Injecties van Lipopolysaccharide in muizen om na te bootsen ingang van microbiële afkomstige producten na de schending van de intestinale barrière

Immunology and Infection
 

ERRATUM NOTICE

Summary

Hier wordt een protocol om na te bootsen de ingang van bacteriële afkomstige verbindingen na de schending van de intestinale barrière gepresenteerd. Een lage dosis subletale lipopolysaccharide werd systemisch geïnjecteerd in muizen, die werden gecontroleerd voor 24u na injectie. De expressie van pro-ontsteking cytokinen werd vastgesteld op verschillende tijdstippen in de milt, lever en dikke darm.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De intestinale epitheliale barrière scheidt de host van de microbiota die normaal wordt getolereerd of genegeerd. De schending van deze barrière leidt tot de ingang van bacteriën of bacteriën afkomstige producten naar de host, toegang tot de host verkeer en binnenorganen leiden tot de ongecontroleerde ontsteking zoals waargenomen bij patiënten met een inflammatoire darmziekte (IBD), die worden gekenmerkt door een toegenomen permeabiliteit voor intestinale epitheliale.

Om na te bootsen de ingang van bacteriële afkomstige verbindingen in de gastheer, een endotoxemia model heeft vastgesteld in welke lipopolysaccharide (LPS), een onderdeel van de buitenste celwand van gram-negatieve bacteriën, waren geïnjecteerd in muizen. In deze studie een subletale dosis van LPS intraperitoneally werd geïnjecteerd en de muizen werden vervolgens gecontroleerd voor 8 h met gebruikmaking van een ziekte-score. Bovendien, de niveaus van de ontsteking cytokinen, Il6, Il1b, en Tnfa werden geanalyseerd in de milt, de lever en de dikke darm door de qPCR op verschillende tijdstippen expressie post LPS injectie. Dit model kan nuttig zijn voor de studies waarbij onderzoek van immuunresponsen na de invasie van micro-organismen of bacteriële afkomstige producten veroorzaakt door een breuk van de barrière van oppervlakken van het lichaam.

Introduction

De menselijke darm is gekoloniseerd met een groot consortium van micro-organismen die vormt de microbiota, die een wederzijds voordelige relatie met de host tijdens de evolutie heeft ontwikkeld. In deze relatie voorziet de host een veilige niche de microbiota, overwegende dat de microbiota levert vitaminen, nutriënten spijsvertering en bescherming tegen ziektekiemen naar de host, waar de microbiota1 verblijft. Wanneer deze heilzame relatie tussen de host en de microbiota wordt verstoord, kunnen ziekten ontwikkelen, zoals inflammatory bowel disease (IBD). IBD is een multifactoriële chronische ontstekingsziekte van de darm veroorzaakt door genetische en ecologische factoren die in twee belangrijke vormen, ziekte van Crohn (CD) en colitis ulcerosa (UC optreden). Ondanks de gelijkenissen tussen de twee vormen van IBD, worden ze gekenmerkt door bepaalde verschillen in de locatie en de aard van de wijzigingen van de inflammatoire. CD is een recidiverende Transmurale inflammatoire aandoening die potentieel uit te tot elk deel van het maagdarmkanaal, breiden kan terwijl UC niet-Transmurale is en is beperkt tot de dikke darm. Bovendien, mutaties in Nucleotide-bindende oligomerisatie domein-bevattende eiwitten 2 (NOD2), een patroon erkenning receptor (PRR) die muramyl dipeptide (MDP), een onderdeel van de celwand van gram-positieve en meest - negatieve bacteriën herkent, is CD2is gekoppeld. Bovendien, Escherichia coli (E. coli), Listeria , streptokokken en hun producten alle bleken binnen macrofagen in CD-patiënten die de gastheer hebt ingevoerd nadat een barrière inbreuk op3. Wanneer bacteriën of naar hun producten de host tijdens de ontwikkeling van CD invoert, ontwikkelt het immuunsysteem een reactie die leidt tot de productie van circulerende antilichamen anti-bacteriële4. Misschien de meest overtuigende bewijs voor de rol van de microbiota in de pathogenese van IBD vloeit voort uit Muismodellen. Wanneer dieren worden behandeld met antibiotica, of wanneer de muizen zijn bewaard in kiem-gratis (GF) omstandigheden, is de ernst van de ziekte verlaagd in de meeste colitis modellen, zoals in de IL-10-/-muizen die geen colitis in GF voorzieningen5,6 ontwikkelen. Colitis verstoort bovendien ook de samenstelling van de microbiota, die wordt gekenmerkt door een onevenwichtige samenstelling en verminderd rijkdom genaamd dysbiosis7. Het gevolg van IBD kunnen een verhoogde intestinale permeabiliteit die tot de ingang van microben en microbiële afkomstige producten in de gastheer leiden kan.

In dieren induceert de toepassing van Dextran natriumsulfaat (DSS) een intestinale epitheliale inbreuk leidt tot een verhoogde doorlaatbaarheid van de epitheliale barrière-8. Portal LPS concentraties zijn verheven in dieren met DSS colitis9. Interessant is dat zijn dieren ontbreekt de C type lectine receptor specifieke intracellulaire adhesie molecuul-3 grijpen nonintegrin homolog-gerelateerde 1 (teken-R1) beschermd tegen DSS colitis en LPS-geïnduceerde endotoxemia10. Ter verdere verspreiding van de in de gastheer, moeten bacteriën of bacteriën afgeleide producten passeren de vasculaire barrière11, de peritoneale Holte, waarin de kleine en grote darm bevindt, de mesenterische lymfeklieren en/of de lever12. Verklein de complexiteit van dit systeem en werd een gedefinieerde bacteriële afkomstige omheind gebruikt. LPS, waardoor endotoxemia na intraperitoneale (i.p.) of intraveneuze (IV) injectie13 werd geïnjecteerd in muizen, de uitdrukking van de interleukins Il6 en Ilb en het cytokine Tnfa in reactie op LP's te bestuderen.

LPS is een pathogeen-geassocieerde moleculaire patroon (PAMP) uitgedrukt als een celwand onderdeel van gram-negatieve bacteriën, die uit een lipide-A bestaat (de belangrijkste PAMP in de structuur van LPS), een kern-oligosaccharide en een O kant keten14. Toll-like receptor 4 (TLR4) uitgedrukt door dendritische cellen, macrofagen en epitheliale cellen herkent LPS15, waarvoor co receptoren voor de juiste binding. De acute fase eiwit LPS-bindend-proteïne (LBP) bindt LPS vormen een complex dat de overdracht van LPS aan het cluster van differentiatie 14 (CD14), een glycosylphosphatidylinositol-verankerd membraan eiwit. CD14 verder shuttles LPS lymfocyt antigeen 96 of ook wel bekend als MD-2, die is gekoppeld aan de extracellulaire domein van TLR4. De binding van LPS naar MD-2 vergemakkelijkt de dimerisatie van TLR4/MD-2 voor het opwekken van conformationele wijzigingen in het werven van intracellulaire adapter moleculen om te activeren van de stroomafwaartse signalering traject14, waarin de primaire myeloïde differentiatie reactie gene 88 (MyD88) - afhankelijke traject en de TIR domein-bevattende adapter-inducerende interferon-β (TRIF) - afhankelijke traject16. De erkenning van LPS door TLR4 vervolgens activeert de NF-recombination pathway en induceert de uitdrukking van proinflammatoire cytokines, als TNFα, IL-6, IL-1β17.

In het bijzonder wanneer LPS wordt geïnjecteerd in de dieren, de concentratie van LPS gegeven om de dieren, moet de genetische achtergrond van het dier en het dieet worden beschouwd. Hoge concentraties van LPS leidt tot een septische shock, gekenmerkt door hypotensie en meerdere orgel stroomstoringen, en ten slotte aan dood18. Muizen zijn minder gevoelig voor LPS ten opzichte van mensen, waar LPS concentraties van 2-4 ng/kg lichaamsgewicht (BW) kunnen voor het opwekken van een cytokine storm19. Voor muizen, de letale dosis (LD50), die dood in de helft van de muizen varieert van 10-25 mg/kg BW20 afhankelijk van de gebruikte muis stam induceert. Voor de meest gebruikte muis stammen, C57Bl/6 en BALB/c, is de 50% van letale dosis (LD50) 10 mg/kg BW. In tegenstelling, worden de stammen C3H/HeJ en C57BL/10ScCr beschermd tegen LPS geïnduceerde endotoxemia, dat te wijten aan mutaties in Tlr421 is. Bijgevolg zijn Tlr4-deficiënte muizen hyporesponsive aan injecties met LPS22. Andere genetisch gemodificeerde muis lijnen, zoals PARP1-/-muizen23 resistent zijn tegen LPS-geïnduceerde toxische shock.

Het muismodel beschreven gebruikt hier een subletale dosis van LPS systemisch toegediend om na te bootsen de gevolgen van de verspreiding van de LPS na een schending van de barrière van het lichaam van de oppervlakken. De gekozen LPS concentratie (2 mg/kg BW) heeft geen veroorzaken sterfte in C56Bl/6 muizen, maar de geïnduceerde release van pro-inflammatoire cytokines.

Protocol

Muizen werden gefokt en gehouden onder specifieke pathogenen vrije (SPF) omstandigheden in het dier faciliteit van het departement van medische biologie, Universiteit van Basel (Basel, Zwitserland). Alle muis experimenten werden uitgevoerd overeenkomstig de Zwitserse federale en kantonnale regelgeving (dierlijke protocolnummer 2816 [Canton Basel-Stadt]).

1. bereiding van LPS-oplossing

  1. Open de voorraad van LPS gezuiverd van Escherichia coli 0111:B4 onder steriele omstandigheden en reconstrueren het in water bij de concentratie van 5 mg/mL.
  2. Verdun de LPS-materieel met de steriele fosfaatgebufferde zoutoplossing (PBS) de concentratie van de werken van 0,2 µg/µL.

2. intraperitoneale injectie van LPS met muizen

  1. De LPS werkoplossing in een 0,5 mL injectiespuit met een naald 30 G in een laminaire luchtstroming gecombineerd.
  2. Vrouwelijke C57Bl/6 muizen (zes tot 10 weken oud) wegen en berekent het bedrag van LPS die zal worden geïnjecteerd: 10 µL (2 µg) /g lichaamsgewicht.
    Opmerking: bijvoorbeeld, als een muis 20 g, dan 20 g x 10 µL weegt = 200 µL LPS werkt oplossing moeten worden geïnjecteerd.
  3. Omgaan met de muis voorzichtig maar vastberaden en beperken van het dier in de ene hand. Ervoor zorgen dat het dier in staat te ademen normaal, maar niet te verdraaien en zet tijdens de terughoudendheid is.
  4. Kantelen van de neus van de muis iets naar de vloer om de buik voor injectie bloot te stellen. Zoek de middellijn van de buik en de plaats van de injectie in de lage buik links of rechts van de middellijn. Injecteren i.p. PBS in plaats van LPS in controle muizen.
  5. Met de vrije hand, spuit het juiste volume (het volume dat is berekend in stap 2.2) van de LPS-werkoplossing. Zorg ervoor dat de naald heeft ingevoerd de peritoneale Holte, anders mis injecties in de laag van de buikspier kunnen optreden. Toch gaan niet te diep met de naald in de peritoneale holte te voorkomen verwonden binnenorganen gelegen in dat gebied.
  6. Terug het dier zorgvuldig naar de kooi met maximaal 5 muizen per kooi.

3. het controleren van de muizen

  1. Het controleren van de dieren ten tijde van de injectie en elke 2 h na de injectie voor 8 h voor het optreden en de ernst van de endotoxemia. Gebruik daarom een scoreblad (tabel 1) die aangepast van een eerder gepubliceerde manuscript 24 is.
  2. Score van de LPS ingespoten muizen voor de volgende parameters vermeld in tabel 1
    1. Controleer of het uiterlijk van de vacht die normaal glad is. Als de vacht gegolfde, stekelige of gezwollen bont waarin ongemak en/of pijn verschijnt, scoren ze 1, 2 of 3.
    2. Controleer of de activiteit van de muis.
      Opmerking: Muizen normaal zich vrij bewegen rond de hele kooi eten, drinken, klimmen, maar onderdrukt of beperkte activiteit zou een teken van pijn.
    3. Controleer het niveau van bewustzijn.
      Opmerking: Muizen zijn erg nieuwsgierig en ze normaal bewegen van de kooi onderzoekt de omgeving. Gebrek aan of verminderde beweging kan suggereren pijn en ongemak.
    4. Controleer de ogen.
      Opmerking: Volledig open ogen worden verwacht in gezonde muizen kunnen, maar gedeeltelijk of volledig gesloten ogen, eventueel met secretie, een indicatie van de pijn.
    5. Controleer de ademhalingsfrequentie.
      Opmerking: Gezonde muizen hebben meestal een normale en snelle ademhalingsfrequentie, een verminderde ademhalingsfrequentie zou een indicatie van ongemak).
    6. Controleer de kwaliteit van de ademhaling.
      Opmerking: Moeizame ademhaling met of zonder hijgen is een teken van pijn.

4. de weefsels bemonstering voor de extractie van RNA Acid (RNA) en homogenisering

  1. De collectie/homogenisering buizen bereiden: Voeg 1 mL-voor-stapmodus RNA isolatie reagens 2 mL buizen gevuld met 1.4 mm keramische sferen.
  2. Op de juiste tijdstippen (vóór (0 h) en 2 h, 4 h en 8 h na injectie van LPS) euthanaseren van de muis met verdoving overdosis (Isofluraan) gevolgd door exsanguination en ga verder met de dissectie.
  3. Snij de huid en de spier laag bloot van de buikholte met de innerlijke organen met een schaar.
  4. Zorgvuldig ontleden de milt, de lever en de dikke darm, schoon van de organen van vet en houd ze in PBS op ijs.
  5. Knip een klein stukje (ongeveer 0.5 cm lang) van elk orgaan met behulp van schaar of scalpel.
    Opmerking: Het is belangrijk om altijd het stuk van ongeveer hetzelfde deel van het orgel in elke muis (dezelfde kwab van de lever, proximale en distale deel van de dikke darm).
  6. Binnenkort het weefsel op een stukje papier weefsel droog en plaats deze in de collectie/homogenisering buis om ervoor te zorgen dat het volledig is ondergedompeld in RNA isolatie reagens.
  7. Meng het weefsel in een high-speed benchtop-homogenizer. Voor zachte weefsels zoals milt, lever en dubbele punt 1 cyclus van homogenisering tempo 6,00 voor 30 gebruiken s.
  8. Incubeer de monsters gedurende 5 minuten bij kamertemperatuur.
  9. Plaats de buis in de vloeibare stikstof om snap bevriezen het weefsel zorgvuldig lysate. Sla de module bevroren lysate bij-80 ° C tot de RNA-isolatie.

5. RNA extractie van weefsel

Opmerking: RNA isolatie reagentia, chloroform en alcoholen worden beschouwd als gevaarlijke stof. Uitvoeren van RNA extractie onder een chemische motorkap. Gebruik gecertificeerde RNase-vrije reagentia en apparatuur om een RNase-vrije omgeving.

  1. Fase-separatie zichtbaar
    1. Ontdooi het bevroren weefsel lysate op ijs.
    2. Centrifugeer het monster op 1.000 x g gedurende 5 minuten bij 4 ° C tot pellet de resterende deeltjes van weefsel dat zou kunnen worden overgelaten.
    3. Het supernatant overbrengen in een nieuwe nuclease-vrije 1,5 mL-buis.
    4. Voeg 200 µL ijskoude chloroform per 1 mL RNA isolatie reagens en schud krachtig met de hand voor 10-15 s.
    5. Incubeer gedurende 2-3 minuten bij kamertemperatuur.
    6. Centrifuge op 12, 000 x g gedurende 15 minuten staan bij 4 ° C.
      Opmerking: Het monster zal bevatten nu 3 fasen: lagere rode fenol-chloroformfase, de interfase en de bovenste kleurloze waterfase. RNA is aanwezig in de bovenste waterfase.
    7. De bovenste waterfase (50% van het totale volume) en de overdracht in een nieuwe nuclease-vrije 1,5 mL-buis verzamelen.
  2. RNA neerslag
    1. Voeg de ijskoude isopropanol 0,5 mL per 1 mL RNA isolatie reagens en meng voorzichtig door het omkeren van de buis 5 - 6 keer.
    2. Incubeer gedurende 10-15 minuten bij kamertemperatuur.
    3. Centrifugeer bij 12.000 x g gedurende 10 minuten bij 4 ° C.
      Opmerking: RNA pellet zichtbaar moet zijn in dit stadium.
  3. Wassen van RNA pellet
    1. Volledig verwijderen het supernatant met het isopropanol zonder de pellet te verstoren.
    2. Wassen van de pellet met 1 mL ijskoud 75% ethanol per 1 mL RNA isolatie reagens gebruikt voor de initiële lysis.
    3. Vortex het monster kort.
    4. Centrifugeer het monster bij 7.500 (of 12.000) x g gedurende 5 min bij 4 ° C.
  4. Ontbinding van RNA
    1. Volledig verwijderen de ethanol in de bovendrijvende vloeistof zonder de pellet te verstoren.
    2. Laat de geopende buis onder de chemische motorkap gedurende 3-5 minuten tot de RNA-pellet bij kamertemperatuur drogen (doen niet veel te droog als in dat geval het moeilijk zijn zal om los van RNA).
    3. Los de RNA-pellet in 20-50 µL nuclease-gratis water door pipetteren zorgvuldig op en neer.
    4. Incubeer het monster bij 55 ° C gedurende 10-15 min om de oplossing van het RNA verder te verbeteren.
      Opmerking: In dit stadium, RNA kan worden opgeslagen bij-80 ° C tot verdere analyse.

6. de spijsvertering van DNA van de resterende

  1. De concentratie van RNA meten met een spectrofotometer waarbij een aliquoot gedeelte (2 µl) in de spectrofotometer eveneens en pas bij de aanbevolen concentratie.
  2. Start de spijsvertering van DNA te besmetten met max. 10 µg RNA in 50 µL van de nuclease-vrij van het water.
  3. Voeg 0,1 volume van 10 x DNase ik Buffer en 1 µL rDNase ik per monster en meng zachtjes door pipetteren op en neer.
  4. Incubeer bij 37 ° C gedurende 20-30 min.
  5. Vortex DNase inactivatie reagens en 0,1 volume toe te voegen aan het monster mengen goed met de pipet.
  6. Incubeer gedurende 5 minuten bij kamertemperatuur af en toe te mengen met de hand.
  7. Centrifugeer bij 10.000 x g gedurende 1,5 min.
  8. Overdracht van de bovendrijvende substantie met RNA DNA-gratis in de nieuwe nuclease-gratis buis.
  9. De concentratie van RNA en de kwaliteit door spectrofotometer meten.

7. omgekeerde transcriptie

  1. Gebruik een verkrijgbare Deoxyribonucleic acid cDNA omgekeerde transcriptie (RT) kit voor omgekeerde transcriptie.
    Opmerking: Hier, tot 2 µg RNA kan worden omgekeerd getranscribeerde.
  2. Berekenen van het volume, waarin 2 µg RNA. Pipetteer 2 µg RNA in een nieuwe PCR-buis.
  3. Voeg nuclease-gratis water aan het monster in de buis van de PCR aan het uiteindelijke volume van 10 µL.
  4. Bereiden van 2 x Master Mix door het mengen van de volgende onderdelen vermeld in tabel 2
  5. 10 µL 2 x Master Mix aan 10 µl RNA verkrijgen van 1 x Master Mix in het totale volume van 20 µL toevoegen.
  6. Sluit de polymerase-kettingreactie (PCR) buis en spin down de steekproef kort.
  7. Leg de monsters in een PCR Thermocycler en de instellingen die zijn vermeld in tabel 3.
  8. De gegenereerde cDNA bij-20 ° C voor verdere analyse worden opgeslagen.

8. kwantitatieve PCR (qPCR)

  1. De reactie van qPCR met een commercieel beschikbare kit uitvoeren
  2. Zelf ontwerpen en testen van de intron-spanning primers, vóór gebruik, met verschillende concentraties van sjabloon cDNA. De werkzaamheid van de primer analyseren door het creëren van een standaard curve en het gebruik van de inleidingen met hoge doeltreffendheid en correcte smeltende curven.
    Opmerking: De reeksen inleidingen gebruikt in dit experiment zijn vermeld in tabel 2.
  3. Bereiden de kwantitatieve polymerase kettingreactie (qPCR) reactie in de 384-well plaat met de setup van de reactie beschreven in tabel 4.
  4. Houd alle oplossingen en de plaat op ijs met aluminiumfolie om te voorkomen dat de plaat NAT wanneer het reactiemengsel wordt voorbereid.
  5. Alle reacties in triplicates uitvoeren.
  6. Verrichten van de PCR-reactie op een thermocycler met behulp van de instelling die is vermeld in tabel 5.
  7. Berekening van de gemiddelde waarde van de Ct voor alle reacties van de triplicates. Normaliseren alle doelgenen tot het niveau van de expressie van glycerinealdehyde-3-fosfaat-dehydrogenase (Gapdh) huishouding gen door het berekenen van de 2^(-ΔCt).
    Opmerking: Alle de doelgenen met de gemiddelde Ct > 35 werden beschouwd als onder de detectiegrens.

Representative Results

Om na te bootsen de gevolgen voor de host na de ingang van bacteriën of bacteriële-afgeleide producten die na de intestinale barrière schending plaatsvindt, LPS werd geïnjecteerd in de C57Bl/6 muizen in een subletale dosis (2 µg/g lichaamsgewicht). Elke enkele muis werd gecontroleerd en scoorde voor het voorkomen van endotoxemia met parameters die worden vermeld in de scorekaart die omvat, het uiterlijk van de muizen, de activiteit van de dieren, de conditie van de ogen, en de ademhalingsfrequentie en kwaliteit (tabel 1) . De dieren klinische symptomen van ziekte die piek van 6 tot 10 h na de injectie van LPS en hersteld binnen de 24u (Figuur 1) vertoonde. Individuele muizen werden opgeofferd 2 h, 4 h en 8 h na de injectie van LPS. Weefsel stukken werden verzameld uit de milt, lever en dikke darm. RNA werd geïsoleerd van deze organen en omgekeerde herschreven als cDNA. CDNA werd gebruikt als een sjabloon voor qPCR om te bepalen van de niveaus van de expressie van het Il6 (figuur 2A) TNFa (figuur 2C), Il1b (figuur 2B) en Il10 (figuur 2D) met inleidingen gebruikt voor de qPCR vermeld in tabel 6. De expressie van Il6 piek 2 h na injectie in de milt en dikke darm, en 4 h na injectie in de lever. De expressie van Il1b, TNFa, en Il10 bereikte een hoogtepunt van de 4 uur na injectie in de milt, lever en dikke darm. Binnen 8 uur na de injectie, de uitdrukking van Il6, Il10 , Il1ben TNFa, keerde terug naar de niveaus van de basislijn.

Figure 1
Figuur 1: LPS injectie (2 µg/g lichaamsgewicht) geïnduceerde klinische symptomen van endotoxemia in C57Bl/6mice. Na injectie van 2 µg/g lichaamsgewicht van LPS, individuele muizen werden gecontroleerd met de score van de ziekte opgenomen in tabel 1, waarin het uiterlijk en de activiteit van de dieren, opening van hun ogen en hun ademhaling rate en de kwaliteit van elke 2 h voor 12u en 24 h aft Translator LPS injectie. De score van de ziekte (y-as) de respectieve tijd (x-as) werd uitgewist. Bedoel ± SD voor 4-5 muizen per elk punt van de tijd wordt gepresenteerd. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: LPS injectie (2 µg/g lichaamsgewicht) induceert de expressie van pro-ontsteking cytokinen in C57Bl/6 muizen. Muizen werden ingespoten met 2 µg/g lichaamsgewicht van LPS en de niveaus van de expressie van Il6 (A), Il1b (B), Tnfa (C) en Il10 (D) werden geanalyseerd door qPCR in de milt, lever, en colon op de aangegeven tijd punten na injectie. Cytokine-expressie niveaus werden alle genormaliseerd tot de uitdrukking van Gapdh. Bedoel ± SD voor 4-5 muizen per elk punt van de tijd wordt weergegeven. Klik hier voor een grotere versie van dit cijfer.

Tabel 1: ziekte scorekaart controleren C57Bl/6 muizen na injectie van LPS. Parameters die worden gecontroleerd na LPS injectie. Dieren werden gecontroleerd elke 2 h na injectie voor een periode van 12 h en scores kregen voor elke afzonderlijke parameter in de tabel weergegeven. De uiteindelijke score voor elk dier vertegenwoordigt de som van alle individuele scores. Dit is aangepast van referentie24. Klik hier om dit bestand te downloaden.

Bedrag Reagens
2 µL/monster 10 x RT Buffer
0.8 µL/monster 25 x deoxynucleotide (dNTP) Mix (100 mM)
1 µL/monster RT willekeurige Primers
4.2 µL/monster Nuclease-gratis water

Tabel 2: Reagentia gebruikt ter voorbereiding van de master mix van omgekeerde transcriptie.

Temperatuur Tijd
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Houd

Tabel 3: Thermocycler instellingen gebruikt voor reverse transcriptie.

Bedrag Reagens
5 µL per putje 2 x Master Mix
0,05 µL per putje Referentie kleurstof
500 nM finale per putje voorwaartse primer
500 nM finale per putje omgekeerde primer
tussen 10 en 100 ng/putje, gebruikten we 40 ng/putje sjabloon cDNA verdund in een Buffer sjabloon verdunning (1/100 verdunning van deze buffer werd gemaakt in nuclease-gratis water en gebruikt voor het verdunnen van de sjabloon cDNA). Verdunning van de sjabloon in deze Buffer kan de visualisatie van de putten waar sjabloon wordt toegevoegd als de reactie verandert de kleur van blauw naar groen
Nuclease-gratis water tot een eindvolume van 10 µL per putje Nuclease-gratis water

Tabel 4: Beschrijving van de PCR-reactie.

Temperatuur Tijd
95 ° C 2 min
95 ° C 5 s 40 cycli
60 ° C 20 s
95 ° C 15 s smeltende kromme analaysis
60 ° C 1 min
95 ° C 15 s

Tabel 5: Thermocycler instellingen gebruikt voor PCR.

Primer Volgorde Smelttemperatuur Product lengte
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
TNFA-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
TNFA-R AGGGTCTGGGCCATAGAACT 60
Gapdh-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
Gapdh-R CCTGTTGCTGTAGCCGTATT 58

Tabel 6: inleidingen gebruikt in de reactie qPCR. De volgorde van de inleidingen voor qPCR gebruikt voor het opsporen van muis cytokines en huishouding gene Gapdh.

Discussion

Dit protocol bootst immunologische processen die zich na de invasie door microbiële afkomstige producten voordoen. Kritische stappen in het protocol zijn de keuze van de lijn van de muis, de status van de hygiëne van de muizen, de dosis van LPS, de controle van de dieren ten behoeve van het voorkomen van endotoxemia, en het tijdstip van beëindiging van het experiment. Belangrijker nog, moet de genetische achtergrond van de muis stam worden beschouwd. Verschillende muis stammen hebben verschillende gevoeligheid voor LP's. Bijvoorbeeld geïnduceerde de C3H/HeJ en C57BL/10ScCr muizen resistent zijn tegen LPS endotoxemia21,25. Bovendien, de status van de hygiëne van de dieren invloed kan hebben op het verloop van de endotoxemia in LP's. Specifieke-pathogenen vrije (SPF) dieren worden meestal gebruikt. Deze muizen zijn vrij van een gedefinieerde lijst van ziekteverwekkers, maar de volledige microbiota samenstelling van deze dieren is niet bekend26,27. Steriele of het een kiem-vrije dieren (die doen niet haven een microbiota) zijn verschillend van SPF muizen26. Waarschijnlijk, de kolonisatie van een dieren met één micro-organisme of een consortium van micro-organismen (gnotobiotic dieren) invloed kan hebben op de expressie van genen, zoals IL-19, na injectie van LPS in vergelijking met SPF dieren8. Bovendien, een scorekaart heeft gesuggereerd dat werd gebruikt als een scorekaart voor een sepsis model geïnduceerd door het injecteren van de fecale oplossing in de peritoneale holte24. Deze sheetcan worden besproken met het Comité van de lokale dierenwelzijn en kunnen worden aangepast aan de lokale behoeften. In het bijzonder de criteria voor beëindiging moeten worden besproken met het Comité van de lokale dierenwelzijn. Dit experiment moest worden gestopt bij een score > 12 wordt bereikt of wanneer de maximale score voor een afzonderlijke parameter is bereikt. In dit experiment overschreden geen enkel dier uit acht dieren de score van een ziekte van 12 na injectie van LPS (2 µg/g lichaamsgewicht). In deze studie worden resultaten tonen van de expressie van de cytokinen, Il6, Il1b, TNFa en Il10 in de lever, milt en dubbele punt na injectie van LPS gepresenteerd. De expressie van Il1b, TNFa en Il10 piek 4 h na LPS injectie in de milt, lever, dikke darm, en overwegende dat Il6 expressie piek 2 h na LPS injectie in de milt en de dubbele punt en 4 h na LPS injectie in de lever. Binnen 8 uur de expressie Il6terug Il1b, TNFa en Il10 naar basislijn niveaus in de milt, de lever en de dikke darm. Ernst van de ziekte een piek tussen 6 h en 10 h na LPS injectie wanneer de expressie van Il6, Il1b, TNFa en Il10 zijn reeds teruggekeerd naar de niveaus van de basislijn die aangeeft dat verhoogde expressie van Il6, Il1b, TNFa en Il10 treedt snel na LPS injectie, maar dat de kinetiek van andere genen een ander patroon kan tonen na LPS injectie. De uitdrukking van deze cytokines kan ook op het niveau van de eiwitten in het bloed van de dieren door ELISA, die kan worden beschouwd als aanvulling op qPCR worden geanalyseerd.

Wijzigingen en probleemoplossing van de techniek zijn noodzakelijk in gevallen wanneer een ziekte score > 12 is bereikt. Daarom moet de dosis van LPS worden verminderd en beter aangepast aan de gebruikte muis-lijn en de plaatselijke omstandigheden om te voorkomen dat de voortijdige beëindiging van het experiment. Het manipuleren van genen door te verwijderen van een bepaald genomic gebied of overexpressing van een gen kan de gevoeligheid van muizen voor LPS beïnvloeden. In voorbereidende experimenten, kan de dosis van LPS worden getitreerd aan de juiste dosis te vermijden geen onnodige schade en de dood van de dieren in dit experiment. Van de nota, verontreiniging van LPS met andere bacteriële afkomstige producten en mis injecties moeten worden vermeden. Bovendien moet de kinetiek van de expressie van genen van belang na LPS injectie worden bepaald.

Beperkingen zijn dat deze techniek informatie over de gevolgen van de verspreiding van microbiële producten in de gastheer na een overtreding van de intestinale barrière biedt, maar geen informatie over gebeurtenissen die leiden geeft aan schending van de intestinale barrière en oorzaken dat trigger IBD. Natuurlijk, dit model is niet een colitis-model als de DSS colitis model, maar het kan zinvol zijn naast colitis modellen om te studeren het gevolg van de ingang van microbiële producten in de gastheer. Bovendien zal het i.p. injectie van LPS verstoren de peritoneale Holte, die de kleine en grote darmen bevinden. Dit kan het vergemakkelijken van de translocatie van intestinale afkomstige bacteriële producten uit de peritoneale holte in de gastheer.

De betekenis van dit model is het feit dat het gebruik maakt van een gedefinieerde PAMP. In andere modellen waaronder de i.p. injectie van hele bacteriën, het i.p. injectie van fecale oplossingen24 of de septische peritonitis modellen, waarin peritonitis wordt veroorzaakt door cecal afbinding en punctie28, een breed scala van microben of hun producten induceert ziekte. Anderzijds injectie van LPS in muizen is een ongecompliceerde benadering en vereist geen chirurgie zoals septische peritonitis geïnduceerd door cecal afbinding en punctie.

Verdere toepassing van dit model zijn studies die gericht zijn op het onderzoeken van endotoxemia of LPS geïnduceerde bloedvergiftiging in alle contexten gekenmerkt door de translocatie van bacteriën afkomstige producten naar de host, zoals de schending van de barrière van de huid of het overtreden van de urogenitale tractus. Kortom, is dit een eenvoudig model dat kan worden gebruikt in elke instelling laboratorium. Afhankelijk van de plaatselijke omstandigheden, kan er aanpassingen aan de lokale behoeften nodig. In het bijzonder moet de scorekaart met de lokale autoriteiten worden besproken voordat het experiment wordt uitgevoerd. Deze aanpak werd gebruikt om na te bootsen van gevolgen voor de host wanneer bacteriën of bacteriële afkomstige producten de host invoert nadat er een barrière schending heeft plaatsgevonden. Dit is met name relevant in studies die onderzoeken de basis van IBD waar het uitbreken van een overtreding van de intestinale barrière een gemeenschappelijk evenement in de pathologie van de ziekte is.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

JHN wordt ondersteund door de Zwitserse nationale Stichting (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics