Инъекции липополисахарида в мышей, чтобы имитировать вход микробной производных продуктов после нарушения кишечного барьера

Immunology and Infection
 

ERRATUM NOTICE

Summary

Здесь представлен протокол имитировать вход бактериальных Производные соединений после нарушения кишечный барьер. Низкая доза сублетальных липополисахарида системно вводили мышей, которые наблюдали за 24 ч после инъекции. Выражение провоспалительных цитокинов был определен в нескольких точках времени в селезенке, печени и кишечника.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Кишечного эпителия барьер отделяет хост от микрофлору, которая обычно переносится или игнорируется. Нарушение этого барьера приводит к входу бактерий или бактерии производные продукты в узле, доступ к хост циркуляции и внутренних органов, ведущих к неконтролируемой воспаление как наблюдается в пациентах с воспалительным заболеванием кишечника (IBD), что характеризуется повышенной проницаемости кишечного эпителия.

Чтобы имитировать вход бактериальных Производные соединений в хозяина, эндотоксемия модель была принята в котором липополисахарида (LPS), компонент внешней клеточной стенки грамположительных бактерий, вводили в мышей. В этом исследовании внутрибрюшинно вводили сублетальных доз ПЛАСТИНОК и мышей были впоследствии наблюдение за 8 ч, используя счет болезни. Кроме того выражение, которое уровни воспалительных цитокинов ИЛ 6, Il1b и Tnfa были проанализированы в селезенке, печени и кишечника ПЦР в разных временных точках пост LPS инъекций. Эта модель может быть полезна для исследования, с участием расследования иммунных реакций после вторжения микроорганизмов или бактериальной производные продукты, вызванные нарушением барьер тела поверхностей.

Introduction

Кишечнике человека колонизировали с большой консорциум микроорганизмов, образует микробиоты, который разработал взаимовыгодные отношения с принимающей страны в ходе эволюции. В этой связи принимающей предоставляет безопасную нишу для микробиоты, тогда как микробиоты обеспечивает витаминов, питательных пищеварение и защиты от патогенных микроорганизмов на хост, где микробиоты проживает1. Когда нарушается этот выгодные отношения между принимающей и микрофлору, могут развиваться заболеваний, таких как воспалительные заболевания кишечника (IBD). IBD является многофакторной хроническим воспалительным заболеванием кишечника, вызванных генетических и экологических факторов, которые происходят в двух основных формах, болезнь (CD) крона и язвенного колита (UC). Несмотря на сходство между двумя формами IBD они характеризуются некоторые различия в местонахождение и характер воспалительных изменений. CD является рецидивирующего Трансмуральное воспалительных расстройство, которое потенциально может распространяться на любую часть желудочно-кишечного тракта, в то время как UC является не Трансмуральное и ограничивается толстой кишки. Кроме того мутации в нуклеотидных-олигомеризации домена содержащих белок 2 (NOD2), рецептор признание шаблон (ПРР), которая признает muramyl дипептид (ПРУ), компонент клеточной стенки наиболее грамположительных и - отрицательных бактерий, является связанные с CD2. Кроме того Escherichia coli (E. coli), Listeria и стрептококки и их продукты были найдены внутри макрофагов в CD пациентов, которые вступили узел после того, как барьер нарушение3. Когда бактерии или их продукции введите хост во время разработки CD, иммунная система развивается реакции, ведущие к производству циркулирующих антител анти-бактериальное4. Возможно наиболее убедительные доказательства для роли микрофлору в патогенезе IBD проистекает из моделей мышей. Когда животные лечатся антибиотиками, или когда мыши находятся в стерильных условиях (GF), тяжести заболевания уменьшается в большинстве колит моделей, таких как в Ил-10-/ мышей, которые не развиваются колит в GF зал5,6. Кроме того колит также тревожит состав микрофлору, которая характеризуется несбалансированный состав и снижение богатство, называется дисбактериозом7. Следствием IBD может быть повышенной проницаемости кишечника, которые могут привести к входу микробов и микробных производные продукты в хозяина.

В животных применение декстран сульфат натрия (DSS) индуцирует кишечного эпителия нарушение приводит к повышенной проницаемости эпителиальных барьер8. Портал LPS концентрации повышаются в животных с DSS колит9. Интересно, что животные не хватает C тип Лектин рецептор конкретных внутриклеточных адгезии молекулы-3 захвата nonintegrin связанных с гомолога 1 (знак-R1) защищены от DSS колит и LPS-индуцированной эндотоксемии10. Для дальнейшего распространения в хозяина, бактерии или бактерии производные продукты должны пройти сосудов барьер11, брюшной полости, в которой расположен маленький и большой intestine, брыжеечный лимфатических узлов и/или печени12. Чтобы уменьшить сложность этой системы, был использован определенных бактериальных производные соединения. LPS, которые вызывает эндотоксемии после внутрибрюшинного (и.п.) или внутривенно (и.в.) инъекций13 было впрыснуто в мышей, изучение выражение интерлейкинов Il6 и Ilb и цитокина Tnfa в ответ на ЛПС.

LPS является патоген связанные молекулярные шаблон (PAMP) выраженный компонент клеточной стенки грамположительных бактерий, который состоит из липидов A (главный PAMP в структуре ПЛАСТИНОК), олигосахариды ядро и O боковой цепи14. Толл подобный рецептор 4 (TLR4), выраженные дендритные клетки, макрофаги и эпителиальных клеток признает LPS15, что требует совместного рецепторов для соответствующую привязку. Острая фаза LPS-привязки протеин (LBP) связывает LPS сформировать комплекс, который передает LPS в кластер дифференцировки 14 (CD14), glycosylphosphatidylinositol якорь мембранный белок. CD14 далее челноков LPS лимфоцитов антигеном 96, или также известный как MD-2, который связан с внеклеточного домена TLR4. Связывание LPS в MD-2 облегчает Димеризация TLR4/MD-2 побудить конформационные изменения набора молекул внутриклеточных адаптер для активации течению сигнальный путь14, который включает миелоидного дифференциации первичной ответ гена 88 (MyD88) - зависит от пути и МДП домена содержащих вызывая адаптер интерферона β (TRIF) - зависимых путь16. Признание LPS, TLR4 затем активирует NF-κB путь и Индуцирует экспрессию провоспалительных цитокинов, таких как TNFα, IL-6 и IL-1β17.

В частности когда LPS впрыскивается в животных, концентрация ПЛАСТИНОК для животных, генетический фон животного и диета должна рассматриваться. Высокие концентрации LPS приводит к септический шок, характеризуется гипотензии и несколько орган неудач и наконец до смерти18. Мышей менее чувствительны к ЛПС, по сравнению с людьми, где концентрации LPS между 2-4 нг/кг веса тела (BW) способны вызвать цитокинов шторм19. Для мышей летальной дозы (ЛД50), которая вызывает смерть в половине мышей колеблется от20 10-25 мг/кг массы тела в зависимости от штамма мыши используется. Для часто используемых мыши штаммов, C57Bl/6 и BALB/c, смертельная доза 50% (ЛД50) – 10 мг/кг массы тела. В отличие от штаммов C3H/HeJ и C57BL/10ScCr защищены от ПЛАСТИНОК индуцированной эндотоксемии, который из-за мутации в Tlr421. Следовательно Tlr4-недостаточным мышей, hyporesponsive для инъекций с ПЛАСТИНОК22. Другие генетически модифицированные мыши линии, такие как PARP1/мышей23 устойчивы к LPS-индуцированной токсический шок.

Описанная модель мыши здесь использует сублетальных дозы LPS, ведении системно для имитации последствий распространения ПЛАСТИНОК после нарушения барьер тела поверхностей. Выбранной LPS концентрации (2 мг/кг массы тела) не вызывает смертности в C56Bl/6 мышей, но индуцированных релиз провоспалительных цитокинов.

Protocol

Мышей были разведены и хранятся в определенных условиях возбудителя бесплатно (SPF) в объекте животных Департамента биомедицины, Университет Базеля (Базель, Швейцария). Все мыши эксперименты были проведены в соответствии с швейцарских федеральных и кантональных правил (номер 2816 [кантона Базель-Штадт] животных протокол).

1. Приготовление раствора LPS

  1. Откройте запас LPS, очищенного от кишечной палочки 0111:B4 в стерильных условиях и восстановить его в воде с концентрацией 5 мг/мл.
  2. Разбавьте LPS акций с стерильных фосфатный буфер (PBS) рабочей концентрации 0,2 мкг/мкл.

2. внутрибрюшинного введения ПЛАСТИНОК для мышей

  1. Аспирационная LPS рабочего раствора в 0,5 мл шприц с иглой 30 G в ламинарного воздушного потока.
  2. Весят самок мышей C57Bl/6 (шесть в возрасте 10 недель) и рассчитать количество ПЛАСТИНОК, которые будут вводиться: 10 мкл (2 мкг) / г веса тела.
    Примечание: например, если мышь весит 20 g, а затем 20 g x 10 мкл = 200 мкл LPS рабочих нужд раствор для инъекций.
  3. Обрабатывать мыши, мягко, но твердо и удержать животное в одной руке. Убедитесь, что животное имеет возможность дышать нормально но не поворот и превратить во время сдержанность.
  4. Наклона нос мыши слегка к полу подвергать живота для инъекций. Найдите средней линии живота и место инъекции в низкой части живота влево или вправо от средней линии. Inject PBS и.п. вместо ПЛАСТИНОК в мышах управления.
  5. Свободной рукой, внедрить соответствующий объем (объем, рассчитанные на шаге 2.2) из ПЛАСТИНОК рабочего раствора. Убедитесь, что игла вошла брюшной полости в противном случае, неправильной инъекции в слой мышц живота может произойти. Тем не менее не вдаваться слишком глубоко с иглой в брюшной полости, чтобы избежать, ранив внутренних органов, расположенных в этом районе.
  6. Вернуть животное тщательно клетка с до 5 мышей в клетке.

3. контролировать мышей

  1. Мониторинг животных во время инъекции и каждые 2 ч после инъекции на 8 ч для возникновения и тяжести эндотоксемии. Таким образом используйте судейскую (Таблица 1), который был адаптирован от ранее опубликованные рукописи 24.
  2. Оценка LPS вводили мышам для следующих параметров, перечисленных в таблице 1
    1. Проверка внешнего вида меха, которая обычно гладкая. Если мех трепал, колючие или опухшие мех, который указывает дискомфорт или боль, оценка их как 1, 2 или 3.
    2. Проверка для действия мыши.
      Примечание: Мыши обычно свободно перемещаться по всей клетке еды, питья, восхождение, но подавлены или ограничения деятельности может быть признаком боли.
    3. Проверьте уровень сознания.
      Примечание: Мышь очень любопытны, и они обычно движутся вокруг клетки, исследование окружающих. Отсутствие или снижение движение может предложить боль и дискомфорт.
    4. Проверка глаз.
      Примечание: Полностью открытыми глазами, как ожидается, в здоровых мышей, но полностью или частично закрытые глаза, возможно с секреторной функцией, может быть признаком боли.
    5. Проверка частоты дыхания.
      Примечание: Здоровых мышей обычно имеют нормальное и быстрое дыхание скорость, частота уменьшение дыхания может быть признаком дискомфорта).
    6. Проверка качества дыхания.
      Примечание: Затрудненное дыхание с или без затрудненное дыхание является признаком боли.

4. ткань выборки для извлечения рибонуклеиновой кислоты (РНК) и гомогенизации

  1. Подготовить коллекцию/гомогенизации трубы: добавить 1 мл одноступенчатых РНК изоляции реагента в 2 мл трубы заполнено автоматически с керамическими сферами 1,4 мм.
  2. В соответствующее время точках (до (0 h) и 2 h, 4 h и 8 ч после инъекции LPS) усыпить мыши с обезболивающий передозировки (изофлюрановая) следуют обескровливания и провести вскрытие.
  3. Вырежьте кожу и мышцы слой, подвергая с внутренних органов брюшной полости с ножницами.
  4. Тщательно анализировать селезенки, печени и кишечника, очистить органов от жира и храните их в PBS на льду.
  5. Вырежьте небольшой кусок (около 0,5 см) от каждого органа с помощью ножниц или скальпелем.
    Примечание: Важно всегда взять кусок от примерно такой же частью этого органа в каждой мыши (же лепесток печени, проксимальных или дистальной части толстой кишки).
  6. Вскоре сухой ткани на кусок бумаги ткани и поместите его в коллекции/гомогенизации трубку, убедившись, что он полностью погружен в РНК изоляции реагента.
  7. Однородный ткани в гомогенизатор высокоскоростной benchtop. Для мягких тканей как селезенке, печени и кишечника используют 1 цикл гомогенизации скоростью 6,00 за 30 s.
  8. Проинкубируйте образцы для 5 мин при комнатной температуре.
  9. Осторожно поместите трубку в жидком азоте для прикрепления замораживание ткани lysate. Храните оснастки, заморожены lysate-80 ° c до изоляции РНК.

5. РНК добыча из ткани

Примечание: РНК изоляции реагентов, хлороформе и спиртов считаются опасными материалами. Выполняйте извлечение RNA под химические вытяжки. Использование сертифицированных бесплатно РНКазы реагенты и оборудование для поддержания свободной РНКазы среды.

  1. Разделение фаз
    1. Разморозить замороженные ткани lysate на льду.
    2. Центрифуга для образца на 1000 x g 5 мин при 4 ° C для пеллет оставшиеся частицы ткани, которые могут быть оставлены.
    3. Супернатант передать новой свободной от нуклеиназы 1,5 мл трубки.
    4. Добавить 200 мкл ледяной метилхлороформа за 1 мл РНК изоляции реагента и встряхнуть рукой за 10-15 s.
    5. Проинкубируйте 2-3 мин при комнатной температуре.
    6. Центрифуга 12, 000 x g 15 мин при 4 ° C.
      Примечание: Образец теперь будет содержать 3 фазы: Нижняя красный фенол хлороформ этап, интерфаза, а верхняя бесцветный водный. РНК присутствует в верхней водной фазе.
    7. Соберите верхний водной фазе (50% от общего объема) и передачи в новой свободной от нуклеиназы 1,5 мл трубку.
  2. РНК осадков
    1. Добавить 0,5 мл ледяной изопропиловый спирт на 1 мл РНК изоляции реагента и осторожно перемешать, инвертирование трубки 5 - 6 раз.
    2. Проинкубируйте втечение 10-15 мин при комнатной температуре.
    3. Центрифуга на 12000 g x 10 мин при 4 ° C.
      Примечание: РНК Пелле должны быть видны на данном этапе.
  3. Мойка РНК Пелле
    1. Полностью удалите супернатант, содержащую изопропанол не нарушая гранулы.
    2. Помойте лепешка с ледяной этанол 75% 1 мл на 1 мл РНК изоляции реагент, используемый для первоначального lysis.
    3. Вихрь образца кратко.
    4. Центрифугуйте образцы на 7500 (или 12 000) х g 5 мин при 4 ° C.
  4. Растворяя РНК
    1. Полностью удалите этанола в надосадке не нарушая гранулы.
    2. Оставьте открытой трубки под химические вытяжки для 3-5 мин для воздушно-сухой Пелле РНК при комнатной температуре (не слишком сухой, как в этом случае будет трудно растворить РНК).
    3. Растворяют гранулы РНК в 20-50 мкл нуклеиназы свободной воды, тщательно закупорить вверх и вниз.
    4. Инкубируйте образца при 55 ° C для 10-15 мин для дальнейшего улучшения раствор РНК.
      Примечание: На данном этапе, РНК может храниться при температуре-80 ° C до дальнейшего анализа.

6. пищеварение оставшихся ДНК

  1. Измерить концентрации РНК с спектрофотометр закупорить Алиготе (2 мкл) в спектрофотометра и приспособиться к рекомендуемая концентрация.
  2. Запустите пищеварение загрязнять ДНК с макс. 10 мкг РНК в 50 мкл нуклеиназы свободной воды.
  3. Добавьте 0,1 объема 10 x DNase буфере и 1 мкл rDNase я за образец и смешайте нежно, закупорить вверх и вниз.
  4. Инкубируйте при 37 ° C для 20-30 мин.
  5. Вихревой DNase инактивацию реагент и добавить 0,1 объема выборки, смешивая с пипеткой.
  6. Инкубируйте 5 мин при комнатной температуре, иногда смешивая вручную.
  7. Центрифуга на 10000 x g для 1,5 мин.
  8. Передача супернатанта, содержащие РНК, ДНК бесплатно в новой свободной от нуклеиназы трубку.
  9. Измерение концентрации РНК и качество, спектрофотометр.

7. Обратная транскрипция

  1. Используйте имеющиеся дезоксирибонуклеиновой кислоты cDNA обратная транскрипция (RT) Комплект для обратной транскрипции.
    Примечание: Здесь, до 2 мкг РНК могут быть отменены транскрипции.
  2. Вычислите объем, который содержит 2 мкг РНК. Пипетка 2 мкг РНК в новом ПЦР-пробирку.
  3. Добавьте воды, свободной от нуклеиназы образца в ПЦР-пробирку на окончательный объем 10 мкл.
  4. Готовить 2 x Мастер микс, смешивая следующие компоненты, перечисленные в таблице 2
  5. Добавьте 10 мкл 2 x Мастер микс 10 мкл РНК для получения 1 x Мастер микс в общем объеме 20 мкл.
  6. Закройте полимеразной цепной реакции (ПЦР) трубки и спин вниз образца кратко.
  7. Поместите образцы в Термоциклер ПЦР и задайте параметры, перечисленные в таблице 3.
  8. Сохраните созданный cDNA при-20 ° C для дальнейшего анализа.

8. Количественная ПЦР (ПЦР)

  1. Выполните реакции ПЦР с коммерчески доступных комплект.
  2. Самостоятельного проектирования и тестирования Интрон охватывающих грунтовки, перед использованием, с различной концентрации шаблон cDNA. Анализировать эффективность грунтовка, создавая калибровочной кривой и использовать грунты с высокой эффективности и правильный плавления кривых.
    Примечание: В таблице 2перечислены последовательности грунты, используемых в этом эксперименте.
  3. Подготовьте количественные полимеразной цепной реакции (ПЦР) реакции в пластину 384-ну реакции установки, описанной в таблице 4.
  4. Держите все решения и пластину на льду, с помощью алюминиевой фольги для предотвращения пластину промокания когда реакционную смесь готовится.
  5. Выполните все реакции в triplicates.
  6. Осуществляют реакции PCR на Термоциклер с использованием настроек, указанных в таблице 5.
  7. Вычислить среднее значение Ct для всех реакций от triplicates. Нормализовать все генов-мишеней на уровень экспрессии glycerinealdehyde-3-фосфат дегидрогеназы (Gapdh) уборки гена в расчете 2^(-ΔCt).
    Примечание: Все целевых генов с средняя КТ > 35 были сочтены под предел обнаружения.

Representative Results

Для имитации последствий для принимающей страны после входа бактерий или бактериальной производные продукты, возникающая после нарушения кишечного барьера, LPS вводили мышей C57Bl/6 в сублетальных доз (2 мкг/г веса тела). Каждый мыши контролируется и забил за возникновение эндотоксемии с параметрами, перечисленных в протоколе, которая включает внешний вид мышей, деятельность животных, состояние глаз и частота дыхания и качества (Таблица 1) . Животных наблюдались клинические признаки заболевания, который достиг 6-10 ч после инъекции ПЛАСТИНОК и восстановлены в течение 24 ч (рис. 1). Отдельные мышей были пожертвовать 2 h, 4 h и 8 ч после инъекции ПЛАСТИНОК. Куски ткани были собраны из селезенки, печени и кишечника. РНК был изолирован от этих органов и обратной транскрипции cDNA. CDNA был использован как шаблон для ПЦР для определения уровней выражение Il6 (рисунок 2A) Il1b (рис. 2B), TNFa (рис. 2 c) и Il10 (Рисунок 2D) с праймерами для ПЦР перечисленные в таблице 6. Проявление ИЛ 6 пик 2 ч после инъекции в селезенке и толстой кишки и 4 ч после инъекции в печени. Выражение Il1b, TNFa, и Il10 пика 4 ч после инъекции в селезенке, печени и кишечника. В течение 8 ч после инъекции проявление ИЛ 6, Il1b, TNFa и Il10 вернулся в базовых уровней.

Figure 1
Рисунок 1: LPS инъекции (2 мкг/г веса тела) индуцированной клинических признаков, эндотоксемии в C57Bl/6mice. После инъекции 2 мкг/г веса тела LPS, отдельные мышей были проверены с Оценка болезнь, представлены в таблице 1, которая включает внешний вид и активность животных, открывая их глаза и их частота дыхания и качества каждые 2 ч для 12 h и 24 h кормовой ER LPS инъекций. Оценка по болезни (ось y) были смыты соответствующих времени (ось x). Средний ± SD для 4-5 мышей в каждый момент времени представлена. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: LPS инъекции (2 мкг/г веса тела) Индуцирует экспрессию провоспалительных цитокинов в мышей C57Bl/6. Мышей были введены с 2 мкг/г веса тела ПЛАСТИНОК и уровни выражения Il6 (A), (B) Il1b , Tnfa (C) и (D) Il10 были проанализированы ПЦР в селезенке, печени и кишечника в назначенное время очков после инъекции. Уровни цитокина выражения были нормализованы по выражению Gapdh. Средний ±, проявленную SD для 4-5 мышей в каждый момент времени. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Таблица 1: болезнь Оценка лист для мониторинга мышей C57Bl/6 после инъекции LPS. Параметры, которые контролируются после инъекции ПЛАСТИНОК. Животные были контролироваться каждые 2 ч после инъекции в течение 12 ч, и оценки были даны для каждого отдельного параметра, перечисленных в таблице. Окончательная оценка для каждого животного представляет собой сумму всех индивидуальных очков. Это адаптированный ссылки24. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Сумма Реагент
2 мкл/образец 10 x буфер RT
0,8 мкл/образец 25 x deoxynucleotide (dNTP) микс (100 мм)
1 мкл/образец RT случайных праймеров
4.2 мкл/образец Нуклеаза свободной воды

Таблица 2: Реагенты используются для подготовки мастер смесь для обратной транскрипции.

Температура Время
25 ° C 10 мин
37 ° C 120 мин
37 ° C 5 мин
4 ° C удерживайте

Таблица 3: Термоциклер параметры, используемые для обратной транскрипции.

Сумма Реагент
5 мкл/хорошо 2 x Мастер микс
0,05 мкл/хорошо Ссылка краска
500 Нм финал/хорошо Форвард грунтовка
500 Нм финал/хорошо Обратный грунтовка
между 10 и 100 нг/Ну, мы использовали 40 нг/хорошо шаблон cDNA, разводили буфером для разбавления проб шаблон (1/100 разбавления этого буфера была в свободной от нуклеиназы воды и используется для разбавления cDNA шаблона). Разбавление шаблон в этом буфере позволяет визуализировать скважин, где шаблон добавляется в качестве реакции изменения цвета от синего до зеленого
Нуклеаза свободной воды, чтобы окончательный объем 10 мкл/хорошо Нуклеаза свободной воды

Таблица 4: Описание реакции PCR.

Температура Время
95 ° C 2 мин
95 ° C 5 s 40 циклов
60 ° C 20 s
95 ° C 15 s плавления кривой analaysis
60 ° C 1 мин
95 ° C 15 s

Таблица 5: Термоциклер параметры, используемые для ПЦР.

Грунтовка Последовательность Температура плавления Длина продукта
ИЛ 6 F TCG КЛЯП GCT TAA TTA CAC ГПТ TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
Tnfa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
Tnfa-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Таблица 6: используется в реакции ПЦР праймеры. Последовательность грунтовки используется для ПЦР для выявления цитокины мыши и уборки гена Gapdh.

Discussion

Этот протокол имитирует иммунологических процессов, которые происходят после вторжения микробов производные продукты. Важнейшие шаги в рамках Протокола являются выбор линии мыши, состояние гигиены мышей, доза LPS, мониторинг животных для возникновения эндотоксемии и время прекращения эксперимент. Самое главное генетический фон мыши штамм должен рассматриваться. Различные мыши штаммов имеют разные восприимчивость к ЛПС. К примеру C3H/HeJ и устойчивы к LPS мышей C57BL/10ScCr индуцированных эндотоксемии21,25. Кроме того состояние гигиены животных может повлиять на ход эндотоксемии в ЛПС. Наиболее часто используются специфические возбудитель бесплатно животные (SPF). Эти мыши свободны от определенного перечня патогенных микроорганизмов, но полный микробиоты состав этих животных не известно26,27. Стерильные стерильных или стерильных животных (которые не гавани микробиоты) отличаются от SPF мышей26. Вероятно колонизации стерильных животных с одной микроорганизма или с консорциумом микроорганизмов (gnotobiotic животных) могут влиять на экспрессию генов, как ил-19, после инъекции LPS, по сравнению с животных SPF8. Кроме того было предложено Оценка лист, который был использован как оценка лист для модели сепсиса, индуцированных впрыскивать фекальных решение в брюшной полости24. Этот sheetcan обсудить с Комитетом местных животных и могут быть адаптированы к местным потребностям. В частности критерии для прекращения необходимо обсудить с Комитетом местных животных. Этот эксперимент должен был быть остановлены, когда достигается Оценка > 12 или по достижении максимального показателя для одного отдельного параметра. В этом эксперименте ни одно животное из восьми животных превысило болезни баллов из 12 после инъекции ПЛАСТИНОК (2 мкг/г веса тела). В этом исследовании представлены результаты показаны выражение цитокинов ИЛ 6, Il1b, TNFa и Il10 в печени, селезенки и кишечника после инъекции ПЛАСТИНОК. Выражение Il1b, TNFa и Il10 пика 4 ч после инъекции LPS в селезенке, печени и кишечника, тогда как, Il6 выражение пика 2 ч после инъекции LPS в селезенке и толстой кишки и 4 ч после инъекции LPS в печени. В течение 8 ч выражение Il6 Il1b, TNFa и Il10 вернулся в базовые уровни в селезенке, печени и кишечника. Тяжести заболевания пика между 6 ч. и 10 ч после инъекции LPS, когда проявление ИЛ 6, Il1b, TNFa и Il10 вернулись уже в базовых уровнях указанием что увеличение проявление ИЛ 6, Il1b, TNFa и Il10 происходит быстро после инъекции ПЛАСТИНОК, но что кинетика других генов может показать другой шаблон после инъекции ПЛАСТИНОК. Выражение этих цитокинов также могут быть проанализированы на уровень белка в крови животных, ELISA, что можно рассматривать как дополнение к ПЦР.

Модификации и устранение неполадок техники необходимы в тех случаях, когда достигается болезни Оценка > 12. Таким образом доза LPS должна быть уменьшена и лучше приспособлены к линии используется мышь и местных условий, чтобы избежать преждевременного завершения эксперимента. Манипулирования генов путем удаления данного региона геномной или экспрессирующих ген может повлиять подверженность мышей, ПЛАСТИНОК. В предварительных экспериментов доза LPS может титруют в соответствующей дозы, чтобы избежать ненужного вреда и смерть животных в этом эксперименте. Следует отметить загрязнение ПЛАСТИНОК с других бактериальная производные продукты и неправильной инъекции нужно избегать. Кроме того кинетика экспрессии генов интерес после LPS инъекции необходимо определить.

Ограничения, что эта техника предоставляет информацию о последствиях распространения микробных продуктов в узле после нарушения кишечного барьера, но не даст информацию о событиях, которые приводят нарушения кишечного барьера и причины Этот триггер IBD. Конечно эта модель не является моделью колит как модель колита DSS, но это может быть полезно помимо колит моделей для изучения следствием входа микробных продуктов в хозяина. Кроме того и.п. инъекции LPS нарушит брюшной полости, в которых расположены малые и толстой кишке. Это может облегчить транслокации кишечных производные бактериальных продуктов из брюшной полости в хозяина.

Значимость этой модели является тот факт, что он использует определенные PAMP. В других моделях, включая и.п. инъекции всего бактерий, и.п. инъекции фекальных решения24 или септик перитонит модели, в которых перитонит индуцируется сенситизации перевязки и прокол28, широкий спектр микробов или их продукты вызывает болезнь. Кроме того инъекции LPS в мышей неосложненной подход и не требуют хирургии как септик перитонит, вызванных сенситизации перевязки и проколов.

Дальнейшее применение этой модели являются исследования, которые призваны расследовать эндотоксемии или LPS индуцированной сепсис в любых контекстах характеризуется транслокации бактерий производные продукты в узле, например нарушение барьер кожи или нарушенного из урогенитального тракта. В заключение это простая модель, которая может использоваться в каждом лабораторных условиях. В зависимости от местных условий могут быть адаптации к местным потребностям необходимые. В частности оценка лист должен обсуждаться с местными властями, прежде чем эксперимент выполняется. Этот подход был использован для имитации последствий для принимающей страны, когда бактерии или бактериальной производные продукты введите хост после того, как произошло нарушение барьер. Это может быть, в частности, соответствующих исследований, изучения основу IBD, где возникновение нарушения кишечного барьера является общепринятая в патологии болезни.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

JHN поддерживается Швейцарским национальным фондом (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics