Inyección de lipopolisacárido en ratones para imitar la entrada de productos derivados de microbios después de la ruptura de la barrera Intestinal

Immunology and Infection
 

ERRATUM NOTICE

Summary

Aquí se presenta un protocolo para imitar la entrada de compuestos derivados de bacterias después de la ruptura de la barrera intestinal. Una baja dosis subletal de lipopolisacárido se inyectó sistémica en ratones, que fueron supervisados para la inyección después de 24 h. La expresión de citoquinas proinflamatorias se determinó en varios puntos del tiempo en bazo, hígado y colon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La barrera epitelial intestinal separa el host de la microbiota que normalmente es tolerada o ignorada. Resultados de la violación de esta barrera en la entrada de bacterias o productos derivados de las bacterias en el host, acceso a la circulación de host y órganos internos, llevando a la inflamación incontrolada, como se observa en pacientes con enfermedad inflamatoria intestinal (EII), que se caracterizan por un aumento de la permeabilidad epitelial intestinal.

Para imitar la entrada de compuestos derivados de bacterias en el host, un modelo de endotoxemia ha sido adoptado en que lipopolysaccharide (LPS), un componente de la pared celular externa de bacterias Gram-negativas, fueron inyectadas en ratones. En este estudio, una dosis subletal de LPS se inyectó por vía intraperitoneal y los ratones fueron posteriormente monitoreados durante 8 h con un marcador de enfermedad. Además, la expresión se analizaron los niveles de las citoquinas pro-inflamatorias Il6, Il1b y Tnfa en bazo, hígado y colon por qPCR en diferentes puntos temporales post inyección de LPS. Este modelo puede ser útil para los estudios de investigación de la respuesta inmune después de la invasión de microorganismos o productos derivados de la bacteriana causados por una violación de la barrera de las superficies del cuerpo.

Introduction

El intestino humano es colonizado con un gran consorcio de microorganismos que forman la microbiota, que ha desarrollado una relación mutuamente beneficiosa con el anfitrión durante la evolución. En esta relación, el anfitrión ofrece un lugar seguro para la microbiota, mientras que la microbiota proporciona vitaminas, nutrientes digestión y protección contra agentes patógenos al host, donde la microbiota reside1. Cuando se altera esta relación beneficiosa entre el host y la microbiota, pueden desarrollar enfermedades, tales como enfermedad inflamatoria intestinal (EII). EII es una enfermedad inflamatoria crónica multifactorial del intestino causada por factores genéticos y ambientales que se presentan en dos formas principales, (CD) de la enfermedad de Crohn y colitis ulcerosa (Cu). A pesar de las similitudes entre las dos formas de EII, se caracterizan por ciertas diferencias en la ubicación y naturaleza de las modificaciones inflamatorias. CD es un desorden inflamatorio de recaída transmural que potencialmente se puede extender a cualquier parte del tracto gastrointestinal, mientras que la UC es no transmural y se limita a los dos puntos. Además, las mutaciones de nucleótido-Oligomerización dominio-que contienen proteína 2 (NOD2), un receptor de reconocimiento de patrón (PRR) que reconoce Muramil dipéptido (MDP), un componente de la pared celular de más bacterias Gram positivas y - negativo, es asociados con el CD2. Además, Listeria y estreptococos , Escherichia coli (e. coli)y sus productos todos se encontraron dentro de los macrófagos en pacientes con EC que han entrado en el host después de que una barrera de incumplimiento3. Cuando las bacterias o sus productos entran en el host durante el desarrollo del CD, el sistema inmunológico desarrolla una respuesta lleva a la producción de anticuerpos anti-bacterial4en circulación. Tal vez, la evidencia más convincente para el papel de la microbiota en la patogenia de la EII deriva en modelos de ratón. Cuando los animales son tratados con antibióticos, o cuando los ratones se mantienen en condiciones libres de gérmenes de (GF), la severidad de la enfermedad se reduce en la mayoría de los modelos de colitis, como de IL-10-/-ratones que desarrollan colitis en GF instalaciones5,6. Además, la colitis también perturba la composición de la microbiota, que se caracteriza por una composición desequilibrada y reducida riqueza llamada disbiosis7. La consecuencia de la EII puede ser un aumento de la permeabilidad intestinal que puede conducir a la entrada de microbios y productos derivados de microbios en el host.

En los animales, la aplicación de sulfato de sodio-dextrano (DSS) induce una infracción epitelial intestinal conduce a un aumento de la permeabilidad de la barrera epitelial8. Portal LPS concentraciones son elevadas en animales con DSS colitis9. Curiosamente, animales que carecen el C tipo lectina receptor adherencia intracelular específica molécula-3 ase nonintegrin relacionadas con homólogo 1 (señal-R1) son protegidos de colitis DSS y endotoxemia inducida por LPS10. Para difundir aún más en el huésped, bacterias o productos derivados de las bacterias tienen que pasar la barrera vascular11, la cavidad peritoneal, donde se encuentra el intestino pequeño y grande, los nodos de linfa mesentéricos y el hígado12. Para reducir la complejidad de este sistema, se utilizó un compuesto de origen bacteriano definido. LPS, que causa la endotoxemia después intraperitoneal (i.p.) o intravenosa (i.v.) inyección13 se inyectó en ratones, para estudiar la expresión de interleuquinas Il6 y Ilb y la citoquina Tnfa en respuesta a LPS.

LPS es un patrón asociado a patógenos molecular (PAMP) expresado como un componente de la pared celular de bacterias Gram-negativas, que consiste en lípido A (PAMP principal en la estructura del LPS), un oligosacárido núcleo y una O lado cadena14. Receptor de tipo Toll 4 (TLR4) expresadas por las células dendríticas, macrófagos y células epiteliales reconoce LPS15, que requiere de receptores de cooperación para el enlace apropiado. La fase aguda proteína de unión a LPS (LBP) une a LPS para formar un complejo que transfiere LPS al cluster de diferenciación 14 (CD14), una proteína de membrana glicosilfosfatidilinositol anclada. CD14 más lanzaderas LPS para antígeno de linfocito 96 o también conocido como el MD-2, que se asocia con el dominio extracelular de TLR4. La Unión del LPS a MD-2 facilita la dimerización del TLR4/MD-2 inducen cambios conformacionales para reclutar moléculas intracelulares adaptador para activar el downstream señalización vía14, que incluye la diferenciación mieloide primaria gen de respuesta 88 (MyD88) - camino del dependiente y el TIR dominio-que contienen adaptador induce interferón-β (TRIF) - dependiente de la vía16. El reconocimiento de los LPS por TLR4 activa la vía de NF-κB e induce la expresión de citocinas proinflamatorias, como el TNFα, IL-6 e IL-1β17.

En particular, cuando LPS se inyecta en animales, la concentración de LPS a los animales, el fondo genético del animal y la dieta tiene que ser considerado. Altas concentraciones de LPS conduce a un choque séptico, caracterizado por hipotensión y fallos múltiples del órgano y finalmente a muerte18. Ratones son menos sensibles al LPS comparados con los seres humanos, donde están capaces de inducir una tormenta del cytokine del19LPS las concentraciones entre 2-4 ng/kg de peso corporal (BW). Para los ratones, la dosis letal (DL50), que induce la muerte en la mitad de los rangos de ratones de 10-25 mg/kg BW20 dependiendo de la cepa de ratón utilizada. Para las cepas utilizadas ratón C57Bl/6 y BALB/c, la dosis letal 50% (DL50) es de 10 mg/kg BW. En contraste, las cepas C3H/HeJ y C57BL/10ScCr son protegidas de endotoxemia inducida por LPS, que es debido a mutaciones en Tlr421. En consecuencia, deficientes en Tlr4 ratones son hyporesponsive a las inyecciones con LPS22. Otras líneas de ratón modificados genéticamente, como PARP1/ratones23 son resistentes al choque tóxico inducida por LPS.

El modelo de ratón descrito aquí utiliza una dosis subletal de LPS administrado sistémicamente para imitar las consecuencias de la difusión de LPS después de una ruptura de la barrera de las superficies del cuerpo. La concentración de LPS solicitada (2 mg/kg BW) no indujo mortalidad en ratones C56Bl/6, pero la inducida por liberación de citoquinas proinflamatorias.

Protocol

Ratones fueron criados y mantenidos bajo libre de patógenos (SPF) condiciones específicas en el Animalario del Departamento de Biomedicina, Universidad de Basilea (Basilea, Suiza). Se realizaron todos los experimentos de ratón conformidad con el Federal suizo Cantonal (número de protocolo animal 2816 [Cantón de Basilea-Stadt]).

1. preparación de solución de LPS

  1. Abra el stock de LPS purificado de Escherichia coli 0111:B4 en condiciones estériles y reconstituir en agua a la concentración de 5 mg/mL.
  2. Diluir la acción de LPS con el tampón de fosfato estéril salino (PBS) a la concentración de trabajo de 0,2 μg/μl.

2. intraperitoneal inyección de LPS a los ratones

  1. Aspire los LPS solución diluida en una jeringa de 0.5 mL con una aguja de 30 G en un flujo de aire laminar.
  2. Pesar ratones C57Bl/6 mujeres (seis a 10 semanas de edad) y calcular la cantidad de LPS que se inyecta: 10 μl (2 μg) / g de peso corporal.
    Nota: por ejemplo, si un ratón pesa 20 g y 20 g x 10 μl = 200 LPS μl trabajo necesidades de solución para ser inyectada.
  3. Manejar el mouse con suavidad pero con firmeza y refrenar el animal en una mano. Asegúrese de que el animal es capaz de respirar normalmente pero no girar y girar durante la contención.
  4. Inclinación de la nariz del ratón ligeramente hacia el suelo para exponer el abdomen para la inyección. Busque la línea media del abdomen y el lugar de la inyección en el abdomen bajo izquierdo o derecho de la línea media. Inyectar la i.p. PBS en lugar de LPS en ratones de control.
  5. Con la mano libre, inyectar el volumen adecuado (el volumen calculado en el paso 2.2) de los LPS de solución. Asegúrese de que la aguja ha entrado en la cavidad peritoneal en caso contrario, pueden ocurrir mal las inyecciones en la capa del músculo abdominal. Todavía, no ir demasiado profundo con la aguja en la cavidad peritoneal para evitar lesionar órganos internos ubicados en esa zona.
  6. Volver cuidadosamente al animal a la jaula con 5 ratones por jaula.

3. Controle los ratones

  1. Controlar los animales en el momento de inyección y cada 2 h después de la inyección de 8 h para la ocurrencia y la severidad de endotoxemia. Por lo tanto, utilizar una hoja de puntuación (tabla 1) que ha sido adaptada de un manuscrito previamente publicados 24.
  2. Cuenta los ratones inyectados de LPS para los parámetros enumerados en la tabla 1
    1. Compruebe el aspecto de la piel que es normalmente suave. Si el pelo rizado, pelo spiky o hinchada que indica incomodidad o dolor, cuenta como 1, 2 o 3.
    2. Compruebe que la actividad del ratón.
      Nota: Ratones normalmente moverse libremente alrededor de la jaula todo comer, beber, subir, pero suprimida o restringida de la actividad podría ser un signo de dolor.
    3. Compruebe el nivel de conciencia.
      Nota: Los ratones son muy curiosos, y normalmente se mueven alrededor de la jaula, investigar los alrededores. Falta de o disminución del movimiento sugerir dolor y malestar.
    4. Revise los ojos.
      Nota: Ojos totalmente abiertos se espera que en los ratones sanos, pero ojos parcial o totalmente cerrados, posiblemente con la secreción, pueden ser un indicio de dolor.
    5. Compruebe que la tasa de respiración.
      Nota: Ratones sanos suelen tienen un ritmo de respiración normal y rápida, un ritmo de respiración reducido podría ser un indicio de malestar).
    6. Compruebe la calidad de la respiración.
      Nota: Respiración lenta con o sin jadear es un signo de dolor.

4. tejido muestreo para la extracción de ácido ribonucleico (ARN) y homogeneización

  1. Preparar los tubos de colección/homogeneización: Agregue 1 mL solo paso RNA aislamiento reactivo en tubos de 2 mL prellenada con esferas cerámicas de 1.4 milímetros.
  2. En los momentos apropiados (antes (0 h) y 2 h, 4 h y 8 h después de la inyección de LPS) eutanasia el ratón con sobredosis de anestésico (isoflurano) seguido de exsanguinación y proceder con la disección.
  3. Cortar la piel y la capa muscular exponiendo la cavidad abdominal con los órganos internos con un par de tijeras.
  4. Diseccionar el bazo, el hígado y el colon, la limpieza los órganos de la grasa y mantenerlos en PBS en el hielo.
  5. Corte un trozo pequeño (de unos 0,5 cm) de cada órgano mediante tijeras o bisturí.
    Nota: Es importante siempre tomar la pieza de aproximadamente la misma parte del órgano en cada ratón (mismo lóbulo de parte de hígado, proximal o distal del colon).
  6. Poco seco el tejido en un pedazo de papel tejido y colóquelo en el tubo de colección/homogeneización asegurándose de que está completamente inmerso en reactivo de aislamiento de RNA.
  7. Homogeneizar el tejido en un homogeneizador de alta velocidad de la mesa. Para los tejidos blandos como bazo, hígado y colon usan 1 ciclo de homogeneización a velocidad 6.00 para 30 s.
  8. Incubar las muestras durante 5 minutos a temperatura ambiente.
  9. Con cuidado coloque el tubo en el nitrógeno líquido para congelar el tejido lisado. Almacenar el resorte congelado lisado a-80 ° C hasta el aislamiento de RNA.

5. RNA extracción del tejido

Nota: Los reactivos de aislamiento de RNA, cloroformo y alcoholes se consideran como material peligroso. Realizar extracción de RNA bajo una campana química. Uso certificado libre de Rnasa reactivos y equipo para mantener un ambiente libre de Rnasa.

  1. Separación de la fase
    1. Descongelar el lisado de tejido congelado en el hielo.
    2. Centrifugar la muestra a 1.000 x g durante 5 min a 4 ° C para que sedimenten las partículas restantes de tejido que pudieran quedar.
    3. Transferir el sobrenadante a un nuevo tubo libre de nucleasa 1,5 mL.
    4. Añadir cloroformo helada de 200 μL por aislamiento de RNA de 1 mL Reactivo y agitar vigorosamente a mano s de 10-15.
    5. Incubar durante 2-3 min a temperatura ambiente.
    6. Centrifugar a 12, 000 x g durante 15 min a 4 ° C.
      Nota: La muestra ahora contiene 3 fases: inferior de rojo fenol-cloroformo fase, la interfase y la fase acuosa incolora superior. El ARN está presente en la fase acuosa superior.
    7. Recoger la fase acuosa superior (50% del volumen total) y la transferencia en un nuevo tubo libre de nucleasa 1,5 mL.
  2. Precipitación de RNA
    1. Agregar 0,5 mL isopropanol helada por 1 mL Reactivo de aislamiento de RNA y mezclar suavemente por inversión del tubo 5 - 6 veces.
    2. Incubar por 10-15 min a temperatura ambiente.
    3. Centrifugar a 12.000 x g durante 10 min a 4 ° C.
      Nota: El pellet de RNA debe ser visible en esta etapa.
  3. Lavado del pellet de RNA
    1. Eliminar completamente el sobrenadante que contiene el isopropanol sin perturbar el pellet.
    2. Lavar el pellet con etanol del de 75% helada 1 mL por 1 mL RNA aislamiento de reactivo utilizado para la lisis inicial.
    3. Vórtice la muestra brevemente.
    4. Centrifugar la muestra a 7.500 (o 12.000) x g durante 5 min a 4 ° C.
  4. Disolución de ARN
    1. Eliminar por completo el etanol en el sobrenadante sin perturbar el pellet.
    2. Dejar el tubo abierto debajo de la campana química 3-5 minutos secar el pellet de RNA en la temperatura ambiente (no demasiado seco, en ese caso va a ser difícil disolver RNA).
    3. Disolver el pellet de RNA en 20-50 μl libre de nucleasa de agua mediante pipeteo con cuidado hacia arriba y hacia abajo.
    4. Incubar la muestra a 55 ° C durante 10-15 min mejorar aún más la solución del ARN.
      Nota: En esta etapa, el RNA se puede almacenar a-80 ° C hasta su análisis posterior.

6. digestión del ADN restante

  1. Medir la concentración de RNA con un espectrofotómetro por pipetear una alícuota (2 μL) en el espectrofotómetro y ajustar a la concentración recomendada.
  2. Comenzar la digestión de la contaminación de ADN con max. 10 μg RNA en 50 μl de agua libre de nucleasa.
  3. Agregar 0.1 volumen de 10 x DNasa tampón y 1 μl rDNase I por la muestra y mezclar suavemente mediante pipeteo arriba y abajo.
  4. Incubar a 37 ° C durante 20-30 min.
  5. Reactivo de inactivación de DNasa de vórtice y añadir volumen 0.1 de la muestra mezclando bien con la pipeta.
  6. Incubar por 5 min a temperatura ambiente, mezclar de vez en cuando a mano.
  7. Centrifugar a 10.000 x g durante 1,5 minutos.
  8. Transferir el sobrenadante que contiene RNA DNA-libre en el nuevo tubo libre de nucleasas.
  9. Medir la concentración de RNA y la calidad de espectrofotómetro.

7. transcripción reversa

  1. Utilice un kit de transcripción inversa (RT) de cDNA ácido desoxirribonucleico comercialmente disponible para reversa de la transcripción.
    Nota: Aquí, hasta 2 μg de ARN puede revertirse transcrito.
  2. Calcular el volumen, que contiene 2 μg de RNA. Pipetear 2 μg de RNA en un nuevo tubo PCR.
  3. Añadir agua libre de nucleasa a la muestra en el tubo PCR hasta el volumen final de 10 μl.
  4. Preparar 2 x Master Mix mezclando los siguientes componentes enumerado en la tabla 2
  5. Añadir 10 μl de 2 x Master Mix a 10 μl de RNA para obtener 1 x Master Mix en el volumen total de 20 μl.
  6. Cerrar el tubo de reacción en cadena (PCR) polimerasa y el giro de la muestra brevemente.
  7. Coloque las muestras en un termociclador de PCR y establezca los ajustes enumerados en la tabla 3.
  8. Almacenar el cDNA generado a-20 ° C para su posterior análisis.

8. PCR cuantitativa (qPCR)

  1. Realizar la reacción de qPCR con un kit disponible comercialmente.
  2. Uno mismo-diseñe y pruebe los iniciadores del intrón-atravesar, antes de su uso, con diferentes concentraciones de cDNA de la plantilla. Analizar la eficacia de la cartilla mediante la creación de una curva estándar y los cebadores con alta eficacia y las curvas de fusión correcta.
    Nota: Las secuencias de los primers utilizados en este experimento se enumeran en la tabla 2.
  3. Preparar la reacción cuantitativa de polimerasa de reacción en cadena (qPCR) en la placa de 384 pozos con la configuración de la reacción que se describe en la tabla 4.
  4. Mantenga todas las soluciones y la placa de hielo usando papel de aluminio para evitar que la placa se humedezcan cuando se prepara la mezcla de reacción.
  5. Llevar a cabo todas las reacciones en triplicado.
  6. Llevar a cabo la reacción de PCR en un termociclador utilizando la configuración que se enumeran en la tabla 5.
  7. Calcular el valor medio de la Ct para todas las reacciones de los triplicados. Normalizar todos los genes de objetivo para el nivel de expresión de la glycerinealdehyde-3-fosfato-deshidrogenasa (Gapdh) gen housekeeping mediante el cálculo de 2^(-ΔCt).
    Nota: Todos los genes de la blanco con el Ct promedio > 35 considerados bajo límite de detección.

Representative Results

Para imitar las consecuencias para el huésped después de la entrada de bacterias o productos derivados de bacterias que se produce después de la ruptura de la barrera intestinal, LPS se inyectó en ratones C57Bl/6 en dosis subletal (2 μg/g de peso corporal). Cada ratón fue supervisado y anotó para la aparición de endotoxemia con parámetros enumerados en la hoja de puntuación que incluye, la aparición de los ratones, la actividad de los animales, la condición de los ojos y la tasa de respiración y de la calidad (tabla 1) . Los animales mostraron signos clínicos de la enfermedad que alcanzó su punto máximo de 6 a 10 h después de la inyección de LPS y recuperado dentro de 24 h (figura 1). Los ratones fueron sacrificado 2 h, 4 h y 8 h después de la inyección de LPS. Se recolectaron piezas de tejido de bazo, hígado y colon. RNA fue aislado de estos órganos y atrás transcrito a cDNA. El cDNA se utilizó como plantilla para qPCR para determinar los niveles de expresión de Il6 (figura 2A) Il1b (figura 2B), TNFa (figura 2) y Il10 (Figura 2D) con cebadores utilizados para la qPCR listados en la tabla 6. La expresión de Il6 alcanzó 2 h después de la inyección en el bazo y colon y 4 h después de la inyección en el hígado. La expresión de la Il1b, TNFa y Il10 alcanzó 4 h después de la inyección en bazo, hígado y colon. Dentro de las 8 h después de la inyección, la expresión de Il6, Il10 , Il1by TNFa, volvió a los niveles basales.

Figure 1
Figura 1: inyección de LPS (2 μg/g de peso corporal) inducida por signos clínicos de la endotoxemia en C57Bl/6mice. Después de la inyección de 2 μg/g de peso corporal de LPS, los ratones fueron supervisados con la puntuación de la enfermedad presentada en la tabla 1 que incluye el aspecto y la actividad de los animales, abriendo sus ojos y su tasa de respiración y calidad cada 2 h durante 12 h y 24 h de popa ER la inyección de LPS. La puntuación de la enfermedad (eje y) fue borrado en el tiempo respectivo (eje x). Promedio ± SD para 4-5 ratones por cada punto del tiempo se presenta. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: inyección de LPS (2 μg/g de peso corporal) induce la expresión de cytokines favorable-inflamatorios en ratones C57Bl/6. Ratones fueron inyectados con 2 μg/g peso de LPS y los niveles de expresión de Il6 (A), (B)de la Il1b , Tnfa (C) y Il10 (D) se analizaron por qPCR en bazo, hígado y colon en el tiempo indicado puntos después de la inyección. Niveles de expresión de citocinas se normalizan a la expresión de la Gapdh. Promedio ± SD para 4-5 ratones por cada punto del tiempo se muestra. Haga clic aquí para ver una versión más grande de esta figura.

Tabla 1: hoja de puntuación de enfermedades para controlar ratones C57Bl/6 después de la inyección de LPS. Parámetros que son monitoreados después de la inyección de LPS. Los animales fueron monitoreados cada 2 h después de la inyección durante un período de 12 horas, y decenas fueron dadas para cada parámetro individual indicado en la tabla. El puntaje final para cada animal representa la suma de todas las puntuaciones individuales. Esto es adaptado de la referencia24. Haga clic aquí para descargar este archivo.

Cantidad Reactivo de
2 μl/muestra 10 x Buffer de RT
0,8 μl/muestra 25 x Deoxinucleótidos (dNTP) Mix (100 mM)
1 muestra μl Primers al azar RT
Muestra de μl 4,2 agua libre de nucleasas

Tabla 2: Reactivos utilizan para preparar la mezcla principal para reversa de la transcripción.

Temperatura Tiempo
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Mantenga

Tabla 3: Configuración de Termociclador utilizado para transcripción reversa.

Cantidad Reactivo de
5 μL/pocillo 2 x Master Mix
ΜL/pocillo 0,05 Tinte de referencia
500 nM final/pozo primer avance
500 nM final/pozo revertir la cartilla
entre 10 y 100 ng/bien, utilizamos 40 ng/pozo plantilla cDNA diluido en un Buffer de dilución de plantilla (dilución 1/100 de este buffer era hecho en agua libre de nucleasas y diluir el cDNA de la plantilla). Diluir la plantilla en este Buffer permite la visualización de los pozos donde plantilla se añade como los cambios de color de la reacción de azul a verde
agua libre de nucleasas hasta volumen final de 10 μL/pocillo agua libre de nucleasas

Tabla 4: Descripción de la reacción de PCR.

Temperatura Tiempo
95 ° C 2 min
95 ° C 5 s 40 ciclos
60 ° C 20 s
95 ° C 15 s analaysis curva de fusión
60 ° C 1 min
95 ° C 15 s

Tabla 5: Configuración de Termociclador utilizado para PCR.

Cartilla de Secuencia de Temperatura de fusión Longitud del producto
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60.3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56.1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57.2
Il10-F ATCGATTTCTCCCCTGTGAA 56.2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56.1
TNFa-F CCACCACGCTCTTCTGTCTAC 60.4 103 bp
TNFa-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Tabla 6: iniciadores utilizados en la reacción de qPCR. La secuencia de los primers utilizados para qPCR para detectar ratón citoquinas y gen housekeeping Gapdh.

Discussion

Este protocolo imita procesos inmunológicos que se producen después de la invasión de productos derivados de microbios. Pasos críticos en el protocolo son la selección de la línea de ratón, el estado de higiene de los ratones, la dosis de LPS, el seguimiento de los animales para la aparición de endotoxemia y el momento de la terminación del experimento. Lo más importante, el fondo genético de la cepa de ratón ha de ser considerada. Cepas de ratón diferentes tienen diferente susceptibilidad a LPS. Por ejemplo, el C3H/HeJ y ratones C57BL/10ScCr son resistentes a LPS indujeron endotoxemia21,25. Además, el estado de higiene de los animales puede influenciar el curso de endotoxemia en LPS. Comúnmente se utilizan animales (SPF) libre de patógenos específicos. Estos ratones son de una lista definida de los agentes patógenos, pero la composición de la microbiota total de estos animales no se sabe de26,27. Animales libres de gérmenes o axénicos estériles (que no una microbiota) son diferentes de los de ratones SPF26. Probablemente, la colonización de animales axénicos con un microorganismo o con un consorcio de microorganismos (gnotobiótico animales) puede influir en la expresión de genes, tales como IL-19, después de la inyección de LPS comparada con animales SPF8. Por otra parte, una hoja de puntuación se ha sugerido que fue utilizado como una hoja de puntuación para un modelo de sepsis inducido por la inyección de la solución fecal en la cavidad peritoneal24. Este sheetcan ser discutido con el Comité de bienestar de los animales locales y puede ser adaptado a las necesidades locales. En particular, los criterios para la terminación debe ser discutido con el Comité de bienestar de los animales locales. Este experimento tuvo que suspenderse cuando se logra una puntuación > 12 o cuando se alcanza la máxima puntuación para cada uno de los parámetros. En este experimento, ningún animal de ocho animales superaron un marcador de enfermedad de 12 después de la inyección de LPS (peso corporal de 2 μg/g). En este estudio, mostrando la expresión de las citoquinas Il6, Il1by TNFa Il10 en el hígado, bazo y colon después de la inyección de LPS se presentan resultados. La expresión de Il1by TNFa Il10 alcanzó 4 h después de la inyección de LPS en bazo, hígado y colon, mientras que expresión Il6 alcanzó 2 h después de la inyección de LPS en el bazo y colon y 4 h después de la inyección de LPS en el hígado. Dentro de las 8 h la expresión Il6, Il1by TNFa Il10 regresaron a niveles basales en bazo, hígado y colon. Severidad de la enfermedad alcanzó su punto máximo entre 6 h y 10 h después de la inyección de LPS cuando la expresión de TNFa , Il6, Il1by Il10 han regresado ya a los niveles de referencia que indica que aumentó la expresión de Il6, Il1by TNFa Il10 ocurre rápidamente después de la inyección de LPS, pero que la cinética de otros genes puede mostrar un patrón diferente después de la inyección de LPS. La expresión de estas citoquinas también podría analizarse en el nivel de proteína en la sangre de los animales por ELISA, que puede ser considerada además de qPCR.

Modificaciones y la resolución de problemas de la técnica son necesarias en casos cuando se alcanza una puntuación > 12 de la enfermedad. Por lo tanto, la dosis de LPS tiene que ser reducido y mejor ajustados a la línea de ratón utilizado y las condiciones locales para evitar la terminación prematura del experimento. La manipulación de genes por borrar una región genómica o overexpressing un gen puede influir en la susceptibilidad de los ratones a LPS. En experimentos preliminares, la dosis de LPS puede titularse a la dosis apropiada para evitar daños innecesarios y la muerte a los animales en este experimento. De nota, contaminación de LPS con otros productos derivados de bacterias y mal las inyecciones debe evitarse. Además, la cinética de la expresión de genes de interés después de la inyección de LPS necesita ser determinado.

Limitaciones son que esta técnica proporciona información sobre las consecuencias de la difusión de productos microbianos en el huésped después de una ruptura de la barrera intestinal pero no dará información sobre los eventos que conducen a la ruptura de la barrera intestinal y a las causas desencadenan la enfermedad inflamatoria intestinal. Por supuesto, este modelo no es un modelo de colitis como el modelo de colitis DSS, pero puede ser útil además de modelos de colitis a estudiar la consecuencia de la entrada de productos microbianos en el host. Además, la inyección i.p. de LPS interrumpirá la cavidad peritoneal, en el que se encuentran el pequeño y el intestino. Esto puede facilitar la translocación de los productos bacterianos intestinales derivados de la cavidad peritoneal en el host.

La importancia de este modelo es el hecho que usa un PAMP definida. En otros modelos como la inyección intraperitoneal de enteras bacterias, la inyección intraperitoneal de soluciones fecal24 o los modelos de peritonitis séptica, en el cual peritonitis es inducida por el cecal la ligadura y la punción28, una amplia gama de microbios o sus productos induce la enfermedad. Además, la inyección de LPS en ratones es un enfoque sencillo y no requiere cirugía como en la peritonitis séptica inducida por la punción y la ligadura cecal.

Otro uso de este modelo son estudios que tienen como objetivo investigar la endotoxemia o LPS inducidas septicemia en cualquier contexto caracterizado por la translocación de los productos derivados de las bacterias en el host, como ruptura de la barrera cutánea o incumplido de la tracto urogenital. En conclusión, este es un modelo sencillo que puede ser utilizado en cada entorno de laboratorio. Dependiendo de las condiciones locales, puede haber adaptaciones a las necesidades locales necesarias. En particular, la hoja de puntuación tiene que ser discutido con las autoridades locales antes de realiza el experimento. Este acercamiento fue utilizado para imitar las consecuencias para el huésped cuando las bacterias o productos bacterianos derivados del host después de una ruptura de la barrera. Esto puede ser particularmente relevante en los estudios que examinan la base de la EII donde la ocurrencia de una violación de la barrera intestinal es un evento común en la patología de la enfermedad.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

JHN es apoyado por la Fundación Nacional Suizo (FNS 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics