de gélose, et effectuer rapidement toute la procédure.

Une méthode similaire a été utilisée avec succès par RF Ketting et al. 28. Ils ont appliqué la méthode d'isolement des gonades pour étudier la fonction de piRNAs et la voie de PIWI dans des larves âgées de 3 semaines. Ici, nous avons disséqué gonades des larves de poisson zèbre dès 17 dpf pour explorer le profil de l'identité moléculaire et l'expression génique du déveping gonades poisson zèbre. Des analyses moléculaires futures du tissu gonadique plus tôt isolés peuvent être effectués pour déterminer les motifs transcriptome, méthylome et acétylation des histones pour élucider les mécanismes sous-jacents du développement sexuel chez le poisson zèbre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils ont pas d'intérêts financiers concurrents.

Acknowledgments

Nous remercions C Zhang pour les soins de poissons. Ce travail a été soutenu par la Fondation nationale des sciences naturelles de Chine (31171074, 31371099 et 31571067 GP) et par le projet Talent Pujiang (09PJ1401900 GP).

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics