Injektioner af LPS ind i musene at efterligne indgangen af mikrobielle-afledte produkter efter tarm barriere brud

Immunology and Infection
 

ERRATUM NOTICE

Summary

Her præsenteres en protokol til at efterligne indgangen af bakteriel-afledte forbindelser efter tarm barriere brud. En lav subletale dosis af LPS blev sprøjtet systemisk ind i musene, som blev overvåget for 24 timer efter injektion. Udtryk af pro-inflammatoriske cytokiner var fast besluttet på flere tidspunkter i milten, leveren og kolon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den intestinale epitel barriere adskiller vært fra den mikrobiota, der er normalt tolereres eller ignoreret. Overtrædelse af denne barriere resulterer i indgangen af bakterier eller bakterier-afledte produkter i host, host omsætning og indre organer fører til ukontrolleret betændelse som observeret hos patienter med inflammatorisk tarmsygdom (IBD), der er karakteriseret ved en øget intestinal epitelial permeabilitet.

For at efterligne indgangen af bakteriel-afledte forbindelser til værten, en endotoxemia model er blevet vedtaget i som LPS (LPS), en del af den ydre cellevæg af Gram-negative bakterier, blev sprøjtet ind i musene. I denne undersøgelse, en subletale dosis af LP'ER var intraperitoneal injiceres og musene blev efterfølgende overvåges for 8 h ved hjælp af en sygdom score. Derudover udtrykket niveauer af den inflammatoriske cytokiner Il6, Il1b, og Tnfa blev analyseret i milten, leveren og kolon af qPCR på forskellige tidspunkter post LP'ER injektion. Denne model kan være nyttigt for de undersøgelser, der indebærer undersøgelse af immunrespons efter invasionen af mikroorganismer eller bakteriel-afledte produkter forårsaget af en barriere brud på kroppen overflader.

Introduction

Human tarmen er koloniseret med et stort konsortium af mikroorganismer, der danner den mikrobiota, der har udviklet et gensidigt gavnlige forhold med værten under udviklingen. I dette forhold giver værten en sikker niche for mikrobiota, mens mikrobiota giver vitaminer, næringsstoffer fordøjelse og beskyttelse mod patogener til værten, hvor mikrobiota findes1. Når denne gavnlige forholdet mellem værten og mikrobiota forstyrres, kan sygdomme udvikle, såsom inflammatorisk tarmsygdom (IBD). IBD er en multifaktoriel Kronisk inflammatorisk sygdom i tarmen forårsaget af genetiske og miljømæssige faktorer, der forekommer i to hovedgrupper, Crohns sygdom (CD) og colitis ulcerosa (UC). Trods ligheder mellem de to IBD former, er de kendetegnet ved visse forskelle i placering og karakter af inflammatoriske ændringer. CD er en recidiverende transmural inflammatorisk sygdom, der potentielt kan udvides til nogen del af mave-tarmkanalen, mens UC er ikke-transmural og er begrænset til tyktarmen. Desuden mutationer i nukleotid-bindende oligomerisering domæne indeholdende protein 2 (NOD2), et mønster anerkendelse receptor (PRR), genkender muramyl dipeptid (MDP), en komponent af cellevæggen mest grampositive og -negative bakterier, er forbundet med CD2. Derudover blev Escherichia coli (E. coli), Listeria og streptokokker og deres produkter alle fundet i makrofager i CD patienter, der har indtastet værten efter en barriere brud på3. Når bakterier eller deres produkter ind værten under udviklingen af CD, udvikler immunsystemet en reaktion, der fører til produktion af cirkulerende anti-bakteriel antistoffer4. Måske, de mest overbevisende beviser for rollen som mikrobiota i patogenesen af IBD stammer fra musemodeller. Når dyrene behandles med antibiotika, eller når mus holdes i Kim-fri (GF) betingelser, er sværhedsgraden af sygdommen reduceret i de fleste colitis modeller, såsom i IL-10-/-mus, der ikke udvikler colitis i GF faciliteter5,6. Desuden forstyrrer colitis også sammensætningen af mikrobiota, som er karakteriseret ved en skæv sammensætning og reduceret rigdom kaldet dysbiosis7. Konsekvensen af IBD kan være en øget intestinal permeabilitet, der kan føre til indgangen af mikroorganismer og mikrobielle-afledte produkter i værten.

I dyr inducerer anvendelse af Dextran natriumsulfat (DSS) en tarm epitel overtrædelse fører til en øget gennemtrængelighed af epitel barriere8. Portalen LP'ER koncentrationer er forhøjet i dyr med DSS colitis9. Interessant, er dyr mangler C type lektin receptor specifikke intracellulære vedhæftning molekyle-3 snuppe nonintegrin homolog-relaterede 1 (tegn-R1) beskyttet fra DSS colitis og LPS-induceret endotoxemia10. For at videre formidle til værten, skal bakterier eller bakterier afledte produkter passere de vaskulære barriere11, bughulen, hvor små og store tarmen er beliggende, mesenteriallymfeknuderne lymfeknuder og/eller de lever12. For at reducere kompleksiteten af dette system, blev et defineret bakteriel-afledt stof brugt. LP'ER, som forårsager endotoxemia efter intraperitoneal (i.p.) eller intravenøs (IV) injektion13 blev sprøjtet ind i musene, at studere udtryk af interleukiner Il6 og Ilb og cytokin Tnfa svar på LPS.

LPS er en patogen-associeret molekylære mønster (PAMP) udtrykt som en cellevæg komponent af Gram-negative bakterier, der består af lipid A (den vigtigste PAMP i strukturen af LP'ER), en core oligosaccharid og en O side kæde14. Toll-lignende receptor 4 (TLR4) udtrykt ved dendritiske celler, makrofager og epitelceller genkender LP'ER15, der kræver samarbejde receptorer for relevante bindende. Den akutte fase protein LPS-bindende protein (LBP) binder LP'ER til at danne et kompleks, der overfører LP'ER til klynge af differentiering 14 (CD14), en glycosylphosphatidylinositol-forankrede membran protein. CD14 yderligere pendulfart LP'ER til lymfocytter antigen 96 eller også kendt som MD-2, som er forbundet med det ekstracellulære domæne af TLR4. Bindingen af LP'ER til MD-2 letter dimerization af TLR4/MD-2 til at fremkalde konformationelle ændringer at rekruttere intracellulære adapter molekyler for at aktivere den downstream signaling vej14, som omfatter den myeloide differentiering primære svar gen 88 (MyD88) - afhængige pathway og den TIR-domæne-holdige adapter-inducerende interferon-β (TRIF) - afhængige pathway16. Anerkendelse af LP'ER af TLR4 derefter aktiverer NF-κB pathway og inducerer udtryk af proinflammatoriske cytokiner, såsom TNFα, IL-6 og IL-1β17.

Især når LP'ER sprøjtes ind dyr, koncentrationen af LP'ER gives til dyr, har den genetiske baggrund for dyret og kost betragtes. Høje koncentrationer af LP'ER fører til en septisk shock, karakteriseret ved hypotension og flere orgel fejl, og endelig død18. Mus er mindre følsomme over for LP'ER i forhold til mennesker, hvor LP'ER koncentrationerne mellem 2-4 ng/kg legemsvægt (BW) er i stand til at fremkalde en cytokin storm19. For mus, den dødelige dosis (LD50), som inducerer død i halvdelen af musene spænder fra 10-25 mg/kg BW20 afhængigt af mus stamme anvendes. For almindeligt anvendte mus stammer, C57Bl/6 og BALB/c, er den dødelige dosis 50% (LD50) 10 mg/kg BW. I modsætning hertil er stammer C3H/HeJ og C57BL/10ScCr beskyttet fra LPS induceret endotoxemia, som skyldes mutationer i Tlr421. Tlr4-mangelfuld mus er derfor hyporesponsive til injektioner med LP'ER22. Andre genmodificerede mus linjer, som PARP1/mus23 er resistente over for LPS-induceret giftig shock.

Musen modellen beskrevet bruger her en subletale dosis af LP'ER administreres systemisk hen til efterligner følgerne af LP'ER udbredelse efter en barriere tilsidesættelse af kroppens overflader. Den valgte LP'ER koncentration (2 mg/kg BW) ikke fremkalde dødelighed i C56Bl/6 mus, men den inducerede udgivelsen af pro-inflammatoriske cytokiner.

Protocol

Mus blev avlet og holdes under specifikt patogenfri (SPF) forhold i det animalske facilitet af Institut for biomedicin, universitetet i Basel (Basel, Schweiz). Alle mus eksperimenter blev udført efter de schweiziske føderale og kantonale bestemmelser (animalske protokolnummer 2816 [Canton af Basel-Stadt]).

1. forberedelse af LP'ER løsning

  1. Åbn bestanden af LP'ER renset fra Escherichia coli 0111:B4 under sterile forhold og rekonstruere det i vand til koncentration på 5 mg/mL.
  2. Fortynd LP'ER bestanden med steril fosfatbufferet saltopløsning (PBS) med arbejde koncentrationen af 0,2 µg/µL.

2. intraperitoneal injektion af LP'ER til mus

  1. Opsug LP'ER arbejder løsning i en 0,5 mL sprøjte med en 30 G kanyle i en laminar air flow.
  2. Vejer C57Bl/6 hunmus (seks til 10 uger gammel) og beregne mængden af LP'ER, der vil blive injiceret: 10 µL (2 µg) /g kropsvægt.
    Bemærk: For eksempel, hvis en mus vejer 20 g, så 20 g x 10 µL = 200 µL LP'ER arbejder løsning skal injiceres.
  3. Håndtere musen forsigtigt men fast og begrænse dyret i den ene hånd. Sikre, at dyret er i stand til at trække vejret normalt, men ikke til at vride og vende under tilbageholdenhed.
  4. Vippe mus næsen lidt mod gulvet at eksponere maven til injektion. Find midterlinjen af maven og injektion sted i den lave del af maven, venstre eller højre fra midterlinjen. Tilføre kontrol mus i.p. PBS i stedet for LP'ER.
  5. Med den frie hånd, injicere den passende volumen (volumen beregnet i trin 2.2) af LP'ER arbejder løsning. Kontroller, at nålen har indtastet bughulen som ellers mis injektioner i mavemuskel lag kan forekomme. Stadig, ikke går for dybt med nålen i bughulen at undgå sårede indre organer beliggende i dette område.
  6. Returnere dyret forsigtigt til bur med op til 5 mus pr. bur.

3. overvåge mus

  1. Overvåge dyrene på tidspunktet for indsprøjtning og hver 2 timer efter injektion til 8 h for forekomsten og sværhedsgraden af endotoxemia. Derfor bruge en score ark (tabel 1), der er blevet tilpasset fra en tidligere udgivne manuskript 24.
  2. Score LP'ER injiceres mus for følgende parametre i tabel 1 anførte
    1. Check for udseendet af de skind, som er normalt glat. Hvis fur synes oppustede, pjusket og strittende pels, som angiver ubehag og/eller smerter, score dem som 1, 2 eller 3.
    2. Check for aktiviteten af musen.
      Bemærk: Mus flytte normalt frit rundt i hele buret spise, drikke, klatring, men undertrykt eller begrænset aktivitet kunne være et tegn på smerte.
    3. Kontroller, om niveauet af bevidsthed.
      Bemærk: Mus er meget nysgerrige, og de bevæger sig normalt rundt i buret ved at undersøge det omkringliggende. Manglende eller nedsat bevægelse kan foreslå smerter og ubehag.
    4. Kontrollere øjne.
      Bemærk: Fuldt åbne øjne forventes i sund mus, men helt eller delvist lukkede øjne, eventuelt med sekretion, kan være en indikation af smerte.
    5. Check for åndedræt satsen.
      Bemærk: Sund mus har normalt en normal og hurtige åndedræt sats, en nedsat åndedræt sats kunne være en indikation af ubehag).
    6. Check for respiration kvalitet.
      Bemærk: Besværet vejrtrækning med eller uden gispende er et tegn på smerte.

4. væv prøveudtagning for ribonukleinsyre (RNA) udvinding og homogenisering

  1. Forberede indsamling/homogenisering rør: tilføje 1 mL trinvis RNA isolering reagens til 2 mL rør udfyldes på forhånd med 1,4 mm keramiske kugler.
  2. På passende tidspunkt punkter (før (0 h) og 2, 4 og 8 h efter LPS injektion) aflive mus med bedøvelsesmiddel overdosis (isofluran) efterfulgt af exsanguination og fortsætte med dissektion.
  3. Skær huden og muskel lag udsætter bughulen med de indre organer med en saks.
  4. Omhyggeligt dissekere milten, leveren og kolon, rense organer fra fedt og holde dem i PBS på is.
  5. Klip et lille stykke (ca 0,5 cm lang) fra hver orgel ved hjælp af saks eller skalpel.
    Bemærk: Det er vigtigt at altid tage stykke fra cirka den samme del af orglet i hver mus (samme lap af leveren, proksimale eller distale del af tyktarmen).
  6. Snart tør væv på et stykke papir væv og placere den i den samling/homogenisering tube og sørg for, at det er helt nedsænket i RNA isolering reagens.
  7. Homogeniseres væv i en højhastigheds benchtop homogeniseringsapparat. Til bløddele som milten, leveren og kolon bruge 1 cyklus af homogenisering på speed 6,00 til 30 s.
  8. Inkuber prøver for 5 min ved stuetemperatur.
  9. Omhyggeligt placere røret i de flydende kvælstof til snap fryse vævet lysate. Gemme snap frosne lysate ved-80 ° C indtil RNA isolering.

5. RNA udvinding fra væv

Bemærk: RNA isolering reagenser, kloroform og alkoholer betragtes som farligt materiale. Udføre RNA udvinding under en kemisk hætte. Bruge certificeret fri for RNase reagenser og udstyr til at opretholde en RNase-frit miljø.

  1. Faseadskillelse
    1. Optø frosne vævet lysate på is.
    2. Der centrifugeres prøve på 1.000 x g i 5 min. ved 4 ° C at sammenpresse de resterende væv partikler, der måtte være tilbage.
    3. Overføre supernatanten til en ny nukleasen-fri 1,5 mL tube.
    4. Tilføje 200 µL iskold chloroform per 1 mL RNA isolering reagens og rystes kraftigt med Haanden for 10-15 s.
    5. Der inkuberes i 2-3 min. ved stuetemperatur.
    6. Centrifuge på 12, 000 x g i 15 min. ved 4 ° C.
      Bemærk: Prøven vil nu indeholde 3 faser: lavere røde phenol-chloroform fase, interphase og den øverste farveløse vandig fase. RNA er til stede i den øverste vandfasen.
    7. Indsamle øverste vandfasen (50% af det samlede volumen) og overførsel til en ny nukleasen-fri 1,5 mL tube.
  2. RNA nedbør
    1. Tilsæt 0,5 mL iskold isopropanol per 1 mL RNA isolering reagens og bland forsigtigt ved at vende røret 5 - 6 gange.
    2. Der inkuberes i 10-15 min. ved stuetemperatur.
    3. Der centrifugeres ved 12.000 x g i 10 min. ved 4 ° C.
      Bemærk: RNA pellet skal være synlig på dette stadium.
  3. Oprensning af RNA pellet
    1. Helt Fjern supernatanten indeholdende isopropanol uden at forstyrre pelleten.
    2. Vask pellet med 1 mL iskold 75% ethanol pr. 1 mL RNA isolering reagens, der anvendes for den indledende lysering.
    3. Vortex prøven kort.
    4. Prøven på 7.500 (eller 12.000) x g der centrifugeres i 5 min. ved 4 ° C.
  4. Opløse RNA
    1. Helt ophæve ethanol i supernatanten uden at forstyrre pelleten.
    2. Forlade åbnede røret under den kemiske hood for 3-5 min at lufttørre RNA pellet ved stuetemperatur (ikke over tør som i så fald vil det være vanskeligt at opløse RNA).
    3. Opløses RNA pellet i 20-50 µL nukleasen-gratis vand ved pipettering forsigtigt op og ned.
    4. Inkuber prøve ved 55 ° C i 10-15 min til yderligere at forbedre løsningen af RNA.
      Bemærk: På dette stadium, RNA kan opbevares ved-80 ° C indtil videre analyse.

6. fordøjelse af resterende DNA

  1. Måle RNA-koncentrationen med et spektrofotometer når der afpipetteres en alikvot del (2 µl) i spektrofotometrets og tilpasse sig til den anbefalede koncentration.
  2. Begynd fordøjelsen af kontaminerende DNA med max. 10 µg RNA i 50 µL nukleasen-gratis vand.
  3. Tilføje 0,1 volumen af 10 x DNase jeg Buffer og 1 µL rDNase jeg pr. prøve og bland forsigtigt af pipettering op og ned.
  4. Der inkuberes ved 37 ° C i 20-30 min.
  5. Vortex DNase inaktivering reagens og tilføje 0,1 volumen til prøven blandes godt med en pipette.
  6. Inkuber i 5 min. ved stuetemperatur blanding lejlighedsvis i hånden.
  7. Der centrifugeres ved 10.000 x g for 1,5 min.
  8. Overføre supernatanten der indeholder DNA-fri RNA ind i nye nukleasen-fri rør.
  9. Måle RNA koncentrationen og kvaliteten af Spektrofotometer.

7. omvendt transkription

  1. Bruge en kommercielt tilgængelig deoxyribonukleinsyre cDNA reverse transkription (RT) kit til reverse transkription.
    Bemærk: Her, op til 2 µg af RNA kan vendes transskriberede.
  2. Beregne den diskenhed, som indeholder 2 µg RNA. Der afpipetteres 2 µg RNA i en ny PCR rør.
  3. Tilføje nukleasen-gratis vand til prøven i PCR rør til den endelige mængden af 10 µL.
  4. Forberede 2 x Master Mix ved at blande følgende komponenter vises i tabel 2
  5. Tilsæt 10 µL 2 x Master Mix til 10 µl RNA til at opnå 1 x Master Mix i sammentællingen af rumfanget af 20 µL.
  6. Luk polymerase kædereaktion (PCR) rør og spin-ned prøven kort.
  7. Placere prøverne i en PCR Thermocycler og angive de indstillinger, der er anført i tabel 3.
  8. Gemme den genererede cDNA ved-20 ° C for yderligere analyse.

8. kvantitativ PCR (qPCR)

  1. Udføre qPCR reaktion med et kommercielt tilgængeligt kit.
  2. Selvstændig designe og teste de intron-spænder primere, før brug, med forskellige koncentrationer af skabelon cDNA. Analysere effekten af primeren ved at oprette en standardkurve og bruge primere med høj effektivitet og rette smeltende kurver.
    Bemærk: Sekvenser af primere, der anvendes i dette eksperiment er angivet i tabel 2.
  3. Forberede den kvantitative polymerase kæde reaktion (qPCR) reaktion i 384-godt plade med reaktion konfigurationen som beskrevet i tabel 4.
  4. Holde alle løsninger og plade på is ved hjælp af aluminiumsfolie for at forhindre pladen at blive våd når reaktionsblandingen er parat.
  5. Udføre alle reaktioner i tre.
  6. Udføre PCR reaktion på en thermocycler ved hjælp af indstillingen, der er anført i tabel 5.
  7. Beregn den gennemsnitlige Ct værdi for alle reaktioner fra tre. Normalisér alle mål gener til udtryk niveau af glycerinealdehyde-3-fosfat-dehydrogenase (Gapdh) husholdning gen ved at beregne 2^(-ΔCt).
    Bemærk: Alle mål gener med den gennemsnitlige Ct > 35 blev anset for at være under detektionsgrænsen.

Representative Results

Hen til efterligner følgerne for værten efter indgangen af bakterier eller bakteriel-afledte produkter, der opstår efter tarm barriere brud, LP'ER var injiceres i C57Bl/6 mus i en subletale dosis (2 µg/g kropsvægt). Hver enkelt mus blev overvåget og scorede for forekomst af endotoxemia med parametre, der er anført i score-arket, der indeholder, udseendet af mus, aktiviteten af dyrene, øjne, tilstand og åndedræt sats og kvalitet (tabel 1) . Dyrene viste kliniske tegn på sygdom, der toppede 6 til 10 h efter injektion af LP'ER og inddrevet inden for 24 timer (figur 1). Individuelle mus blev ofret 2 h, 4 h, og 8 h efter injektion af LP'ER. Væv stykker blev indsamlet fra milten, leveren og kolon. RNA er isoleret fra disse organer og omvendt transskriberet til cDNA. CDNA blev brugt som en skabelon for qPCR for at bestemme udtryk niveauer af Il6 (figur 2A) Il1b (figur 2B) TNFa (figur 2 c) og Il10 (figur 2D) med primere, der anvendes til qPCR angivet i tabel 6. Udtryk for Il6 toppede 2 h efter injektion i milten og tyktarmen og 4 h efter injektion i leveren. Udtryk for Il1b, TNFa, og Il10 toppede 4 h efter injektion i milten, leveren og kolon. Inden for 8 timer efter injektion, udtryk for Il6, Il1b, TNFa, og Il10 vendte tilbage til baseline niveauer.

Figure 1
Figur 1: LP'ER injektion (2 µg/g kropsvægt) induceret kliniske tegn på endotoxemia i C57Bl/6mice. Efter injektion af 2 µg/g kropsvægt af LP'ER, individuelle mus blev overvåget med sygdom score præsenteret i tabel 1, der omfatter udseende og aktivitet af dyrene, åbne deres øjne og deres åndedræt sats og kvalitet hver 2 h til 12 h og 24 h aft Øh LP'ER injektion. Sygdom score (y-aksen) blev renset for de respektive tid (x-akse). Betyde ± SD for 4-5 mus pr. hvert tidspunkt præsenteres. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: LP'ER injektion (2 µg/g kropsvægt) inducerer udtryk af pro-inflammatoriske cytokiner i C57Bl/6 mus. Mus blev sprøjtet med 2 µg/g kropsvægt af LP'ER og udtryk niveauer af Il6 (A), Il1b (B), Tnfa (C) og Il10 (D) blev analyseret af qPCR i milten, leveren og kolon på angivne tid point efter injektion. Cytokin udtryk niveauer blev alle normaliseret til ekspression af Gapdh. Betyde ± SD for 4-5 mus pr. hvert tidspunkt er vist. Venligst klik her for at se en større version af dette tal.

Tabel 1: sygdom score ark til at overvåge C57Bl/6 mus efter LPS injektion. Parametre, der overvåges efter LPS injektion. Dyr blev overvåget hver 2 timer efter injektion i en periode på 12 timer, og scorer blev givet for hver enkelt parameter angivet i tabellen. Den endelige score for hvert dyr udgør summen af alle individuelle scores. Dette er tilpasset fra reference24. Venligst klik her for at downloade denne fil.

Beløb Reagens
2 µL/prøve 10 x RT Buffer
0,8 µL/prøve 25 x deoxynucleotide (dNTP) Mix (100 mM)
1 µL/prøve RT tilfældige primere
4.2 µL/prøve nukleasen-frit vand

Tabel 2: Reagenser, der bruges til at forberede den master mix til reverse transkription.

Temperatur Tid
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C hold

Tabel 3: Thermocycler indstillinger bruges til reverse transkription.

Beløb Reagens
5 µL/brønd 2 x Master Mix
0,05 µL/brønd Reference farvestof
500 nM finalen/brønd fremad primer
500 nM finalen/brønd vende primer
mellem 10 og 100 brugte ng/nå, vi 40 ng/brønd skabelon cDNA fortyndet i en skabelon fortynding Buffer (1/100 fortynding af denne buffer lavet i nukleasen-gratis vand og anvendes til at fortynde skabelon cDNA). Fortynding skabelon i denne Buffer giver mulighed for visualisering af brøndene hvor skabelonen er tilføjet som reaktion farveændringer fra blå til grøn
nukleasen-gratis vand til endelige mængden af 10 µL/brønd nukleasen-frit vand

Tabel 4: Beskrivelse af PCR reaktionen.

Temperatur Tid
95 ° C 2 min
95 ° C 5 s 40 cykler
60 ° C 20 s
95 ° C 15 s smeltende kurve analaysis
60 ° C 1 min
95 ° C 15 s

Tabel 5: Thermocycler indstillinger bruges til PCR.

Primer Sekvens Smeltepunktet Produkt længde
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
Tnfa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
Tnfa-R AGGGTCTGGGCCATAGAACT 60
Gapdh-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
Gapdh-R CCTGTTGCTGTAGCCGTATT 58

Tabel 6: primere bruges i qPCR reaktion. Rækkefølgen af primere bruges til qPCR at finde musen cytokiner og husholdning gen Gapdh.

Discussion

Denne protokol efterligner immunologiske processer, der forekommer efter invasionen af mikrobielle-afledte produkter. Kritiske trin i protokollen er udvælgelsen af linjen mus, hygiejne status af mus, dosis af LP'ER, overvågning af dyrene til forekomsten af endotoxemia og tidspunkt for eksperiment ophør. Vigtigst, har den genetiske baggrund for musen stamme betragtes. Forskellige mus stammer har forskellig følsomhed over for LP'ER. For eksempel induceret C3H/HeJ og C57BL/10ScCr mus er resistente over for LPS endotoxemia21,25. Derudover kan hygiejne status af dyrene påvirke forløbet af endotoxemia i LPS. Specifikt patogenfri (SPF) dyr er mest almindeligt anvendt. Disse mus er gratis fra en fastlagt liste af patogener, men komplet mikrobiota sammensætningen af disse dyr er ikke kendt26,27. Sterile Kim-fri eller axenic dyr, (det ikke havnen en mikrobiota) er adskilt fra SPF mus26. Sandsynligt, kolonisering af axenic dyr med en mikroorganisme eller et konsortium af mikroorganismer (kimfri dyr) kan have indflydelse på udtrykket af gener, som IL-19, efter LPS injektion i forhold til SPF dyr8. Derudover er blevet foreslået en score ark, der blev brugt som en score ark for sepsis model induceret ved at indsprøjte den fækal løsning i bughulen24. Denne sheetcan skal drøftes med det lokale dyrevelfærd udvalget og kan tilpasses til de lokale behov. Navnlig kriterierne for opsigelse skal drøftes med det lokale dyrevelfærd udvalget. Dette eksperiment måtte stoppes, når en score > 12 er opnået, eller når den maksimale score for én enkelt parameter er nået. I dette eksperiment overskredet ingen dyr ud af otte dyr en sygdom score på 12 efter injektion af LP'ER (2 µg/g kropsvægt). I denne undersøgelse præsenteres resultaterne viser udtryk af cytokiner Il6, Il1b, TNFa og Il10 i leveren, milten og tyktarmen efter injektion af LP'ER. Udtryk for Il1b, TNFa og Il10 toppede 4 h efter LPS injektion i milten, leveren og kolon, hvorimod Il6 udtryk toppede 2 efter LPS injektion i milten og tyktarmen og 4 h efter LPS injektion i leveren. Inden for 8 h udtryk Il6, Il1b, TNFa og Il10 vendte tilbage til baseline niveauer i milten, leveren og kolon. Sygdommens sværhedsgrad toppede mellem 6 og 10 h efter LPS injektion da udtryk for Il6, Il1b, TNFa og Il10 har vendte allerede tilbage til baseline niveauer med angivelse, øget udtryk for Il6, Il1b, TNFa og Il10 opstår hurtigt efter LPS injektion, men at kinetik af andre gener kan vise et andet mønster efter LPS injektion. Udtryk for disse cytokiner kan også analyseres på protein-niveau i blodet af dyrene ved ELISA, som kan betragtes ud over qPCR.

Ændringer og fejlfinding af teknikken er nødvendige i tilfælde, når en sygdom score > 12 er nået. Dosis af LPS har derfor at blive reduceret og bedre tilpasset til linjen brugt mus og de lokale forhold at undgå for tidlig afslutning af forsøget. Manipulation af gener ved at slette en given genomisk region eller overekspression et gen kan påvirke modtageligheden af mus til LP'ER. I indledende forsøg, kan dosis af LP'ER titreres til den passende dosis til at undgå unødig skade og død for dyr i dette eksperiment. Af note, forurening af LP'ER med andre bakterielle-afledte produkter og mis injektioner skal undgås. Derudover skal kinetik af udtrykket af gener af interesse efter LPS injektion bestemmes.

Begrænsninger er at denne teknik giver oplysninger om konsekvenserne af udbredelsen af mikrobielle produkter til værten efter en tarm barriere brud, men vil ikke give oplysninger om begivenheder, der fører til intestinal barriere brud og årsager der udløser IBD. Selvfølgelig, denne model er ikke en colitis model som DSS colitis model, men det kan være nyttigt ud over colitis modeller at studere konsekvens af indgangen af mikrobielle produkter til værten. Derudover vil i.p. injektion af LP'ER forstyrre bughulen, hvor små og store tarmene er placeret. Dette kan lette omplantning af tarm-afledte bakteriel produkter fra bughulen i værten.

Betydningen af denne model er det faktum, det bruger en defineret PAMP. I andre modeller, herunder i.p. injektion af hele bakterier, i.p. injektion af fækal løsninger24 eller septisk peritonitis modeller, hvor peritonitis er foranlediget af cecal ligatur og punktering28, en bred vifte af mikrober eller deres produkter inducerer sygdom. Derudover injektion af LP'ER ind i musene er en ukompliceret tilgang og kræver ikke operation som i septisk peritonitis induceret af cecal ligatur og punktering.

Yderligere anvendelse af denne model er undersøgelser, der har til formål at undersøge endotoxemia eller LPS induceret sepsis i nogen sammenhænge karakteriseret ved omplantning af bakterier-afledte produkter i værten, som brud på hud barrieren eller tilsidesat af den urogenital tarmkanalen. Afslutningsvis, er dette en enkel model, der kan bruges i hvert laboratorium indstilling. Afhængigt af de lokale forhold, kan der være tilpasninger til de lokale behov. Navnlig har score-arket skal drøftes med de lokale myndigheder, før eksperimentet udføres. Denne metode blev brugt til at efterligne konsekvenser for værten, når bakterier eller bakteriel-afledte produkter indtaste vært efter barriere er blevet misligholdt. Dette kan være særlig relevant i studier undersøger grundlaget for IBD, hvor forekomsten af en tarm barriere brud er en fælles begivenhed i patologi af sygdommen.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

JHN understøttes af den schweiziske National Foundation (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics