Injections de lipopolysaccharides dans souris pour imiter l’entrée des produits d’origine microbienne après rupture de la barrière intestinale

Immunology and Infection
 

ERRATUM NOTICE

Summary

Un protocole pour simuler l’entrée de composés d’origine bactérienne après rupture de la barrière intestinale est présenté ici. Une faible dose de lipopolysaccharide a été injectée systémique chez la souris, qui ont été observées pendant l’injection après 24 h. L’expression des cytokines pro-inflammatoires était déterminée à plusieurs moments dans la rate, du foie et du colon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La barrière épithéliale intestinale sépare l’hôte de la microflore est normalement tolérée ou ignorée. La violation de cette barrière se traduit par l’entrée de bactéries ou de produits dérivés de bactéries dans l’hôte, l’accès à la circulation de l’hôte et les organes internes menant à l’inflammation incontrôlée, comme observé chez les patients atteints de la maladie intestinale inflammatoire (MII), qui sont caractérisés par une augmentation de la perméabilité épithéliale intestinale.

Pour simuler l’entrée de composés d’origine bactérienne dans l’hôte, un modèle endotoxémie a été adoptée par les lipopolysaccharides (LPS), un composant de la paroi externe des bactéries Gram-négatives, ont été injectées à des souris. Dans cette étude, une dose de LPS a été injectée par voie intrapéritonéale et les souris ont été suivis par la suite pendant 8 h, à l’aide d’un score de maladie. En outre, l’expression taux de cytokines inflammatoires Il6, Il1b et Tnfa ont été analysés dans la rate, le foie et le colon de qPCR à des moments différents après injection de LPS. Ce modèle pourrait être utile pour les études portant sur l’étude des réponses immunitaires après l’invasion de micro-organismes ou de produits dérivés bactérien causés par un manquement de la barrière de la surface du corps.

Introduction

L’intestin humain est colonisé avec un grand consortium de micro-organismes qui forme le microbiote, qui a développé une relation mutuellement bénéfique avec l’hôte au cours de l’évolution. Dans cette relation, l’hôte fournit un créneau sûr pour la microflore, tandis que le microbiote fournit des vitamines, de la digestion des éléments nutritifs et de protection contre les agents pathogènes à l’hôte, où le microbiote réside1. Lorsque cette relation positive entre l’hôte et le microbiote est perturbée, les maladies peuvent se développer, tels que les maladies inflammatoires de l’intestin (MII). EIA est une maladie inflammatoire chronique multifactorielle de l’intestin causée par des facteurs génétiques et environnementaux qui se produisent sous deux formes principales, (CD) de la maladie de Crohn et la colite ulcéreuse (Cu). Malgré les similitudes entre les deux formes de l’EIA, elles sont caractérisées par certaines différences dans la localisation et la nature des modifications inflammatoires. CD est une affection inflammatoire de rechute transmurale qui peut potentiellement s’étendre à n’importe quelle partie du tube digestif, tandis que l’UC est non transmural et est limité à du côlon. En outre, les mutations de liaison nucléotidique oligomérisation domaine protéine 2 (NOD2), un récepteur de reconnaissance de modèle (PRR) qui reconnaît MURAMYLE dipeptide (MDP), un composant de la paroi cellulaire des bactéries plus Gram positifs et - négatifs, est associé à CD2. En outre, Escherichia coli (e. coli), Listeria et streptocoques et leurs produits tous se trouvaient dans les macrophages chez les patients de CD qui sont entrés dans l’hôte après une barrière violent3. Lorsque les bactéries ou leurs produits dans l’hôte pendant l’élaboration du CD, le système immunitaire développe une réaction conduisant à la production d’anticorps anti-bacterial4en circulation. Peut-être, la preuve la plus convaincante pour le rôle de la microflore dans la pathogenèse de l’IBD provient de modèles murins. Lorsque les animaux est traités avec des antibiotiques, ou lorsque les souris sont maintenues dans des conditions sans germe (GF), la sévérité de la maladie est réduite dans la plupart des modèles de colite, comme dans IL 10-souris-/-qui ne se développent pas colitis en GF installations5,6. En outre, la colite perturbe également la composition de la microflore, qui se caractérise par une composition déséquilibrée et réduit la richesse appelé dysbiose7. La conséquence de l’IBD peut être une augmentation de la perméabilité intestinale pouvant mener à l’entrée de microbes et de produits d’origine microbienne dans l’hôte.

Chez les animaux, l’application de Dextran Sulfate de Sodium (DSS) a induit une atteinte épithéliale intestinale conduisant à une augmentation de la perméabilité de la barrière épithéliale8. Portail LPS concentrations sont élevées chez les animaux souffrant de colite DSS9. Fait intéressant, animaux manquant le C type lectine du récepteur spécifique adhérence intracellulaire molécule 3 saisissant nonintegrin liée au homologue 1 (signe-R1) sont protégés contre colite DSS et induite par LPS endotoxémie10. Pour diffuser dans l’hôte, les bactéries ou les bactéries provenant de produits doivent passer la barrière vasculaire11, la cavité péritonéale, où se trouve le petit et grand intestin, les ganglions lymphatiques mésentériques et/ou le foie12. Pour réduire la complexité de ce système, un composé dérivé de bactéries défini a été utilisé. LPS, ce qui provoque l’endotoxémie après voie intrapéritonéale ou par voie intraveineuse (i.v.) injection13 a été injectées à des souris, pour étudier l’expression de l’interleukines Il6 et Ilb et la cytokine Tnfa en réponse au LPS.

LPS est un motif moléculaire micro-organismes pathogènes associés (PAMP) exprimé en un composant de paroi cellulaire de bactéries à Gram négatif, consistant en lipide A (le PAMP principal dans la structure de LPS), un oligosaccharide de noyau et un O côté chaîne14. Récepteur de type Toll 4 (TLR4) exprimé par les cellules dendritiques, les macrophages et les cellules épithéliales reconnaît LPS15, nécessitant des corécepteurs de liaison appropriée. La phase aiguë, la protéine liant le LPS (LBP) lie LPS pour former un complexe qui transfère le LPS au cluster de différenciation 14 (CD14), une protéine membranaire glycosylphosphatidylinositol-ancré. CD14 autres navettes LPS à l’antigène des lymphocytes 96 ou également connu sous le nom de MD-2, qui est associé avec le domaine extracellulaire de TLR4. La liaison du LPS à MD-2 facilite la dimérisation de TLR4/MD-2 pour induire des changements de conformation de recruter des molécules d’adapteur intracellulaire pour activer l’aval signalisation voie14, qui comprend la principale différenciation myéloïde gène de réponse 88 (MyD88) - voie dépendante et le TIR contenant du domaine adaptateur induisant l’interféron β (FTBC) - dépendant voie16. La reconnaissance du LPS par le TLR4 puis active la voie NF-κB et induit l’expression des cytokines pro-inflammatoires, telles que le TNFα, IL-6 et IL-1β17.

En particulier, lorsque le LPS est injecté dans des animaux, la concentration de LPS donné aux animaux, le bagage génétique de l’animal et le régime alimentaire doit être considérée. Des concentrations élevées de LPS conduit à un choc septique, caractérisée par une hypotension et des défaillances d’organes multiples et enfin à la mort de18. Souris sont moins sensibles aux LPS par rapport à l’homme, où les concentrations de LPS entre 2 à 4 ng/kg de poids corporel (PC) sont capables d’induire une tempête de cytokines19. Pour les souris, la dose létale (DL50), qui provoque la mort dans la moitié des gammes souris de 10 à 25 mg/kg de poids vif de20 selon la souche de souris utilisée. Pour les souches de souris couramment utilisés, C57Bl/6 et BALB/c, la dose létale 50 % (DL50) est de 10 mg/kg de poids vif. En revanche, les souches C3H/HeJ et C57BL/10ScCr sont protégés des LPS induits endotoxémie, qui est due à des mutations dans le Tlr421. En conséquence, les souris déficientes Tlr4 sont hyporéactivité à injections avec LPS22. Autres lignées de souris génétiquement modifiés, tels que les souris PARP1-/-23 sont résistantes au choc toxique induite par LPS.

Le modèle murin décrit ici utilise une dose de LPS administré systématiquement pour imiter les conséquences de la diffusion de LPS après une rupture de la barrière des surfaces du corps. La concentration choisie de LPS (2 mg/kg de poids vif) n’induit pas de mortalité chez des souris C56Bl/6, mais la libération induite par des cytokines pro-inflammatoires.

Protocol

Souris ont été élevés et gardés sous exempts de micro-organismes pathogènes (SPF) des conditions spécifiques à l’animalerie du département de biomédecine, Université de Bâle (Bâle, Suisse). Toutes les expériences de souris ont été effectuées conformément aux règlements cantons (numéro de protocole animaux 2816 [Canton de Bâle-ville]) et fédéral suisse.

1. préparation de la Solution de LPS

  1. Ouvrez le stock de LPS purifié à partir de 0111:B4 d’Escherichia coli dans des conditions stériles et reconstituer dans l’eau à la concentration de 5 mg/mL.
  2. Diluer le stock de LPS avec la saline stérile tamponnée au phosphate (PBS) à la concentration du travail de 0,2 µg/µL.

2. intrapéritonéale de LPS chez la souris

  1. Aspirer les LPS en solution une seringue 0,5 mL avec une aiguille de 30 G dans un flux d’air laminaire.
  2. Peser les souris C57Bl/6 femelles (6 à 10 semaines d’âge) et de calculer le montant de LPS qui sera injecté : 10 µL (2 µg) / g corps de poids.
    NOTE : par exemple, si une souris pèse 20 g, puis 20 g x 10 µL = 200 µL LPS travaillant les besoins de la solution à doser.
  3. Manipuler la souris doucement mais fermement et immobiliser l’animal dans une main. Veiller à ce que l’animal est capable de respirer normalement, mais pas de tordre et tourner au cours de la retenue.
  4. Incliner le nez de souris légèrement vers le sol pour exposer l’abdomen pour injection. Localiser la ligne médiane de l’abdomen et l’endroit de l’injection dans le bas ventre à gauche ou à droite de la ligne médiane. I.p. PBS au lieu de LPS injecter des souris témoins.
  5. Avec la main libre, injecter le volume approprié (le volume calculé à l’étape 2.2) des LPS, solution de travail. S’assurer que l’aiguille est entrée dans la cavité péritonéale comme dans le cas contraire, mauvaise injections dans la couche musculaire abdominale peuvent se produire. Pourtant, n’allez pas trop profondément avec l’aiguille dans la cavité péritonéale pour ne pas blesser les organes intérieurs situés dans cette zone.
  6. Retourner l’animal soigneusement à la cage avec la souris jusqu'à 5 par cage.

3. surveiller les souris

  1. Surveiller les animaux au moment de l’injection et toutes les 2 h après l’injection pendant 8 h pour la fréquence et la gravité de l’endotoxémie. Par conséquent, utiliser une feuille de pointage (tableau 1) qui a été adaptée à partir d’un manuscrit précédemment publié 24.
  2. Marquer les souris injectées LPS pour les paramètres suivants énumérés au tableau 1
    1. Vérifier l’apparence de la fourrure qui est normalement lisse. Si la fourrure apparaît fourrure hérissée, hérissé ou gonflé qui indique l’inconfort ou douleur, leur score comme 1, 2 ou 3.
    2. Vérifier l’activité de la souris.
      NOTE : Souris normalement circuler librement autour de la cage toute manger, boire, escalade, mais supprimée ou restreinte l’activité pourrait être un signe de douleur.
    3. Vérifier le niveau de conscience.
      Remarque : Les souris sont très curieux et qu’ils se déplacent normalement la cage enquêter sur l’entourage. Le manque d’ou mouvement réduite peut suggérer la douleur et l’inconfort.
    4. Vérifier les yeux.
      Remarque : Les yeux pleinement ouverts sont attendus chez la souris, mais partiellement ou entièrement clos yeux, éventuellement avec sécrétion, peut être une indication de la douleur.
    5. Vérifier le taux de respiration.
      Remarque : Chez la souris ont généralement un taux de respiration normale et rapide, un taux réduit de la respiration pourrait être une indication d’inconfort).
    6. Vérifiez la qualité de la respiration.
      NOTE : Respiration difficile avec ou sans halètement est un signe de douleur.

4. prélèvement de pour l’Extraction de l’acide ribonucléique (ARN) et homogénéisation

  1. Préparer les tubes de collection/homogénéisation : ajouter 1 mL de réactif isolement de seule étape RNA à tubes de 2 mL remplie au préalable avec les sphères en céramique de 1,4 mm.
  2. Aux points de temps approprié (avant (0 h) et 2 h, 4 h et 8 h après l’injection de LPS) euthanasier la souris avec surdosage anesthésique (isoflurane) suivi d’une exsanguination et procéder à la dissection.
  3. Couper la peau et la couche musculaire, exposant ainsi la cavité abdominale avec les organes internes avec une paire de ciseaux.
  4. Soigneusement disséquer la rate, le foie et le colon, nettoyer les organes de la graisse et les conserver dans du PBS sur la glace.
  5. Découper un petit morceau (environ 0,5 cm de longueur) de chacun des organes à l’aide de ciseaux ou un scalpel.
    Remarque : Il est important de toujours prendre la pièce d’environ la même partie de l’organe dans chaque souris (même lobe d’une partie du foie, proximale et distale du côlon).
  6. Peu de temps, sécher le tissu sur un morceau de mouchoir en papier et placez-le dans le tube de collecte/homogénéisation en vous assurant qu’il est complètement immergé en réactif d’isolement ARN.
  7. Homogénéiser le tissu dans un homogénéisateur de benchtop à grande vitesse. Pour les tissus mous comme rate, le foie et le colon, utilisent 1 cycle d’homogénéisation à vitesse 6,00 pendant 30 s.
  8. Incuber les échantillons pendant 5 min à température ambiante.
  9. Placer soigneusement le tube dans l’azote liquide pour aimanter gel le tissu lysat. Stocker le composant logiciel enfichable congelé lysat à-80 ° C jusqu'à ce que l’ARN.

5. RNA Extraction du tissu

NOTE : RNA isolation réactifs, chloroforme et alcools sont considérés comme des matières dangereuses. Effectuer l’extraction de l’ARN sous une hotte chimique. Utilisation certifiée exempte de RNase réactifs et équipements pour maintenir un environnement exempt de RNase.

  1. Séparation de phase
    1. Décongeler le lysat de tissus congelés sur la glace.
    2. Centrifuger l’échantillon sur 1 000 x g pendant 5 min à 4 ° C pour granuler les particules restantes de tissus qui pourraient ne pas être.
    3. Transférer le surnageant dans un nouveau tube sans nucléase 1,5 mL.
    4. Ajouter 200 chloroforme glacée de µL par isolement 1 mL RNA réactif et agiter vigoureusement à la main pendant 10-15 s.
    5. Incuber pendant 2-3 min à température ambiante.
    6. Centrifuger à 12, 000 x g pendant 15 min à 4 ° C.
      Remarque : L’échantillon contient maintenant 3 phases : abaisser le rouge de phénol-chloroforme, l’interphase et la phase aqueuse incolore supérieure. L’ARN est présent dans la phase aqueuse supérieure.
    7. Recueillir la phase aqueuse supérieure (50 % du volume total) et le transfert dans un nouveau tube sans nucléase 1,5 mL.
  2. Précipitation d’ARN
    1. Ajouter 0,5 mL d’isopropanol glacée par 1 mL de réactif d’isolement RNA et mélanger doucement en retournant le tube 5 - 6 fois.
    2. Incuber pendant 10-15 min à température ambiante.
    3. Centrifuger à 12 000 x g pendant 10 min à 4 ° C.
      NOTE : Pellet RNA devrait être visible à ce stade.
  3. Lavage des granulés de RNA
    1. Supprimer complètement le surnageant contenant l’isopropanol sans déranger le culot.
    2. Laver le culot avec 1 mL d’éthanol 75 % glacée par 1 mL de réactif d’isolement RNA utilisé pour provoquer la lyse initiale.
    3. Vortex l’échantillon brièvement.
    4. Centrifuger l’échantillon à 7 500 (ou 12 000) x g pendant 5 min à 4 ° C.
  4. Dissolution des ARN
    1. Supprimer complètement l’éthanol dans le liquide surnageant sans déranger le culot.
    2. Maintenir le tube ouvert sous la hotte chimique pendant 3-5 min sécher le culot de RNA à température ambiante (ne pas trop sécher car dans ce cas, il sera difficile de dissoudre le RNA).
    3. Dissoudre le culot de RNA dans 20 à 50 µL eau exempte de nucléase de pipetage soigneusement de haut en bas.
    4. Incuber les échantillons à 55 ° C pendant 10-15 min d’améliorer encore la solution de l’ARN.
      Remarque : À ce stade, les RNA peut être stockée à-80 ° C jusqu'à une analyse plus approfondie.

6. la digestion de l’ADN restant

  1. Mesurer la concentration en ARN avec un spectrophotomètre en pipettant également, une partie aliquote (2 µl) dans le spectrophotomètre et ajustez la concentration recommandée.
  2. Commencer la digestion de contamination ADN par max. 10 µg RNA dans l’eau sans nucléase 50 µL.
  3. Ajouter 0,1 volume de 10 x la DNase I mettre en mémoire tampon et 1 µL rDNase j’ai par exemple et mélanger doucement en pipettant également, haut et bas.
  4. Incuber à 37 ° C pendant 20-30 min.
  5. Réactif de l’Inactivation de DNase vortex et ajouter 0,1 volume de l’échantillon de mélange bien avec la pipette.
  6. Incuber 5 min à température ambiante, mêlant parfois à la main.
  7. Centrifuger à 10 000 g pendant 1,5 minutes.
  8. Transférer le surnageant contenant sans ADN ARN dans le nouveau tube d’exempte de nucléase.
  9. Mesurer la concentration d’ARN et de la qualité par le spectrophotomètre.

7. Transcription inverse

  1. Utiliser un kit de transcription inverse (RT) disponibles dans le commerce d’acide désoxyribonucléique ADNc pour la transcription inverse.
    NOTE : Ici, du jusqu'à 2 µg d’ARN peut être inversé transcrit.
  2. Calculer le volume, qui contient 2 µg RNA. Pipeter 2 µg RNA dans un nouveau tube PCR.
  3. Ajouter l’eau exempte de nucléase à l’échantillon dans le tube PCR pour le volume final de 10 µL.
  4. Préparer 2 x Master Mix en mélangeant les éléments suivants énuméré dans le tableau 2
  5. Ajouter 10 µL 2 x Master Mix à 10 µl RNA pour obtenir 1 x Master Mix du volume total de 20 µL.
  6. Fermer le tube de polymerase chain reaction (PCR) et la Centrifuger l’échantillon brièvement.
  7. Placer les échantillons dans un thermocycleur PCR et définissez les paramètres répertoriés dans le tableau 3.
  8. Stocker l’ADNc généré à-20 ° C pour une analyse ultérieure.

8. quantitative PCR (qPCR)

  1. Effectuer la réaction de qPCR avec un kit disponible dans le commerce.
  2. Se concevoir et tester les amorces couvrant intron, avant utilisation, avec différentes concentrations de cDNA de modèle. Analyser l’efficacité de l’amorce en créant une courbe standard et utiliser les amorces avec grande efficacité et des courbes de fusion correctes.
    Remarque : Les séquences des amorces utilisées dans cette expérience sont répertoriés dans le tableau 2.
  3. Préparer la réaction en chaîne (qPCR) polymérase quantitative dans la plaque 384 puits avec l’installation de la réaction décrite dans le tableau 4.
  4. Garder toutes les solutions et la plaque sur la glace à l’aide de papier d’aluminium pour empêcher le plat se mouiller lorsque le mélange réactionnel est préparé.
  5. Effectuer toutes les réactions en géométrie.
  6. Effectuer la réaction de PCR sur un thermocycleur en utilisant le paramètre répertorié dans le tableau 5.
  7. Calculer la valeur moyenne de Ct pour toutes les réactions de la géométrie. Normaliser tous les gènes cibles pour le niveau d’expression de la glycerinealdehyde-3-phosphate-déshydrogénase (Gapdh) gène de ménage en calculant 2^(-ΔCt).
    Remarque : Tous les gènes cibles avec le Ct moyen > 35 ont été considéré comme étant sous la limite de détection.

Representative Results

Pour simuler les conséquences pour l’hôte après l’entrée des bactéries ou des produits d’origine bactérienne qui se produit après la rupture de la barrière intestinale, LPS a été injecté à des souris C57Bl/6 en une dose (2 µg/g de poids corporel). Chaque souris a été surveillée et orchestrée pour l’occurrence de l’endotoxémie avec paramètres énumérés dans la feuille de pointage qui comprend, l’apparition des souris, l’activité des animaux, la condition des yeux et le taux de respiration et de qualité (tableau 1) . Les animaux ont montré des signes cliniques de la maladie qui a atteint un maximum de 6 à 10 h après l’injection de LPS et récupérés dans les 24h (Figure 1). Souris individuels ont été sacrifié 2 h, 4 h et 8 h après l’injection du LPS. Morceaux de tissus ont été prélevés de la rate, du foie et du colon. L’ARN a été isolé de ces organes et inverse transcrit à l’ARNC. L’ADNc a été utilisé comme modèle pour qPCR pour déterminer les niveaux d’expression Il6 (Figure 2 a) Il1b (Figure 2 b), TNFa (Figure 2) et Il10 (Figure 2D) avec des amorces utilisées pour le qPCR énumérées au tableau 6. L’expression d’Il6 a atteint un maximum de 2 h après l’injection dans la rate et le côlon et 4 h après l’injection dans le foie. L’expression d’Il1b, TNFa et Il10 a atteint un maximum de 4 h après l’injection dans la rate, du foie et du colon. Dans les 8 h après l’injection, l’expression de Il6, Il1b, TNFa et Il10 retournés à des niveaux de référence.

Figure 1
Figure 1 : injection de LPS (2 µg/g de poids corporel) a provoqué des signes cliniques de l’endotoxémie dans C57Bl/6mice. Après l’injection de 2 µg/g de poids corporel de LPS, souris individuels ont été suivis avec le score de la maladie présenté au tableau 1 qui inclut l’apparence et l’activité des animaux, de leurs yeux et leur taux de respiration et la qualité d’ouverture toutes les 2 h pendant 12 h et 24h arrière cateur injection LPS. Le score de la maladie (axe y) a été effacé à la fois respective (axe x). Moyenne ± SD pour 4-5 souris par chaque instant est présenté. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : injection LPS (2 µg/g de poids corporel) induit l’expression des cytokines pro-inflammatoires chez les souris C57Bl/6. Souris ont été injectées avec 2 µg/g de poids corporel de LPS et les niveaux d’expression Il6 (A), Il1b (B), Tnfa (C) et Il10 (D) ont été analysés par qPCR dans la rate, du foie et du colon à l’heure indiquée points après l’injection. Tous des niveaux d’expression de cytokines ont été normalisées à l’expression de Gapdh. Moyenne ± SD pour 4-5 souris par chaque point dans le temps est montré. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Tableau 1 : feuille de pointage de la maladie pour surveiller les souris C57Bl/6 après injection LPS. Paramètres qui sont surveillées après l’injection de LPS. Animaux ont été surveillés toutes les 2 h après l’injection pour une période de 12 h, et les scores ont été donnés pour tous les paramètres individuels répertoriés dans le tableau. Le score final pour chaque animal représente la somme de tous les scores individuels. C’est une adaptation de référence24. S’il vous plaît cliquez ici pour télécharger ce fichier.

Montant Réactif
2 µL/échantillon mémoire tampon RT 10 x
Échantillon/µL 0,8 25 x désoxyribonucléosides (dNTP) Mix (100 mM)
1 µL/échantillon RT des amorces aléatoires
4.2 µL/échantillon eau exempte de nucléase

Tableau 2 : Les réactifs utilisés pour préparer le mélange maître transcriptase inverse.

Température Temps
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Maintenez

Tableau 3 : Thermocycleur paramètres utilisés pour la transcription inverse.

Montant Réactif
5 µL/puits 2 x Master Mix
0,05 µL/puits Colorant de référence
500 nM final/puits primer avant
500 nM final/puits inverser l’apprêt
entre 10 et 100 ng/Eh bien, nous avons utilisé 40 ng/puits modèle cDNA dilué dans un tampon de Dilution du modèle (dilution 1/100 de ce tampon a été faite dans l’eau sans nucléase et utilisée pour diluer le cDNA de modèle). Diluer le modèle dans ce tampon permet la visualisation des puits où modèle est ajouté comme les changements de couleur de réaction du bleu au vert
exempte de nucléase l’eau pour un volume final de 10 µL/puits eau exempte de nucléase

Tableau 4 : Description de la réaction PCR.

Température Temps
95 ° C 2 min
95 ° C 5 s 40 cycles
60 ° C 20 s
95 ° C 15 s analyse de la courbe de fusion
60 ° C 1 min
95 ° C 15 s

Tableau 5 : Thermocycleur paramètres utilisés pour l’ACP.

Apprêt Séquence Température de fusion Longueur du produit
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57.2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
TNFa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
TNFa-R AGGGTCTGGGCCATAGAACT 60
GAPDH.-f. CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH.-r. CCTGTTGCTGTAGCCGTATT 58

Tableau 6 : amorces utilisées dans la réaction de qPCR. La séquence des amorces utilisées pour qPCR pour détecter les cytokines de souris et gène de ménage Gapdh.

Discussion

Ce protocole imite des processus immunologiques qui se produisent après l’invasion de produits d’origine microbienne. Étapes critiques au sein du protocole sont la sélection de la lignée de souris, l’état d’hygiène des souris, la dose de LPS, la surveillance des animaux pour l’occurrence de l’endotoxémie et le point dans le temps de la fin de l’expérience. Plus important encore, le bagage génétique de la souche de souris doit être considérée. Souches de souris différents ont une sensibilité différente au LPS. Par exemple, le C3H/HeJ et les souris C57BL/10ScCr résistent à la LPS induisent endotoxémie21,25. En outre, l’état d’hygiène des animaux peut-être influencer le cours des endotoxémie LPS. Spécifiques-exempts de micro-organismes pathogènes (SPF) animaux sont plus couramment utilisés. Ces souris sont exempts d’une liste définie d’agents pathogènes, mais la composition de la microflore complète de ces animaux ne connaît pas de26,27. Des animaux axéniques ou axéniques stériles (qui ne pas héberger un microbiote) sont distinguent par SPF souris26; Probablement, la colonisation des animaux axéniques avec un micro-organisme ou avec un consortium de micro-organismes (animaux gnotoxéniques) peut-être influencer l’expression des gènes, telles que IL-19, après injection de LPS par rapport aux animaux de SPF8. En outre, une feuille de pointage a été suggérée, qui a été utilisé comme une feuille de pointage pour un modèle de septicémie provoquée par l’injection de la solution fécale dans la cavité péritonéale24. Cette sheetcan être discuté avec le Comité local de bien-être animal et peuvent être adaptées aux besoins locaux. En particulier, les modalités de résiliation doit être discuté avec le Comité local de bien-être animal. Cette expérience a dû être arrêté lorsqu’une partition > 12 est atteint ou lorsque la note maximale pour un seul paramètre individuel est atteinte. Dans cette expérience, aucun animal de huit animaux a dépassé un score de maladie de 12 après l’injection du LPS (2 µg/g de poids corporel). Dans cette étude, résultats de l’expression des cytokines Il6, Il1b, TNFa et Il10 dans le foie, rate et le côlon après injection de LPS sont présentés. L’expression d’Il1b, TNFa et Il10 a atteint un sommet 4 h après l’injection de LPS dans la rate, du foie et du côlon, tandis que, Il6 expression atteint un maximum de 2 h après l’injection de LPS dans la rate et le côlon et 4 heures après l’injection de LPS dans le foie. Dans les 8 h l’expression Il6, Il1b, TNFa et Il10 retournent à des niveaux de référence dans la rate, du foie et du colon. Gravité de la maladie a atteint un maximum entre 6 h et 10 h après l’injection de LPS lorsque l’expression d’Il6, Il1b, TNFa et Il10 ont déjà retournés à des niveaux de référence indiquant qui a augmenté l’expression Il6, Il1b, TNFa et Il10 survient rapidement après l’injection de LPS, mais que la cinétique d’autres gènes peut-être montrer une tendance différente après injection de LPS. L’expression de ces cytokines puisse également être analysée sur le niveau de protéine dans le sang des animaux par ELISA, qui peut être considérée en plus qPCR.

Modifications et dépannage de la technique sont nécessaires dans les cas quand une maladie score > 12 est atteint. Par conséquent, la dose de LPS doit être réduit et mieux ajustés à la lignée de souris utilisées et les conditions locales pour éviter un arrêt prématuré de l’expérience. La manipulation des gènes en supprimant une région génomique ou surexprimant un gène peut influencer la susceptibilité des souris au LPS. Dans des expériences préliminaires, la dose de LPS peut-être être titrée à la dose appropriée pour éviter les dommages inutiles et la mort aux animaux dans cette expérience. À noter, contamination des LPS avec d’autres produits d’origine bactérienne et mauvaise injections doivent être évités. Par ailleurs, la cinétique de l’expression des gènes d’intérêt après l’injection de LPS doit être déterminée.

Limites sont que cette technique donne des informations sur les conséquences de la dissémination de produits microbiens dans l’hôte après une rupture de la barrière intestinale mais ne donnera pas d’informations sur les événements qui conduisent à la rupture de la barrière intestinale et à des causes ce déclencheur EIA. Bien sûr, ce modèle n’est pas un modèle de colite comme le modèle de colite DSS, mais il peut être utile en plus de modèles de colite pour étudier les conséquences de l’entrée de produits microbiens dans l’hôte. Par ailleurs, l’injection intrapéritonéale de LPS perturbera la cavité péritonéale, où se trouvent le petit et le gros intestin. Cela peut faciliter la translocation des bactéries intestinales dérivés de la cavité péritonéale dans l’hôte.

La signification de ce modèle est le fait qu’il utilise un PAMP défini. Dans d’autres modèles, y compris l’injection intrapéritonéale de bactéries entières, l’injection intrapéritonéale de solutions fécale24 ou les modèles de péritonite septique, dans lequel la péritonite est induite par le caecum ligature et perforation28, une foule de microbes ou leur produits induit la maladie. En outre, injection de LPS chez la souris est une approche simple et ne nécessite pas de chirurgie comme la péritonite septique induite par ponction et ligature caecale.

Autre demande de ce modèle sont les études qui visent à étudier l’endotoxémie ou LPS induits une septicémie dans n’importe quel des contextes caractérisés par la translocation des produits dérivés de bactéries dans l’hôte, telles que la rupture de la barrière de la peau ou a manqué de la tractus urogénital. En conclusion, il s’agit d’un modèle simple qui peut être utilisé dans chaque cadre de laboratoire. Selon les conditions locales, il pourrait y avoir des adaptations au nécessaire aux besoins locaux. En particulier, la feuille de match doit être discuté avec les autorités locales, avant que l’expérience soit effectuée. Cette approche a été utilisée pour imiter les conséquences pour l’hôte lorsque bactéries ou produits d’origine bactérienne dans l’hôte après la survenance d’une rupture de la barrière. Cela peut être en particulier dans les études portant sur la base des MICI lorsque l’éventualité d’une rupture de la barrière intestinale est un événement commun dans la pathologie de la maladie.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Patrick est pris en charge par la Fondation National Suisse (FNS 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics