Injektioner av lipopolysackarid i möss att efterlikna hänrycka av mikrobiella produkter efter tarmbarriären brott

Immunology and Infection
 

ERRATUM NOTICE

Summary

Här presenteras ett protokoll att efterlikna hänrycka av bakteriell-derived föreningar efter tarmbarriären brott. En låg subletala dos av lipopolysackarid injicerades systemiskt i möss, som övervakades under 24 h efter injektion. Uttrycket av pro-inflammatoriska cytokiner fastställdes vid flera tidpunkter i mjälten, levern och kolon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epitelial tarmbarriären separerar värden från den bakterieflora som normalt tolereras eller ignoreras. Brott mot denna barriär resulterar i ingången till bakterier eller bakterier-härledda produkter i den mottagande, tillgång till värd cirkulation och inre organ leder till okontrollerad inflammation som observerades hos patienter med inflammatorisk tarmsjukdom (IBD), som kännetecknas av en ökad intestinal epitelial permeabilitet.

För att efterlikna hänrycka av bakteriell-derived föreningar i mottagande, en endotoxemia modell har antagits i som lipopolysackarid (LPS), en komponent i yttre cellväggen av gramnegativa bakterier, skulle injiceras i möss. I denna studie en subletala dos av LPS injicerades intraperitonealt och mössen var därefter övervakas för 8 h använder en sjukdom poäng. Dessutom uttrycket nivåer av det inflammatoriska cytokiner Il6, Il1b, och Tnfa analyserades i mjälten, levern och kolon av qPCR vid olika tidpunkter efter LPS injektionen. Denna modell kan vara användbar för de studier som omfattar utredning av immunsvar efter invasionen av mikroorganismer eller bakteriell-härledda produkter som orsakas av en barriär överträdelse av kroppens ytor.

Introduction

Den mänskliga tarmen är koloniserade med ett stort konsortium av mikroorganismer som bildar den bakterieflora, som har utvecklat ett ömsesidigt givande förhållande med värden under utvecklingen. I denna relation ger värden ett säkert nisch för bakterieflora, medan bakterieflora ger vitaminer, näringsämnen matsmältning och skydd från patogener till värden, där bakterieflora finns1. När denna relation mellan mottagande och bakterieflora är störd, kan det framkalla sjukdomar, såsom inflammatorisk tarmsjukdom (IBD). IBD är en multifaktoriell kronisk inflammatorisk sjukdom i tarmen orsakad av genetiska och miljömässiga faktorer som förekommer i två stora former, Crohns sjukdom (CD) och ulcerös kolit (UC). Trots likheterna mellan de två IBD-formerna kännetecknas de av vissa skillnader i läge och typ av inflammatoriska ändringar. CD är en skovvis transmural inflammatorisk sjukdom som potentiellt kan utöka till någon del av mag-tarmkanalen, medan UC är icke-transmural och är begränsad till tjocktarmen. Mutationer i nukleotid-bindande oligomerisering domän-innehållande protein 2 (NOD2), en mönster erkännande receptor (PRR) som känner igen muramyl dipeptid (MDP), en komponent i cellväggen hos de flesta grampositiva och -negativa bakterier, är dessutom associerade med CD2. Escherichia coli (E. coli), Listeria och streptokocker och deras produkter var alla fann dessutom inom makrofager i CD-patienter som har angett värden efter en barriär bryter mot3. När bakterier eller deras produkter anger värden under utvecklingen av CD, utvecklar immunförsvaret ett svar som leder till produktion av cirkulerande anti-bakteriell antikroppar4. Kanske härstammar mest övertygande bevisen för rollen som bakterieflora i patogenesen av IBD från musmodeller. När djur behandlas med antibiotika, eller när möss hålls i bakteriefria (GF) förhållanden, reduceras svårighetsgraden av sjukdomen i de flesta kolit modeller, såsom i IL-10-/-möss som inte utvecklar kolit i GF faciliteter5,6. Dessutom stör kolit också sammansättningen av den bakterieflora, vilket kännetecknas av en obalanserad sammansättning och kortare rikedom som kallas dysbios7. Följden av IBD kan vara en ökad intestinal permeabilitet som kan leda till ingången av mikrober och mikrobiella produkter i värden.

Djur inducerar ansökan av Dextran natriumsulfat (DSS) en intestinal epitelial överträdelse leder till en ökad permeabilitet av epiteliala barriären8. Portalen är LPS förhöjda hos djur med DSS kolit9. Intressant, skyddas djur saknar den C typ lektin receptor specifika intracellulära vidhäftning molekyl 3 greppa nonintegrin homolog-relaterade 1 (tecken-R1) från DSS kolit och LPS-inducerad endotoxemia10. För att ytterligare sprida in värden, måste bakterier eller bakterier härledda produkter passera den vaskulära hinder11, i bukhålan, där små och stora inälvan är belägen, mesenteriala lymfkörtlar och/eller lever12. För att minska komplexiteten i detta system, användes en definierad bakteriell-derived förening. LPS, som orsakar endotoxemia efter intraperitoneal (IP) eller intravenös (i.v.) injektion13 injicerades i möss, att studera uttrycket av interleukin Il6 och Ilb och cytokin Tnfa svar på LP-skivor.

LPS är en patogen-associerade molekylära mönster (PAMP) uttryckt som en cell-vägg komponent av gramnegativa bakterier, som består av lipid A (den huvudsakliga PAMP i strukturen av LPS), en core oligosaccharide och en O sida kedja14. Toll-like receptor 4 (TLR4) uttryckt av dendritiska celler, makrofager och epitelceller erkänner LPS15, som kräver samtidig receptorer för lämplig bindning. Den akuta fasen protein LPS-bindande protein (LBP) binder LPS bildar ett komplex som överför LPS i klustret av differentiering 14 (CD14), en glycosylphosphatidylinositol-förankrade membranprotein. CD14 ytterligare transferservice LPS till lymfocyter antigen 96 eller också känt som MD-2, som är associerad med det extracellulära området av TLR4. Bindningen av LPS till MD-2 underlättar dimerization TLR4/MD-2 att framkalla konfirmerande förändringar att rekrytera intracellulära adapter molekyler för att aktivera nedströms signalering väg14, vilket inkluderar den myeloida differentiering primärt svar gen 88 (MyD88) - beroende väg och av TIR-domän-innehållande adapter-inducerande interferon-β (TRIF) - beroende väg16. Erkännande av LPS av TLR4 sedan aktiverar NF-κB vägen och inducerar uttryck av proinflammatoriska cytokiner, såsom TNFα, IL-6 och IL-1β17.

I synnerhet när LPS injiceras i djur, koncentrationen av LPS ges till djuren, måste den genetiska bakgrunden av djuret och diet beaktas. Höga koncentrationer av LPS leder till en septisk chock, kännetecknas av hypotoni och flera organ misslyckanden, och slutligen till döden18. Möss är mindre känsliga för LPS jämfört med människor, där LPS koncentrationerna mellan 2-4 ng/kg kroppsvikt (BW) är kunna inducera en cytokin storm19. För möss, den dödliga dosen (LD50), som inducerar död i hälften av möss spänner från 10-25 mg/kg Kroppsvikt20 beroende på mus stammen används. För vanliga mus stammar, C57Bl/6 och BALB/c, är den dödliga dos 50% (LD50) 10 mg/kg Kroppsvikt. Däremot skyddas stammarna C3H/HeJ och C57BL/10ScCr från LPS framkallade endotoxemia, som beror på mutationer i Tlr421. Tlr4-brist möss är följaktligen hyporesponsiv till injektioner med LPS22. Andra genetiskt modifierade mus linjer, såsom PARP1-/-möss23 är resistenta mot LPS-inducerad giftet chockar.

Musmodell som beskrivs använder här en subletala dos av LPS administreras systemiskt för att efterlikna konsekvenserna av LPS spridning efter en barriär överträdelse av kroppens ytor. Den valda LPS koncentrationen (2 mg/kg BW) inducerade inte dödlighet i C56Bl/6 möss, men inducerad frigöraren av pro-inflammatoriska cytokiner.

Protocol

Möss var föds upp och hålls särskilda villkor patogenfria (SPF) i djuranläggningen Institutionen för biomedicin, universitetar av Basel (Basel, Schweiz). Alla mus experimenten utfördes i enlighet med den schweiziska federala kantonala bestämmelser (animaliskt protokollnummer 2816 [Canton av Basel-Stadt]).

1. beredning av LPS lösning

  1. Öppna beståndet av LPS renats från Escherichia coli 0111:B4 under sterila förhållanden och rekonstruera det i vatten för att koncentrationen av 5 mg/mL.
  2. Späd LPS beståndet med den steril fosfatbuffrad saltlösning (PBS) till den arbetande koncentrationen av 0.2 µg/µL.

2. intraperitoneal injektion av LPS till möss

  1. Aspirera LPS arbetar lösning i en 0,5 mL spruta med en 30 G nål i ett laminärt luftflöde.
  2. Väga kvinnliga C57Bl/6 möss (sex till 10 veckors ålder) och beräkna mängden LPS som injiceras: 10 µL (2 µg) / g kroppsvikt.
    Obs: till exempel om en mus väger 20 g, då 20 g x 10 µL = 200 µL LPS arbetar lösning behöver injiceras.
  3. Hantera musen försiktigt men bestämt och hindrar djuret i ena handen. Se till att djuret kan andas normalt men inte att vrida och vända under fasthållningsanordningen.
  4. Tilt mus näsan lite mot golvet för att utsätta magen för injektion. Leta upp mittlinjen av buken och injektion plats i låg buken vänster eller höger från mittlinjen. Injicera kontroll möss i.p. PBS istället för LPS.
  5. Med den fria handen, injicera den lämpliga volymen (den volym som beräknades i steg 2.2) av LPS arbetar lösning. Kontrollera att nålen har gått in i bukhålan annat, mis injektioner i magmuskelstation lagret kan uppstå. Fortfarande, inte gå för djupt med nålen in i bukhålan att undvika skadar inre organ i det området.
  6. Tillbaka djuret noga till buren med upp till 5 möss per bur.

3. övervaka möss

  1. Övervaka djuren vid tidpunkten för injektion och varje 2 h efter injektionen i 8 h för förekomsten och svårighetsgraden av endotoxemia. Använd därför ett poängark (tabell 1) som har anpassats från en tidigare publicerade manuskript 24.
  2. Poäng LPS injicerade mössen för följande parametrar anges i tabell 1
    1. Kontrollera utseendet på pälsen som är normalt slät. Om pälsen visas ruggig, taggiga eller puffy päls som visar obehag eller smärta, Poäng dem som 1, 2 eller 3.
    2. Kontrollera om aktiviteten av musen.
      Obs: Möss röra normalt sig fritt runt hela buren äta, dricka, klättring, men undertryckta eller begränsad aktivitet kan vara ett tecken på smärta.
    3. Kontrollera nivån på medvetandet.
      Obs: Möss är mycket nyfikna och de flytta normalt runt buren undersöker omgivningen. Brist på eller nedsatt rörlighet kan föreslå smärta och obehag.
    4. Kolla ögonen.
      Obs: Fullt öppna ögon förväntas i friska möss, men helt eller delvis slutna ögon, eventuellt med sekretion, kan vara ett tecken på smärta.
    5. Kontrollera respirationshastighet.
      Obs: Friska möss har oftast en snabb och normal respiration klassar, en minskad respiration klassar kan vara en indikation av obehag).
    6. Kontrollera andning kvaliteten.
      Obs: Ansträngd andning med eller utan kippar är ett tecken på smärta.

4. vävnad provtagning för ribonukleinsyra (RNA) utvinning och homogenisering

  1. Förbereda samling/homogenisering rören: Lägg till 1 mL steg RNA isolering reagens 2 mL rör förfyllda med 1.4 mm keramiska kulor.
  2. Vid lämpliga tidpunkter (innan (0 h) och 2, 4 och 8 h efter LPS injektion) avliva musen med bedövningsmedel överdosering (isofluran) följt av exsanguination och fortsätt med dissektion.
  3. Skär huden och muskellagrar utsätta bukhålan med de inre organen med en sax.
  4. Noggrant dissekera mjälten, levern och kolon, rengöra organ från fett och hålla dem i PBS på is.
  5. Klipp ut en liten bit (cirka 0,5 cm lång) från varje organ som använder sax eller skalpell.
    Obs: Det är viktigt att alltid ta bit från ungefär samma del av orgeln i varje mus (samma LOB i levern, proximala eller distala delen av tjocktarmen).
  6. Strax torka vävnaden på en bit papper vävnad och placera det i samling/homogenisering röret att göra säker på att det är helt nedsänkt i RNA isolering reagens.
  7. Homogenisera vävnaden i en höghastighets bänkmonterade Homogenisatorer. För mjuka vävnader som mjälte, lever och kolon använda 1 cykel av homogenisering hastighet 6,00 för 30 s.
  8. Inkubera proverna för 5 min i rumstemperatur.
  9. Noggrant placera röret i det flytande kvävet att knäppa frysa vävnaden lysate. Lagra fäst frysta lysate vid-80 ° C till RNA isolering.

5. RNA-extraktion från vävnad

Obs: RNA isolering reagenser, kloroform och alkoholer betraktas som farligt material. Utföra RNA-extraktion under en kemisk huva. Använd certifierade RNase-fri reagenser och utrustning för att upprätthålla en RNase-fri miljö.

  1. Fasseparation
    1. Tina frysta vävnaden lysate på is.
    2. Centrifugera provet på 1 000 x g under 5 minuter vid 4 ° C till pellet de kvarvarande vävnad partiklar som kan vara kvar.
    3. Överför supernatanten till en ny nuclease-fri 1,5 mL tub.
    4. Tillsätt 200 µL iskall kloroform per 1 mL RNA isolering reagens och skaka den kraftigt för hand för 10-15 s.
    5. Inkubera i 2-3 min i rumstemperatur.
    6. Centrifugera vid 12, 000 x g under 15 minuter vid 4 ° C.
      Obs: Urvalet kommer nu innehåller 3 faser: lägre röd fenol-kloroformfasens, interphasen och övre färglös vattenfasen. RNA är närvarande i övre vattenfasen.
    7. Samla in övre vattenfasen (50% av totala volymen) och överföring till en ny nuclease-fri 1,5 mL tub.
  2. RNA nederbörd
    1. Tillsätt 0,5 mL iskallt isopropanol per 1 mL RNA isolering reagens och blanda försiktigt genom att invertera röret 5 - 6 gånger.
    2. Inkubera i 10-15 min i rumstemperatur.
    3. Centrifugera vid 12 000 x g under 10 minuter vid 4 ° C.
      Obs: RNA pellets ska synas i detta skede.
  3. Tvättning av RNA pellet
    1. Helt ta bort supernatanten innehållande isopropanol utan att störa pelleten.
    2. Tvätta pelleten med 1 mL iskallt 75% etanol per 1 mL RNA isolering reagens används för inledande Lys.
    3. Vortex provet kort.
    4. Centrifugera provet vid 7500 (eller 12.000) x g under 5 minuter vid 4 ° C.
  4. Upplösning RNA
    1. Helt ta bort etanol i supernatanten utan att störa pelleten.
    2. Lämna öppnade tuben under kemiska huven för 3-5 min till lufttorka pelleten RNA vid rumstemperatur (inte över torka som i så fall blir det svårt att upplösa RNA).
    3. Upplösa RNA pelleten i 20-50 µL nuclease-fritt vatten vid pipettering försiktigt upp och ner.
    4. Inkubera provet vid 55 ° C i 10-15 min att ytterligare förbättra lösningen av RNA.
      Obs: I det här skedet-RNA kan lagras vid-80 ° C tills vidare analys.

6. matsmältning av återstående DNA

  1. Mätning av RNA-koncentrationen med en spektrofotometer med pipett en alikvot (2 µl) till spektrofotometern och anpassa sig till den rekommendera koncentrationen.
  2. Starta nedbrytning av kontaminerande DNA med max. 10 µg RNA i 50 µL nuclease-gratis vatten.
  3. Tillsätt 0,1 volym 10 x DNAS jag buffert och 1 µL rDNase jag per prov och blanda försiktigt genom pipettering upp och ner.
  4. Inkubera vid 37 ° C i 20-30 min.
  5. Vortex DNAS inaktivering reagens och tillsätt 0,1 volym blanda väl med pipetten.
  6. Inkubera i 5 min i rumstemperatur blandning ibland för hand.
  7. Centrifugera 10 000 x g för 1,5 min.
  8. Överför supernatanten innehållande DNA-fria RNA i nya nuclease-fri röret.
  9. Mät RNA-koncentrationen och kvalitet av spektrofotometer.

7. omvänd Transkription

  1. Använda ett kommersiellt tillgängliga deoxiribonukleinsyra cDNA omvänd Transkription (RT) kit för omvänd Transkription.
    Obs: Här, upp till 2 µg RNA kan återföras transkriberas.
  2. Beräkna volymen, som innehåller 2 µg RNA. Överför med pipett 2 µg RNA i en ny PCR-röret.
  3. Lägga till nuclease-fritt vatten i provet i PCR-röret till slutvolymen av 10 µL.
  4. Förbered 2 x Master Mix genom att blanda följande komponenter visas i tabell 2
  5. Tillsätt 10 µL 2 x Master Mix till 10 µl RNA att få 1 x Master Mix i den totala volymen av 20 µL.
  6. Stäng polymeras-kedjereaktion (PCR) röret och spinn ner provet kort.
  7. Placera proverna i en PCR termocykler och ange inställningarna som anges i tabell 3.
  8. Lagra den genererade cDNA vid-20 ° C för vidare analys.

8. kvantitativ PCR (qPCR)

  1. Utföra qPCR reaktionen med en kommersiellt tillgänglig kit.
  2. Själv utforma och testa intron-spänner primers, före användning, med olika koncentrationer av mallen cDNA. Analysera effekten av primern genom att skapa en standardkurva och använda primers med hög effekt och rätt smältande kurvor.
    Obs: Sekvenserna av primers används i detta experiment listas i tabell 2.
  3. Förbereda kvantitativa polymerasen kedjar reaktion (qPCR) reaktionen i plattan med 384 brunnar med reaktion setup beskrivs i tabell 4.
  4. Hålla alla lösningar och plattan på is med aluminiumfolie för att förhindra plattan att bli blöt när reaktionsblandningen är beredd.
  5. Utföra alla reaktioner i exemplar.
  6. Utföra PCR-reaktionen på en termocykler med inställningen som anges i tabell 5.
  7. Beräkna det genomsnittliga Ct-värdet för alla reaktioner från exemplar. Normalisera alla målgener till uttryck nivå av glycerinealdehyde-3-fosfat-dehydrogenas (Gapdh) städning gen genom beräkning av 2^(-ΔCt).
    Obs: Alla målgener med genomsnittliga Ct > 35 ansågs vara under detektionsgränsen.

Representative Results

För att efterlikna konsekvenserna för värden efter ingången av bakterier eller bakteriell-härledda produkter som uppstår efter tarmbarriären brott, injicerades LPS i C57Bl/6 möss i en subletala dos (2 µg/g kroppsvikt). Varje enkel mus var övervakas och gjorde för förekomsten av endotoxemia med parametrar i poängark som inkluderar utseendet på möss, aktiviteten av djuren, villkora av ögon, och respiration klassar och kvalitet (tabell 1) . Det för djuren visade kliniska tecken på sjukdom som nådde 6 till 10 h efter injektion av LPS och återvunnits inom 24 h (figur 1). Enskilda möss var offrade 2 h, 4 h och 8 h efter injektion av LPS. Vävnaden bitar samlades in från mjälten, levern och kolon. RNA var isolerade från dessa organ och omvänd transkriberas till cDNA. CDNA användes som mall för qPCR för att bestämma uttrycksnivåerna av Il6 (figur 2A) Il1b (figur 2B), TNFa (figur 2 c) och Il10 (figur 2D) med grundfärg som används för qPCR anges i tabell 6. Uttrycket av Il6 nådde 2 h efter injektion i mjälten och tjocktarmen och 4 h efter injektion i levern. Uttryck för Il1b, TNFa, och Il10 nådde 4 h efter injektion i mjälten, levern och kolon. Inom 8 h efter injektion återvände uttrycket av Il6, Il1b, TNFa, och Il10 till baslinjenivåer.

Figure 1
Figur 1: LPS injektion (2 µg/g kroppsvikt) inducerad kliniska tecken på endotoxemia i C57Bl/6mice. Efter injektion av 2 µg/g kroppsvikt av LPS, enskilda möss övervakades med sjukdom Poäng presenteras i tabell 1 som innehåller utseende och aktiviteten hos djuren, öppna sina ögon och deras respiration klassar och kvalitet varje 2 h för 12 h och 24 h aft er LPS injektion. Den sjukdom poängen (y-axeln) var utplånas till respektive tiden (x-axeln). Menar ± SD för 4-5 möss per varje tidpunkt presenteras. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: LPS injektion (2 µg/g kroppsvikt) inducerar uttryck av pro-inflammatoriska cytokiner i C57Bl/6 möss. Möss injicerades med 2 µg/g kroppsvikt av LPS och uttrycksnivåerna av Il6 (A), Il1b (B), Tnfa (C) och Il10 (D) analyserades av qPCR i mjälten, levern och kolon vid angiven tid punkter efter injektionen. Cytokin uttrycksnivåerna var alla normaliserade för Gapdhuttryck. Menar ± SD för 4-5 möss per varje tidpunkt visas. Klicka här för att se en större version av denna siffra.

Tabell 1: sjukdom poängark att övervaka C57Bl/6 möss efter LPS injektion. Parametrar som övervakas efter LPS injektion. Djur var övervakas varje 2 h efter injektion under en period av 12 h, och poängen gavs för varje enskild parameter som anges i tabellen. Slutresultatet för varje djur representerar summan av alla enskilda noter. Detta är anpassad från referens24. Vänligen klicka här för att hämta den här filen.

Belopp Reagens
2 µL/prov 10 x RT buffert
0.8 µL/sample 25 x deoxynucleotide (dNTP) Mix (100 mM)
1 µL/sample RT slumpmässiga grundfärger
4.2 µL/sample Nuclease-gratis vatten

Tabell 2: Reagenser som används för att förbereda huvudmixen för omvänd Transkription.

Temperatur Tid
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Håll

Tabell 3: Termocykler inställningarna som används för omvänd Transkription.

Belopp Reagens
5 µL per brunn 2 x Master Mix
0.05 µL per brunn Referens Dye
500 nM final/brunn Forward primer
500 nM final/brunn Reverse primer
mellan 10 och 100 använde ng per brunn, vi 40 ng/brunn mall cDNA utspätt i en mall förtunningsbuffert (1/100 utspädning av denna buffert var på nuclease-gratis vatten och används för att späda ut cDNA som mall). Att späda ut mallen i denna buffert tillåter visualisering av brunnarna där mallen läggs som reaktion färgen ändras från blå till grön
Nuclease-fritt vatten till slutvolymen av 10 µL per brunn Nuclease-gratis vatten

Tabell 4: Beskrivning av PCR-reaktionen.

Temperatur Tid
95 ° C 2 min
95 ° C 5 s 40 cykler
60 ° C 20 s
95 ° C 15 s smältande kurva analaysis
60 ° C 1 min
95 ° C 15 s

Tabell 5: Termocykler inställningar som används för PCR.

Primer Sekvens Smälttemperatur Produkt längd
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58,2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
Tnfa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
Tnfa-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Tabell 6: Primers används i qPCR reaktionen. Sekvensen av primers används för qPCR för att upptäcka musen cytokiner och städning gen Gapdh.

Discussion

Detta protokoll härmar immunologiska processer som inträffar efter invasionen av mikrobiella produkter. Kritiska steg inom protokollet är valet av raden mus, hygien status för mössen, dosen av LPS, övervakning av djuren för förekomsten av endotoxemia, och tidpunkten experiment uppsägning. Viktigast av allt, måste den genetiska bakgrunden av mus stammen beaktas. Annan mus stammar har olika känslighet för LPS. Exempelvis inducerad de C3H/HeJ och C57BL/10ScCr möss är resistenta mot LPS endotoxemia21,25. Hygieniska status av djuren kan dessutom påverka endotoxemia i LPS. Specifika-patogenfria (SPF) djur som oftast används. Dessa möss är fria från en definierad lista av patogener, men komplett bakterieflora sammansättningen av dessa djur är inte känt26,27. Sterila bakteriefria eller axenic djur (som inte att hysa en bakterieflora) skiljer sig från SPF möss26. Koloniseringen av axenic djur med en mikroorganism eller ett konsortium av mikroorganismer (gnobiotisk djur) kan sannolikt påverka uttrycket av gener, såsom IL-19, efter LPS injektion jämfört med SPF djur8. Dessutom har ett poängark föreslagits som användes som ett poängark för en sepsis modell induceras genom att injicera fekal lösningen i bukhålan24. Denna sheetcan diskuteras med utskottet för lokala djurens välbefinnande och kan anpassas till lokala behov. I synnerhet kriterierna för uppsägning måste diskuteras med utskottet för lokala djurens välbefinnande. Detta experiment måste att stoppas när en poäng > 12 uppnås eller när maximal poäng för en enskild parameter nås. I detta experiment översteg inget djur ur åtta djur en sjukdom Poäng 12 efter injektion av LPS (2 µg/g kroppsvikt). I denna studie presenteras resultaten visar uttrycket av cytokiner Il6, Il1b, TNFa och Il10 i levern, mjälten och tjocktarmen efter injektion av LPS. Uttryck för Il1b, TNFa och Il10 nådde 4 h efter LPS injektion i mjälten, levern och kolon, medan, Il6 uttryck nådde 2 h efter LPS injektion i mjälten och tjocktarmen och 4 h efter LPS injektion i levern. Inom 8 h uttrycket Il6återvände Il1b, TNFa och Il10 till utgångsnivåerna i mjälten, levern och kolon. Sjukdomens svårighetsgrad nådde mellan 6 och 10 h efter LPS injektion när uttrycket av Il6, Il1b, TNFa och Il10 har redan återvänt till baslinjenivåer som visar att ökat uttryck av Il6, Il1b, TNFa och Il10 sker snabbt efter LPS injektion, men att kinetiken för andra gener kan visa olika mönster efter LPS injektion. Uttrycket av dessa cytokiner kunde också analyseras på proteinnivå i blodet av djuren av ELISA, som kan anses förutom qPCR.

Ändringar och felsökning av tekniken är nödvändigt i fall när en sjukdom poäng > 12 nås. Dosen av LPS har därför minskat och bättre justeras till raden används mus och lokala förhållanden att undvika förtida upphörande av experimentet. Manipulering av gener genom ta bort en viss genomisk region eller överuttryck av en gen kan påverka känsligheten för möss att LPS. I preliminära experiment, kan LPS-dosen titreras till den lämpliga dosen att undvika onödig skada och död till djuren i detta experiment. Notera, förorening av LPS med andra bakterie-härledda produkter och mis injektioner måste undvikas. Dessutom måste kineticsen av uttrycket av gener av intresse efter LPS injektion fastställas.

Begränsningar är att denna teknik ger information om följderna av spridningen av mikrobiella produkter i värden efter en tarmbarriären brott men kommer inte att ge information om händelser som leder till tarmbarriären brott och orsaker att utlösa IBD. Naturligtvis, denna modell är inte en kolit modell som DSS kolit modell, men det kan vara bra förutom kolit modeller att studera följden av hänrycka av mikrobiella produkter in värden. Dessutom kommer den i.p.-injektionen av LPS störa i bukhålan, där små och de stora tarmarna är belägna. Detta kan underlätta på flyttning av intestinal bakteriella produkter från i bukhålan till värden.

Betydelsen av denna modell är att den använder en definierad PAMP. I andra modeller inklusive intraperitoneal injektion av hela bakterier, i.p. injektion av fekal lösningar24 eller septisk peritonit modeller, där peritonit framkallas av cecal ligering och punktering28, en mängd mikrober eller deras produkter framkallar sjukdom. Dessutom injektion av LPS i möss är ett okomplicerat förhållningssätt och kräver inte kirurgi som i septisk peritonit orsakas av cecal ligering och punktering.

Ytterligare tillämpning av denna modell är studier som syftar till att undersöka endotoxemia eller LPS inducerad sepsis i något sammanhang kännetecknas av translokationen av bakterier-härledda produkter i värden, såsom brott mot hudbarriären eller brutit mot den urogenital tarmkanalen. Sammanfattningsvis är detta en enkel modell som kan användas i varje laboratoriemiljö. Beroende på lokala förhållanden, kan det finnas lokala behov nödvändiga anpassningar. Särskilt måste bladet Poäng diskuteras med de lokala myndigheterna innan experimentet utförs. Denna metod användes för att efterlikna konsekvenser för värden när bakterier eller bakteriell-härledda produkter anger värden efter barriär har överträtts. Detta kan vara särskilt relevant i studier till grund för IBD där förekomsten av en tarmbarriären överträdelse är en vanlig händelse i patologi av sjukdomen.

Disclosures

Författarna har något att avslöja.

Acknowledgments

JHN stöds av schweiziska National Foundation (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics