Larva Zebra balığı Gonadal Doku Diseksiyon

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Burada, Zebra balığı seks farklılaşması ve bakım soruşturmaları kolaylaştıracaktır larva zebrabalıkları, gonadal doku izole etmek için bir protokol mevcut.

Cite this Article

Copy Citation | Download Citations

Wang, X., Chen, S., Zhang, W., Ren, Y., Zhang, Q., Peng, G. Dissection of Larval Zebrafish Gonadal Tissue. J. Vis. Exp. (122), e55294, doi:10.3791/55294 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

vahşi Zebra balığı ZZ / ZW cinsiyet belirleme sistemine sahip olmasına rağmen, evcil Zebra balığı seks kromozomuna kaybetti. Bunlar genom topluca bireysel balık seks kimliklerini belirlemek boyunca çeşitli genler dağıtılan polıgenık eşey tayini sistemi kullanmaktadır. Şu anda, genler gonad gelişimini düzenleyen katılır ve nasıl çalışır zor kalır. Normal olarak, gonadal doku izole seks gelişim süreçleri incelemek için ilk adımdır. Burada, zebra balığı dpf larvaları 17 dpf (gün sonra döllenme) ve 25 ile gonadal doku izole etmek için bir prosedürdür. İzole gonadal doku daha sonra morfoloji ve gen ekspresyon profili ile incelenebilir.

Introduction

Vahşi Zebra balığı kromozomu 4'te önemli kadın seks belirleyici 1 (yani ortak laboratuar suşları) kaybolması veya evcil zebrabalıkları değiştirilir. Bunun yerine, sıcaklık, hipoksi, gıda temini ve nüfus yoğunluğu gibi çevresel faktörlerin eşliğinde polıgenık eşey tayini sistemi var. zebra balığı seks gelişme ayrıntılı mekanizması tam olarak anlaşılmış değildir. Birincil cinsiyet tespiti sinyal (ler) i / ne tür zebra balığı cinsiyet tespiti oluştuğunda gibi temel soru vardır ve genler gonad dönüşümün ilk adım, 3 2 cevaplanması gereken kalır düzenleyen.

Zebra balığı seks gelişim sürecinde, birçok önemli aşamalar kabul edilmiştir. gelişiminin erken safhasında, 4 HPF (saat sonra döllenme) primordiyal üreme hücreleri (PGC) özellikleri tabi başlanarak genital s göç veçoğalma. PGC sayıları ve germ hücreleri ve somatik hücreler arasındaki karşılıklı etkileşimler gonad farklılaşma 4 için çok önemlidir. 13 dpf (gün sonra döllenme) 'de, gonadlar farklılaşmamış aşamasındadır. 17 dpf'e olarak, gonadlar gelecek hem kadın hem erkeklerin de iki potansiyel yumurtalıkların içine gelişir. yumurtalık apoptozise bağımlı bir geçiş testise 21 ila 25 dpf başlar ve birçok hafta boyunca devam edebilir. 35 dpf ile, gonadal cinsiyet tespit edilmiştir ve cinsiyete spesifik gamet üretimi, 7 her iki yumurtalıkta devam etmektedir ve 6, 5 testisler.

Bugüne kadar, çeşitli aday genleri ve cinsiyet tespiti mekanizmaları önerilmiştir. Proteomik ve transkriptomik analizi, dimorfik ifade bulunan pek çok gen izole ettik ve bu genler zebrabalıkları 8 seks farklılaşma çalışma kullanılmıştır 9, 10. Örneğin, larva zebrabalıkları, cyp19a1a gen özel olarak fakat testis 11, 12 yumurtalık olarak ifade edilir. Buna ek olarak, AMH geni zayıf yumurtalık folikül granüloza hücrelerinde eksprese edilir, ancak güçlü bir testis Sertoli hücreleri 13 edilmektedir. Bunun aksine, vasa geni sürekli olarak uygun bir gonad işaretleyici 14, 15 yaparak, dişi ve erkek zebrabalıkları germ hücrelerinde ifade edilir.

Gonadal gen ekspresyon düzeyleri incelenmesi, özellikle iki potansiyel yumurtalık aşama 3, 9, cinsiyet tespiti ve diferansiyasyonuna ait moleküler mekanizmanın anlaşılması önemlidir. Bununla birlikte, larva zebrabalıkları ve mukabil ölçüde küçük gonad küçük boyutu gonada izolasyonunu karmaşıkDaha fazla moleküler analiz l dokusu. Kullanılan önceki çalışmalar opercula ve anal gözenek 16 arasındaki bütün gövde bölgesini disseke. Bu preparat içeren gonadlar, ancak birden fazla doku ve organların oluşur. Seçenek olarak ise, bu tür vas olarak gonad-spesifik GFP ekspresyonu ile transgenik hayvanları: EGFP flüoresan aktif hücre ayrıştırma (FACS) ve lazer yakalama mikro diseksiyon 17, 18 üzerinden gonadal doku izolasyonu için kullanılmıştır. Ama onların yaygın uygulama sınırlıdır. Burada, 17 dpf ve 25 dpf'e larva zebrafish gonadal doku izole etmek için basit bir prosedür açıklanmaktadır. Diğer organlarda göre gonad konumunu göstermekte ve çevre dokulardan morfolojik olarak bozulmamış gonadlar izole eder. Biz daha yüksek kantitatif PCR ile gövde dokusu (karşılaştırıldığında izole gonadlar olarak ifade edilmiştir, örneğin vaz ve cyp19a1a olarak gonad-spesifik genleri göstermektedirqPCR) analizi. Bu protokol, böylece gonad doku 19 daha sonra moleküler analiz sağlayarak, tanımlanmasını, izolasyonunu RNA saflaştırma ve larva zebrafish gonadal spesifik genlerin amplifikasyonuna olanak tanır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Zebra balığı deneyler Fudan Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Komitesi tarafından onaylandı. Balığı, standart prosedürlere 20'ye göre yükseltilmiş ve yetiştirildi.

1. hazırlıklar

  1. larva zebrabalıkları dpf 17 dpf ve 25 yetiştirmek
    1. geçiş gününden önce geç öğleden sonra bir geçiş tankına Transferi 2 erkek ve 2 dişi yetişkin zebra balığı (sağlıklı, eski 3 ila 6 ay, laboratuvar AB strain). Bir bariyer kadın ve erkeklerden ayırın. Ertesi sabah, tank suyu yenilemek ve onları çiftleşmeye izin engeli kaldırın. 100 mm Petri tabaklarda döllenmeden sonra 1 ila 2 saat içerisinde yumurta toplayın.
    2. Erken gelişim döneminde (4 gün) boyunca 28.5 ° C'de 40 ml embriyo ortamı (EM) ile bir 100 mm'lik plaka 40 embriyolar tutun ve günde iki kez EM yenileyin. 1 L tankları (300 ml sistem suyuna 40 larva) Larvalar aktarın ve 5 dpf sonra canlı rotifer (tam temini, günde iki kez) ile beslenirler.10 dpf'e sonra yerine rotiferin diyetin canlı tuzlu su karidesi besleyin. 21 dpf 14 yaşında yeniden dolaşan su sistemi içine balık aktarın.
    3. 17 dpf veya 25 dpf kadar yeniden dolaşan su sistemindeki larva zebrafish kaldırın. aydınlık / karanlık döngüsü sağlamak sistem su 14/10 saat ve pH değeri yaklaşık 7.2 olan. 17 dpf (5.5 mm 6.8) ve 25 dpf larvaları 22 (8 mm ila 11) arasında vücut uzunluğu ölçülür.
  2. diseksiyon için% 2 agar hazırlayın.
    1. 200 ml steril su 4 g agar ekleyin. saydam olana kadar bir mikrodalga fırınında karışım ısıtılır.
    2. daha sonra, 60 mm çapında Petri tabağı (plakanın yaklaşık 1/3 hacim) içine dökün, yaklaşık 15 dakika boyunca agar soğutun. 4 ° C'de katılaşmış Agar plakaları saklayın.

2. Protokol 1: Larva dpf Gonadal 17 Doku ve 25 teşrih

  1. 17 dpf larvaları uyutmak için tanka kırılmış buz ekleyin. Transferi30 ml soğuk Ringer solüsyonu ile Petri kabı soğutulmuş 100 mm anestezi larva. Tamamen larvaları uyutmak için en az 15 dakika boyunca soğutulmuş Ringer çözeltisinde kuluçkaya balık tutun.
  2. Küçük bir plastik kaşıkla önceden soğutulmuş bir agar plaka larvalarını aktarın. Ringer çözeltisi soğutulmuş 10 mL tüm balık vücut daldırın ve yavaşça yan koyun.
  3. 25X Stereo mikroskop görüş alanının altında aşağıdaki işlemleri yapın. stabilizasyon cımbız ile balık sandığı Kelepçe. cımbız bir çift kalp anusdan uzunlamasına karın Rip. Yavaşça iç organları açığa çıkarmak için vücudun bir tarafında cilt ve kasların kaldırın.
  4. dikkatle yüzmek mesaneye ventral organlarının kütlesini çıkarın. yüzme mesaneye bağlı gonad zarar kaçının.
  5. yüzmek mesane ve ön vücut arasındaki bağlantıyı kesin. Tüm yüzmek mesane ve yavaşça gonadal doku çekin.
    NOT: En durumdas, 17 dpf gonadal doku epitel doku ve protonephridium çevreleyen içerir. Bunlar kolayca birbirinden ayrıldı değildir, ancak 25 ° C'de kolayca ayrılabilir dpf. erbezi ayrıca anüs bağlanır. anüs birbirine bağlı sol ve sağ gonad olan bir bağlantı açıkça görülebilir.
  6. dikkatli bir şekilde yüzme mesaneden gonadal doku ayırmak ve çevresindeki yağ dokuları temizlemek için cımbız kullanarak.
  7. Hemen 200 uL Ringer çözeltisi ihtiva eden önceden soğutulmuş bir 1.5 mL santrifüj tüpüne izole gonadal doku aktarın. Tüm gonadal dokular larva ayrılır kadar buz üzerinde tüp tutun.
  8. 2.7 - adımlarda 2.1 anlatıldığı gibi dpf larvaları 25 gonadlar parçalara ayır.

3. Protokol 2: İzole Gonadal Dokuların Gen İfade analiz

  1. larva gonadal dokulardan toplam RNA ekstrakte edilir.
    1. Yeni RNazsız 1'e izole gonadal dokuları aktarın.5 ml tüp Ringer çözeltisi kaldırıp. 100 uL lizis çözeltisi ilave edin. dokuların kadar Vorteks tamamen parçalanır.
    2. üreticinin talimatlarına göre toplam RNA ekstraksiyon prosedürü uygulayın.
    3. I tampon 10x DNase 1/10 hacmi ve RNA çözeltisine DNase I 1 uL ekleyin ve yavaşça karıştırın. 37 ° C'de 20 dakika süreyle inkübe edilir.
    4. RNA çözeltisine 1/10 hacim DNaz inaktivasyon reaktif ekleyin. 70 ° C'de 10 dakika süreyle inkübe edilir. bir spektrofotometre kullanılarak toplam RNA konsantrasyonu ölçümü. -20 ° C'de saklayın.
  2. Birinci-şerit cDNA sentezi gerçekleştirme
    1. üreticinin protokolünü birinci tür cDNA sentezi gerçekleştirmek için bir oligo (dT) -bağlayıcı primeri kullanarak. 20 uL bir toplam reaksiyon hacmi 1 RNA ug 2 ekle.
    2. 45 ° C'de 90 dakika boyunca reaksiyon çözeltisi inkübe edin. 5 dakika boyunca 70 ° C'de ısıtma ile reaksiyonu bitirin.
    3. cDNA 1 mL RNaz H ekleme yüzdenDevriminin kalıntı RNA'nın çıkması için. ~ 13,000 x g'de 10 saniye boyunca hafifçe ve santrifüj karıştırın. 37 ° C'de 20 dakika süreyle inkübe edilir. 20 ul nükleaz ücretsiz su ekleyin. -70 ° C'de saklayın.
  3. Floresan kantitatif PCR gerçekleştirme
    1. bir floresan boya ile bir döngü sisteminde qPCR gerçekleştirin. 15 s, 30 s için 68 ° C, 15 sn için 95 ° C 'de Tm-5 ° C ile 35 döngü: Aşağıdaki PCR döngü koşulları kullanarak. (: GTCCTGTTGTCTCCTACTGTCG; REV: fwd CATTTGAGTTGAATATGATGCCCTG), cyp19a1a:;: AMH (GCGGAGAGGTGGAAGAGAGAATG fwd: rev GTGGATGGCAGCAGTACGAC) aşağıdaki gibi primer dizileri kullanarak, nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; REV: CCAAGTGAAAACACAACACCAGTGC), vasa (FWD: ATCGCATAGGAAGAACTGGACGCT; REV: CCAAGTGAAAACACAACACCAGTGC) ve β-aktin (FWD: AGTGCGACGTGGACATCCGTA; rEV: GCACTTCCTGTGGACGATGGA) 19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Gonadların Diseksiyonlar AB strain larva zebrabalıkları uygulandı. Şekil 1, 17 dpf ve 25 dpf larva zebrabalıkları tipik gonadal doku gösterir. Birincisi, deri ve karın bir tarafında kaslarının iç organları açığa çıkarmak için kesilir. iç organların kütlesi çıkardıktan sonra, birlikte gonad ile yüzme kesesi gövde kalır. Yumurtalık ( 'Şekil 1 B' de ok) kesesi ventral tarafında bağlanmıştır. 17 dpf'e, gonad iki potansiyel yumurtalık aşamasında idi. Izole gonad sol ve sağ gonad içerir ve (Şekil 1C) şeffaf idi. Bir çok durumda, bu epitel doku ve protonephridium (Şekil 1C'de ok) ile çevrelenmiştir. Gonad dpf 25 'de, genellikle, yağ dokuları (Şekil 1D) ile sarıldı. Bu gelişmenin st Atyaş, büyük ya da küçük gonad gözlenebilir. Olgunlaşmamış yumurtalık ikincil oositlerin gelişme olarak büyük ve folikül hücrelerinin gonad hacmi (Şekil 1 E) artar. Olgunlaşmamış testis, çünkü larva yumurtalık (Şekil 1F) dejenerasyonu ve apoptoz küçüktür.

İzole gonadal dokular moleküler özellikleri analiz için, ilk AMH, cyp19a1a, nanos3 ve vas, qPCR zebrabalıkları dört gonad belirteçleri, gen ekspresyon düzeyleri incelendi. Toplam RNA, RNA izolasyon kiti kullanılarak larva gonadal dokular (n = 35) elde edildi. Ayrıca, baş ve larva dpf 17 kuyruk çıkarıldı ve kontrol grubu (n = 15) olarak RNA çıkarmak için (kalp ve anal gözenek yapısı arasında) gövde dokusu kullanılır. gövde dokusu deri, kas, kemik (omurga ve kaburga), yüzme mesane, böbrek ve gonad dahil. Oligo dT-primed cDNA qPCR için kullanılmıştır. QPCR sonuç yaklaşık 397, 342, 45 ve 170 kat, sırasıyla (Şekil 2) ile 17 dpf izole gonadal dokuda AMH, cyp19a1a, nanos3 ve vaso ekspresyon düzeylerinde büyük bir artış gösterdi.

Şekil 1
Şekil 17, dpf ve 25 dpf Larvaların Zebra balığı tipik Gonadal Dokuların 1. Microphotographs. (A), bir 25X stereo bir mikroskop altında iç organları ortaya çıkarmak için deri ve karın bir yanının kasları Rip. Iç organ kütlesini ayrılmasından sonra (B) kesesi ve gonad gövde bağlı kalır. (B ') yüzme mesane ve gonad göreli konumunu göstermek için panel B'de kırmızı kutunun görünümü amplifikatör. yumurtalık ok ile belirtilmiştir. (C), Iso 17 dpf gonadal doku yonunun. resmin (oklar) siyah doku gonad bağlı endotelyal doku ve protonephridium vardır. (DE) önce ve 25 dpf adipoz doku çıkarılmasından sonra büyük bir gonad. (F), 25 dpf küçük bir gonad. Ölçek çubukları: 200 um. Bu rakamın büyük halini görmek için buraya tıklayın.

şekil 2
Şekil 17 dpf gövdeleri ve izole edilmiş gonadlarda AMH, cyp19ala, nanos3 ve vas 2. Normalize Gen İfadesi Düzeyleri. Hayvanların numaraları kullanılmaktadır: Kontrol grubu, n = 15; yumurtalık grubu, n kontrol grubunda = 35 gövde dokular baş ve kuyruk yapıları olmadan. Gonad grup izole gonadal dokular anlamına gelir./files/ftp_upload/55294/55294fig2large.jpg" target = '_ blank'> bu rakamın büyük halini görmek için lütfen buraya tıklayın.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Zebra balığı güçlü bir model haline gelmiştir ve yoğun gelişme ve hastalıkla ilgili araştırmalarda kullanılır. Örneğin beyin, kalp, gonad ve böbrek gibi yetişkin zebrabalıkları organların izole edilmesi için yöntemler, iyi 23, 24, 25 belgelenmiştir. Nedeniyle küçük boyutu ve larva zebrabalıkları gonadal dokuların dinamik yeniden yapılanmasına bağlı gonadal dokuların izolasyonu zor bir iştir. Larva gonadlar 26 incelemek için EGFP göre hücre sıralaması ve lazer mikrodiseksiyon: Daha önceki çalışmalarda tüm parçalara gövde dokuları ya da transjenik Vasa kullanılır. evcilleşme sırasında kromozom 4 modifikasyonları cinsiyet tayini evcil zebrabalıkları bir sır yapar. Burada anlatılan Bizim yöntem cinsiyet belirleyici mech keşfetmek için yararlı olabilen, ayrıca morfolojik ve moleküler incelemeler için nispeten temiz ve erken gonad hazırlıklarını sağlayabiliranisms.

Erken gelişim aşamalarında diğer yapılardan gelişmekte gonad ayırmak kolay değildir. Bizim yöntem diseksiyonu nasıl gerçekleştirileceği açıklanır. Başarıyla bu protokolü gerçekleştirmek için, bazı kritik adımlar not edilmesi gerekir. İlk olarak, larva zebrabalıkları büyüme koşulu verimi beklenen sonuçların için kritiktir. Larva zebrafish gonadal gelişim son derece dinamik bir süreçtir. Boyut ve gonad dokuların görünümü hayvanların 27 gelişim aşamaları ile tespit edilir. Standartlaştırılmış durumda zebrabalıkları farklı yığınlarını korumak önemlidir. larva büyümesini etkileyebilecek faktörler nüfus yoğunluğu, ışık süresini ve karanlık döngüleri, gıda kullanılabilirliği ve beslenme programları bulunmaktadır. Larva balık standart uzunluk ölçme hayvanların 22 büyüme durumunu belirlemek için bir kılavuz olarak kullanılabilir. Başarılı gonadal doku ISOLAT için ikinci kritik bir faktöriyon ile olan konumu ve gonadlar ve çevre dokular arasında morfolojik farklılıklar iyi anlaşılmasıdır. yumurtalık yüzme mesane ventral tarafına yer aldığı için, ilk kesesi ile birlikte gonadlar izole etmek için uygundur. Buna ek olarak, gonadlar uzak ucu sıkıca bağırsağın uzak ucuna takılır. Yani bir uzak uçlarında gonad gelen bağırsağı çıkarırken dikkatli olmak zorundadır. daha sonra gen ekspresyon analizi için, önceden soğutulmuş ortamı ile agar plaka kullanımı ve hızlı bir şekilde tüm prosedürü gerçekleştirmek için esastır.

Benzer bir yöntem başarılı bir şekilde RF Ketting ve arkadaşları tarafından kullanılmıştır. 28. Onlar piRNAs fonksiyonunu ve 3 haftalık larva içinde Piwi yolu araştırmak için erbezi izolasyon yöntemi uygulandı. Burada, develo moleküler kimlik ve gen ifadesi profilini incelemek gibi erken 17 dpf'e olarak Zebra balığı larvaları gelen gonadal doku dissekeping Zebra balığı erbezi. Daha önce izole gonadal doku gelecek moleküler analizleri zebrabalıkları cinsiyet gelişimi altında yatan mekanizmaların ortaya çıkartılması için transkriptom, methylome ve histon asetilasyonu desenlerini belirlemek için gerçekleştirilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Acknowledgments

Biz balık bakımı için C Zhang teşekkür ederim. Bu çalışma Çin Ulusal Doğa Bilim Vakfı (GP için 31.171.074, 31.371.099 ve 31.571.067) tarafından ve Pujiang Talent Projesi (GP için 09PJ1401900) tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Cell culture dish 100 mm Corning 430167 For embryo incubation
20x EM For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EM Dilute 20x EM in distilled water
AGAROSE G-10 Gene 121985 For preparing the 2% agar plates
Trizol Reagent Invitrogen 15596-026 For RNA isolation
Meter glass Shen Bo 250 ml For preparing the 2% agar plates
Microwave Oven Midea M1-211A For heating the AGAR
Tweezer DUMONT#5INOX World Precision Instrument 500341 For dissection
Stereomicroscope Motic SMZ168 For dissection
Pure water equipment Millipore
Ringer’s solution For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipette Samco 202, 204
Metal bath QiLinbeier Model GL-150
Microscope Leica  M205 FA For photomicrograph
Centrifuge Eppendorf 5417R
Micro Scale RNA Isolation Kit Ambion AM1931 For RNA isolation from gonad tissues
Dnase I Sigma AMPD1-1KT For DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis Kit Thermo Scientific #K1631 For first-strand cDNA synthesis
Rnase H Thermo Scientific #EN0202 For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master Mix TOYOBO QPK-201 This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
Spectrophotometer Ne Drop OD-2000+ Measuring the concentration of the total RNA
Mastercycler Eppendorf AG 22331 Hamburg gene expression profiling

DOWNLOAD MATERIALS LIST

References

  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198, (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13, (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312, (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236, (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324, (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205, (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76, (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579 (2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18, (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142, (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5, (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116, (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271, (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4, (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262, (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97 (2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7, (4), e34397 (2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238, (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124, (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43, (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics