Conversie van menselijke geïnduceerde pluripotente stamcellen (iPSCs) in functionele spinale en craniale motor neuronen met behulp van PiggyBac vectoren

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit protocol maakt een snelle en efficiënte omzetting van geïnduceerde pluripotente stamcellen in motorische neuronen met een wervelkolom of schedel identiteit, door buitenbaarmoederlijke expressie van transcriptiefactoren van afleidbaar piggyBac vectoren.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

We beschrijven hier een methode om functionele spinale en craniale motor neuronen te verkrijgen van menselijke geïnduceerde pluripotente stamcellen (iPSCs). Directe omzetting in motor neuron wordt verkregen door een buitenbaarmoederlijke expressie van alternatieve modules van transcriptiefactoren, namelijk Ngn2, Isl1 en Lhx3 (NIL) of Ngn2, Isl1 en Phox2a (NIP). NIHIL en NIP specificeren, respectievelijk, spinale en craniale motor neuron identiteit. Ons protocol begint met de generatie van gemodificeerde iPSC lijnen waarin nihil of NIP stabiel zijn geïntegreerd in het genoom via een piggyBac transposon vector. Expressie van de transgenen wordt vervolgens geïnduceerd door doxycycline en leidt, in 5 dagen, tot de omzetting van iPSCs in MN progenitoren. Latere rijping, voor 7 dagen, leidt tot homogene populaties van spinale of craniale MNs. Onze methode heeft verschillende voordelen ten opzichte van eerdere protocollen: het is zeer snel en vereenvoudigd; het vereist geen virale infectie of verdere MN isolatie; het maakt het genereren van verschillende MN sub-populaties (spinale en craniale) met een opmerkelijke mate van rijping, zoals blijkt uit de mogelijkheid om treinen van actiepotentialen brand. Bovendien kan een groot aantal motor neuronen worden verkregen zonder zuivering van gemengde populaties. iPSC-afgeleide spinale en craniale motor neuronen kunnen worden gebruikt voor in vitro modellering van Amyotrofische laterale sclerose en andere neurodegeneratieve ziekten van de motor neuron. Homogene motor neuron populaties kunnen vertegenwoordigen een belangrijke bron voor cel type specifieke drug screenings.

Introduction

Motor neuron (MN) degeneratie speelt een oorzakelijke rol bij menselijke ziekten, zoals amyotrofische lateraal sclerose (ALS) en spinale spieratrofie (SMA). Het opzetten van geschikte in vitro Cell modelsystemen die de complexiteit van de menselijke MN recapituleren is een belangrijke stap in de richting van de ontwikkeling van nieuwe therapeutische benaderingen. Geïnduceerde pluripotente stamcellen (iPSCs), die zijn begiftigd met opmerkelijke plurilineage differentiatie eigenschappen, zijn nu afgeleid van een aantal patiënten die getroffen zijn door motor neuron ziekten1,2. Extra iPSC lijnen die pathogene mutaties in verband met MN ziekten zijn gegenereerd door het bewerken van genen, te beginnen van de controle "gezonde" pluripotente stamcellen3. Deze lijnen vertegenwoordigen nuttige hulpmiddelen voor in vitro Disease modellering en drug screening, op voorwaarde dat passende methoden voor iPSC differentiatie in MNs beschikbaar zijn. De grondgedachte achter de ontwikkeling van deze methode is om de wetenschappelijke gemeenschap geïnteresseerd in MN ziekten met een snelle en efficiënte differentiatie protocol die aanleiding geven tot volwassen functionele MNs te bieden. Het eerste voordeel van deze methode is het tijdsbestek van de uitvoering. Een ander relevant punt van sterkte komt uit de afschaffing van om het even welke reinigingsstap. Ten slotte kan het protocol worden gebruikt om twee verschillende populaties van motorische neuronen te genereren.

De mogelijkheid van het genereren van verschillende subtypen van MNs is bijzonder relevant voor het modelleren van MN ziekten. Niet alle MN subtypen zijn even kwetsbaar in ALS en SMA en het begin van de symptomen in verschillende motor units sterk van invloed op de prognose. In ALS, spinale begin met symptomen die beginnen in de bovenste en onderste ledematen leidt tot de dood in ongeveer 3-5 jaar4. Omgekeerd, bulbaire begin, te beginnen met degeneratie van craniale MNs, heeft een slechtste prognose. Bovendien is het percentage van bulbaire begin significant hoger bij patiënten met mutaties in de RNA-bindende eiwitten FUS en TDP-43 dan bij personen met SOD1 mutaties5. Bijna de totaliteit van alternatieve MN differentiatie protocollen is gebaseerd op de activiteit van retinoic zuur (RA), die een spinale karakter verleent aan differentiëren iPSCs6,7,8. Dit beperkt de mogelijkheid van het bestuderen van intrinsieke factoren, die kunnen worden beschermend in specifieke MN subtypen9,10.

In overeenstemming met een eerdere werk in de muis embryonale stamcellen11, hebben we onlangs aangetoond dat in de menselijke iPSCs buitenbaarmoederlijke expressie van Ngn2, Isl1 en LHX3 (Nil) induceert een spinale MN identiteit, terwijl Ngn2 en Isl1 plus PHOX2A (NIP) specificeren craniale MNs12. We hebben dus ontwikkelde een efficiënt protocol, wat leidt tot de productie van menselijke MNs begiftigd met functionele eigenschappen in een 12 dagen turnaround. Het doel van deze methode is om, in een korte tijd en zonder de noodzaak voor de reiniging (bijv. door FACS), cel populaties zeer verrijkt voor MNs met spinale of craniale identiteit.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. onderhoud van de menselijke iPSCs

  1. Bereiding van matrix gecoate platen
    1. Dooi één 5 mL flacon van matrijs (Zie de lijst van materialen) bij 4 °c 's nachts. De originele matrijs voorraden komen op verschillende voorraad concentraties en de hoeveelheid wordt gemaakt volgens de verdunningsfactor die op het gegevensblad wordt vermeld, specifiek voor de individuele partij. Het is belangrijk om de flacon en de buizen ijskoud te houden om vroegtijdige geleer van de matrix te voorkomen. Doseer de matrix in de voor gekoelde cryobuizen op het ijs. Bevriezen ongebruikte fracties bij-20 °C.
    2. Plaats één hoeveelheid ijs voor ongeveer 2 uur om te ontdooien.
    3. Verdun de hoeveelheid matrix met 20 mL koude DMEM/F12 in een conische buis van 50 mL.
    4. Meng goed en verdeel 1 mL verdunde matrix in 35 mm schotels (equivalente hoeveelheden per oppervlakte van andere gerechten).
    5. Houd de afwas met verdunde matrix voor 1 h bij kamertemperatuur om coating mogelijk te maken.
      Opmerking: Gerechten, verzegeld met Parafilm, kunnen worden opgeslagen bij 4 °C voor maximaal 2 weken.
  2. Voor bereiding van de stockoplossing (20 ml) en 1x werk hoeveelheid van de zachte cel dissociatie reagens (Zie de lijst van materialen).
    1. Los poeder op 10 mg/mL in PBS (CA2 +/mg2 + gratis).
    2. Filter steriliseren door middel van een 0,22 μm filter membraan.
    3. Bereid 20 maal (1 mL per stuk) en bewaar bij-20 °C.
    4. Verdun vóór gebruik één hoeveelheid in PBS (CA2 +/mg2 + Free) tot 1 mg/ml (1x werk hoeveelheid).
      NB: 1x werk hoeveelheid kan maximaal 2 weken bij 4 °c worden opgeslagen.
  3. Passaging menselijke iPSCs.
    1. Voor aanvang: indien opgeslagen bij 4 °C, pre-warm matrijs-met een laag bedekte platen in de incubator bij 37 °C voor 20-30 min. pre-warm bij kamertemperatuur de hoeveelheid menselijk iPSC middel (Zie vereiste lijst van materialen). Pre-warm de DMEM/F12.
    2. Aspireren cultuurmedium.
    3. Spoel iPSCs met PBS (CA2 +/mg2 + gratis).
    4. Voeg 1x zachte dissociatie oplossing toe (0,5 mL voor een 35 mm schotel). Incubeer bij 37 °C tot de randen van de kolonies beginnen te losmaken van de plaat, gewoonlijk 3-5 min.
    5. Aspireren de zachte dissociatie oplossing, oplettend om iPSC kolonies niet los te koppelen.
    6. Was de cellen met DMEM/F12 (2 mL voor een 35 mm schotel) en aspireren wordt voorzichtig niet te ontkoppelen van de cellen. Herhaal deze stap nog een keer.
    7. Voeg humaan iPSC medium toe (1 mL voor een 35 mm schotel).
    8. Maak de kolonies voorzichtig los met een cel lifter en breng deze over naar een 15 mL Tube.
    9. Breek de cel bosjes voorzichtig door het pipetteren op en neer met een P1000 pipetter 3-4 keer.
    10. Aspireren de bovendrijvende uit de matrix beklede plaat (en).
    11. Zaad de cellen in het aangewezen cultuur volume van menselijk iPSC middel. De split ratio kan variëren van lijn tot lijn en is ongeveer 1:4-1:8. Verander het medium dagelijks.

2. generatie van NIL en NIP Afleidbaar iPSC lijnen

  1. Cel transfectie.
    1. Spoel de cellen met PBS (CA2 +/mg2 + gratis).
    2. Voeg cel dissociatie reagens toe (Zie de materiaallijst) (0,35 ml voor een 35 mm schotel) en Incubeer bij 37 °c tot enkele cellen gescheiden zijn (5-10 min).
    3. Voorzichtig complete cel scheiding door pipetten op en neer met een P1000 pipetter 3-4 keer.
    4. Verzamel in een 15 mL Tube en voeg PBS (CA2 +/mg2 + gratis) toe aan 10 ml. Tel de cellen.
    5. Pellet 106 cellen en opnieuw op te schorten in 100 l van buffer R (opgenomen in de cel Electroporation Kit, Zie tabel van materialen).
    6. Voeg plasmide DNA toe voor Transfectie: 4,5 μg van transponerende vector (epB-BSD-TT-NIL of epB-BSD-TT-NIP12) en 0,5 μg van piggyBac transposase plasmide13.
    7. Transfect met de cel Electroporation systeem (Zie tabel van materialen) volgens de instructies van de fabrikant en zoals eerder beschreven3 met de volgende parameters: 1.200 V spanning, 30 MS breedte, 1 puls. Zaad van de cellen in de menselijke iPSC medium aangevuld met 10 μM Y-27632 (ROCK-remmer, Zie tabel van materialen) in een 6 mm matrix-gecoate schotel.
  2. Selectie met antibiotica.
    1. Voeg twee dagen na transfectie 5 μg/mL blasticidin toe aan het kweekmedium.
    2. De meeste van de niet-transfected cellen zullen sterven binnen 48 h van blasticidin selectie. Houd de cellen in blasticidin gedurende ten minste 7-10 dagen te Counter-Selecteer de cellen die niet hebben geïntegreerd de transgenes in het genoom.
    3. Handhaaf stabiel transfected cellen als gemengde bevolking, die uit cellen met verschillend aantal genen en verschillende integratie plaatsen wordt samengesteld, of isoleert enige klonen.
    4. Bereid een extra schotel om te controleren op effectieve expressie van de transgenen, op 1 μg/mL doxycycline inductie, door RT-PCR met transgene-specifieke primers voor Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Omgekeerde: GAAGGGAGGAGGGCTCGACT), zoals eerder beschreven12.
    5. In dit stadium, bevriezen de voorraden van de roman NIL-en NIP-iPSC lijnen in bevriezend middel voor menselijke iPSCs (Zie lijst van materialen).

3. motor neuron differentiatie

  1. Scheid de cellen met het reagens van de cel dissociatie zoals beschreven (stappen 2.1.1.-2.1.3.). Verzamel gescheiden cellen in een 15 mL buis en Verdun met 5 volumes van DMEM/F12. Pellet de cellen en opnieuw op te schorten in de menselijke iPSC medium aangevuld met 10 μM ROCK-remmer. Tel de cellen en zaad op matrix-gecoate gerechten bij een dichtheid van 62.500 cellen/cm2.
  2. De dag na, vervang het medium met DMEM/F12, aangevuld met 1x stabiele L-glutamine analoog, 1x niet-essentiële aminozuur (NEAA) cel cultuur aan te vullen en 0,5 x penicilline/streptomycine, en met 1 μg/mL doxycycline. Dit wordt beschouwd als dag 0 van differentiatie. Op dag 1, vernieuw het medium en doxycycline.
  3. Op dag 2, verander het medium om Neurobasal/B27 medium (Neurobasal medium aangevuld met 1x B27, 1x stabiele L-glutamine analoog, 1x NEAA en 0,5 x penicilline/streptomycine), met 5 μM DAPT, 4 μM SU5402 en 1 μg/mL doxycycline (Zie tabel van materialen ). Vernieuw het medium en doxycycline elke dag tot dag 5.
  4. Dag 5: cellen dissociatie met cel dissociatie reagens (Zie de lijst van materialen).
    1. Spoel de cellen met PBS (CA2 +/mg2 + gratis).
    2. Voeg cel dissociatie reagens (0,35 mL voor een 35 mm schotel) en Incubeer bij 37 °C tot de gehele cel monolayer scheidt van de schotel. Merk op dat enkele cellen niet worden gescheiden tijdens de incubatie.
    3. Voeg 1 mL DMEM/F12 toe en verzamel de cellen in een buis van 15 mL.
    4. Voorzichtig complete cel scheiding door pipetten op en neer met een P1000 pipetter 10-15 keer.
    5. Voeg 4 mL DMEM/F12 toe en Tel de cellen.
    6. In dit stadium, bevriezen motor neuron progenitoren in cel bevriezing medium (Zie tabel van materialen), volgens de fabrikant instructies.
    7. Pellet de cellen en opnieuw op te schorten in neuronale medium (Neurobasal/B27 medium aangevuld met 20 ng/mL BDNF, 10 ng/mL GDNF en 200 ng/mL L-ascorbinezuur, Zie tabel van materiaals) aangevuld met 10 μM Rock-remmer.
    8. Zaad de cellen op poly-Ornithine/laminin-of alternatief op matrijs-met een laag bedekte steunen bij de dichtheid van 100.000 cellen/cm2. Gebruik µ-dia plastic steunen met polymeer dekglaasje (Zie lijst van materialen) voor immunokleuring analyse.
  5. Op dag 6, verander het medium met verse neuronale medium verstoken van ROCK-remmer. Op de volgende dagen, Vernieuw de helft van het medium om de 3 dagen. Het medium van de cultuur moet zeer zorgvuldig worden veranderd om detachement van de oppervlakte te verhinderen.

4. immunokleuring analyse

  1. Cel fixatie. Spoel de cellen met PBS (met CA2 +/mg2+) en incubeer voor 15 min in 4% Paraformaldehyde in PBS (met CA2 +/mg2 +) bij kamertemperatuur.
    Let op: Paraformaldehyde is giftig en verdacht om kanker te veroorzaken. Vermijd contact met huid en ogen en handvat onder een chemische rook kap.
  2. Permeabilize met PBS (met CA2 +/mg2 +) met 0,1% Triton X-100 voor 5 min bij kamertemperatuur.
  3. Incubeer voor 30 min bij kamertemperatuur in antilichaam blokkerende oplossing (ABS: 3% BSA in PBS met CA2 +/mg2 +).
  4. Incubeer voor 1 h bij kamertemperatuur met primaire antilichamen in ABS: anti-TUJ1 (1:1000; konijn) en anti-Oct4 (1:200; muis) of anti-PRAATJE (anti-choline Acetyltransferase; 1:150; geit). Zie de lijst van materialen.
  5. Incubeer voor 45 min bij kamertemperatuur met het aangewezen ezel secundaire antilichaam paar in ABS: anti-muis Alexa Fluor 647 (1:250), anti-konijn Alexa Fluor 594 (1:250) en anti-geit Alexa Fluor 488 (1:250). Zie de lijst van materialen.
  6. Incubeer in 0,4 μg/mL DAPI voor 5 min bij kamertemperatuur om kernen te labelen.
  7. Monteer de cellen met een bevestigings medium (Zie de materiaallijst) voorbeeld vorming bij een fluorescentiemicroscoop.

5. functionele karakterisering via flard-klem opnamen

  1. Bereid de HEPES-geëquilibreerd externe oplossing (NES) als volgt voor: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2, 2 mm MgCl2, 10 mm Hepes, en 10 mm glucose. Stel de osmolariteit tussen 290-300 mΩ. Stel de pH in op 7,3 met behulp van 1N NaOH en bewaar de oplossing bij 4 °C.
  2. Bereid de interne oplossing voor: 140 mM K-gluconaat, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm Hepes, 2 mm mg-ATP, 0,3 mm na-GTP. Pas de pH aan 7,3 met 1M KOH en controleer of de osmolariteit is ingesteld op ongeveer 290 mΩ. Bevriezen van de oplossing bij-20 °C in kleine fracties.
  3. Voor het uitvoeren van de experimenten, pre-warm de NES oplossing in een waterbad tot ongeveer 28-30 ° c.
  4. Trek enkele borosilicaatglas micropipetten (ID 0,86 mm; OD 1,5 mm) voorzien van een tip weerstand: 5-6 MΩ en vul met de intracellulaire oplossing alvorens in de pipet houder te monteren.
    Opmerking: Vergeet niet om chloride zilveren draden van de opname-elektrode en referentie-elektrode in bleekmiddel voor ten minste 30 min om een uniforme laag van AgCl op het draad oppervlak te vormen.
  5. Breng de Petri schaal in de opname kamer over en laat de kamer met de NES oplossing op 1-2 mL/min. Laat de stroom passeren een inline kachel ingesteld op temperatuur van 30 ° c om de oplossing warm te houden.
  6. Plaats elektrofysiologische opname kamer onder een rechte Microscoop. Record membraan stromingen met de patch-klem versterker en het verwerven van gegevens met een passende software.
  7. Open de software voor de versterker besturing en stel de signaal winst op waarde 1 en het Bessel-filter in op 10 kHz. Zorg ervoor dat het Bessel-filter 2,5 keer lager is dan de bemonsteringsfrequentie.
  8. Stel de experimentele protocollen voor spanning-klem en stroom-klem experimenten in de opname software.
  9. In het protocolinstelling, Tick episodische stimulatie-modus en stel de sampling frequentie op 25 kHz. Dan, ga naar de golfvorm tab en typ de spanning of de huidige stap amplitude en lengte als volgt.
  10. Voor de voltage-gated natrium stromingen, gebruik 15 spannings stappen (50 MS duur elk) van-100 mV tot + 40 mV (10 mV Increment). Voer het protocol na het opleggen van de gepatchte cel een holding potentieel van-60 mV via de versterker. Ook de voltage-gated kalium stromen worden opgeroepen door spannings stappen (250 MS duur elk) van-30 mV tot + 50 mV (10 mV Increment) die de opgenomen cel-40 mV.
  11. Voor het onderzoeken van de vuren eigenschappen van iPSC-afgeleid craniale en spinale MNs, de cellen van de klem, in stroom-klem wijze, bij een membraan potentieel van-70 mV en gebruik 4 huidige impulsen (1 s duur elk) van stijgende omvang (van + 20 pA aan + 80 pA; 20 pA toename).
  12. Verwerf voor elke cel voltage-geactiveerde stromen, opgeroepen vuren activiteit en drie passieve eigenschappen als gehele-cel capaciteit (cm), de weerstand van de celmembraan (RM) en rustend membraan potentieel (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Een schematische beschrijving van de differentiatie methode wordt weergegeven in Figuur 1. Human iPSCs (WT I lijn3) werden transfected met EpB-BSD-TT-Nil of EpB-BSD-TT-NIP, het genereren, op blasticidin selectie, stabiel en afleidbaar cel lijnen12, hierna aangeduid als iPSC-Nil en iPSC-NIP, respectievelijk. Onderscheidende cellen werden gekenmerkt voor de uitdrukking van de pluripotentie marker OCT4 en de pan-neuronale marker TUJ1. Immunokleuring analyse toonde uniforme expressie van OCT4 in alle cellen op dag 0, bij afwezigheid van TUJ1 positiviteit (Figuur 2a). Op dag 3, zagen we een sterke daling van het aantal OCT4-positieve cellen, gespiegeld door expressie van TUJ1 in een subset van differentiërende iPSCs (Figuur 2B). Op dag 5, werd geen uitdrukking van OCT4 waargenomen in de bevolking, die verenigbare uitdrukking van TUJ1 toonde en een neuronale morfologie (Figuur 2C) verwierf. Motor neuron progenitoren werden vervolgens gescheiden en opnieuw geplateerd voor verdere rijping. Na 7 dagen (12 dagen sinds dag 0), cellen uniform uitgedrukt TUJ1 en de volwassen motor neuron marker CHAT (Figuur 3). Vergelijkbare resultaten zijn verkregen met twee extra commerciële iPSC lijnen (Zie tabel van materialen), met dezelfde cultuur en differentiatie voorwaarden (aanvullende figuur S1 en aanvullende figuur S2). Zo ook aan nihil-geïnduceerde motor neuronen van de muis Ser's11, menselijke iPSCs GEÏNDUCEERD met nihil en NIP uitgedrukt lage niveaus van HOX transcriptiefactoren en kan worden patroon langs de rostro-caudale as met retinol zuur (aanvullende figuur S3 ).

Deze resultaten werden verkregen toen 62.500 cellen/cm2 werden gezaaid aan het begin van differentiatie en geïnduceerd met 1 μM doxycycline op dag 0. Dit resulteerde in de optimale concentratie van doxycycline om maximale inductie van de transgenen te bereiken zonder evidente toxiciteit voor de cellen (aanvullende figuur S4A). Na verwijdering van doxycycline op dag 5, werd de uitdrukking van de transgenen tot zwijgen gebracht (aanvullende figuur S4B). We hebben ook pilot experimenten uitgevoerd om de optimale dichtheid van de cellen op dit punt van het protocol vast te stellen. We hebben gemerkt dat het variëren van deze parameter in parallelle differentiatie experimenten verschillende uitkomsten leverde. Met de initiële dichtheid verlaagd tot 31.250 cellen/cm2, differentiatie was blijkbaar normaal, zoals geëvalueerd door het observeren van de cel morfologie. Nochtans, zagen wij weerstand tegen dissociatie bij dag 5 (sectie 3,4) en verminderde levensvatbaarheid in de verdere rijpingsfase. Omgekeerd, toen de aanvankelijke dichtheid van de cellen werd verhoogd tot 125.000 cellen/cm2, we waargenomen inefficiënte differentiatie, zoals beoordeeld door een gebrek aan overname van de typische neuron-achtige morfologie. Dit resulteerde in een gemengde populatie die slechts een kleine fractie van MNs, die zou moeten verdere zuivering (bijvoorbeeld door FACS). We hebben daarom vastgesteld dat de optimale dichtheid om een zuivere populatie van neuronale cellen te verkrijgen, in staat om te overleven in de cultuur voor meer dan twee maanden, is 62.500 cellen/cm2.

Vervolgens hebben we beoordeeld de functionele rijping van de iPSC nihil-afgeleide spinale motor neuronen door het karakteriseren van hun elektrofysiologische eigenschappen (Figuur 4), zoals eerder gemeld voor iPSC NIP-afgeleide craniale motor neuronen12. Op dag 7 van de MNs rijpings stap van het Protocol (Zie Figuur 1; totale tijd van differentiatie: 12 dagen) (Figuur 4A) werden in de spannings-en stroom-klem modaliteiten patch klem opnames uitgevoerd. Op dit moment punt, de iPSC nihil-afgeleide motor neuronen toonden een iets lager rust membraanpotentiaal (-30 ± 2 mV; n = 24) en een soortgelijke cel capaciteit waarde (+ 25 ± 2 pF; n = 25) in vergelijking met eerder gemeld iPSC NIP-afgeleide MNs12. Dan, om dieper te karakteriseren de mate van rijping van gedifferentieerde cellen, onderzochten we hun vermogen om natrium en kalium stromen op te roepen wanneer gestimuleerd met een reeks van Spanningspulsen. In deze experimenten, iPSC nihil-afgeleide neuronen met succes weergegeven voltage-afhankelijke natrium stromingen (Figuur 4B), en voltage-afhankelijke kalium stromen (Figuur 4C), het bereiken van piek amplitude wanneer geklemd op een membraanpotentiaal in de buurt van − 20 mV en + 50 mV, respectievelijk. Het evenwicht potentieel voor na+ en K+, berekend met behulp van de Nernst vergelijking (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) met de eerder gemelde extracellulaire en intracellulaire oplossingen, waren + 110 mV en-102 mV respectievelijk. Bovendien, de 80% van de iPSC nihil-afgeleide MNs geklemd in de huidige-klem modaliteit waren in staat om Spike treinen trigger wanneer geïnjecteerd met een huidige puls van + 60 pA of meer (Figuur 4D). De minimale stroom die nodig is om repetitieve vuren in meer dan 50% van de opgenomen cellen te lokken was + 40 pA (15 van de 18 cellen; Figuur 4 E). Spike drempel was-37,6 ± 0,8 MV en de gemiddelde afvuren frequentie op + 40 pa was ongeveer 7,9 ± 2,2 Hz (n = 18; Figuur 4 F).

Globaal, suggereren deze gegevens dat, zo ook aan eerder gemelde iPSC NIP-afgeleide craniale MNs12, IPSC-Nil-afgeleide spinale MNs functionele eigenschappen kenmerkend van rijpe neuronen hebben.

Figure 1
Figuur 1 : Motor neuron differentiatie protocol. De figuur toont een schematische weergave van het differentiatie protocol, van de generatie van stabiele iPSC lijnen met de piggyBac vectoren tot het tijdspunt van de functionele analyse die in de tekst wordt gerapporteerd. Representatieve fasecontrast beelden van de cellen bij verschillende stappen van het protocol worden getoond. Schaal staven = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Representatieve immunokleuring analyse van differentiërende cellen. iPSC-nihil en iPSC-NIP cellen werden geanalyseerd door immunokleuring voor de expressie van de pluripotentie marker OCT4 (paars) en de pan-neuronale marker TUJ1 (rood) op dag 0 (a), dag 3 (B) en dag 5 (C). De kernen werden counterstained met DAPI. Confocale beelden werden verworven bij de laser scanning confocal microscoop (Zie tabel van materialen) met behulp van een 20x na 0,75 doelstelling met zoom 2x, 1024 x 1024 pixel, uitgerust met 405 nm, 473 nm, 559 nm en 635 nm lasers. Filter instelling voor DAPI, Alexa Fluor 594 en Alexa Fluor 647 werden gebruikt. Schaal staven = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Representatieve immunokleuring analyse van iPSC-afgeleide motor neuronen. iPSC-nihil en iPSC-NIP cellen werden geanalyseerd door immunokleuring voor de expressie van de pan-neuronale marker TUJ1 (rood) en de motor neuron marker CHAT (choline acetyltransferase; groen) op dag 12. De kernen werden counterstained met DAPI. Confocale beelden werden verworven zoals beschreven in Figuur 2 legende. Schaal staven = 50 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : Functionele analyse van spinale en craniale motor neuronen. (A) helderveld beeld van de hele cel patch klem op iPSC nihil-afgeleide spinale motor neuron. (B) representatieve I/V-curve voor na+ stroom geregistreerd in iPSC nihil-afgeleide MNs in reactie op een reeks van toenemende spannings stappen (n = 26; Holding potentiaal gelijk aan-60 MV). (C) representatieve I/V-curve voor K+ opgenomen in iPSC nihil-afgeleide MNs in reactie op een reeks van toenemende spannings stappen (n = 23; Holding potentiaal gelijk aan-40 mV). (D) representatieve spoor van een trein van actiepotentialen opgeroepen als reactie op een duurzame huidige injectie van + 60 pa. (E) histogram die het percentage van iPSC nihil-afgeleide MNs het opwekken van actiepotentialen bij elke huidige puls (n = 18). F histogram dat de opgeroepen vurenfrequentie weergeeft bij elke huidige puls (n = 18). Elektrofysiologische opname werd uitgevoerd onder een rechte Microscoop. De membraan stromingen opnamesysteem is aangegeven in de tabel van materialen. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplementary Figure 1
Aanvullend figuur S1: MN differentiatie met behulp van Episomal hiPSCs. (A) helderveld beelden van differentiëren Episomal HIPSC-nihil (links) en Episomal HIPSC-NIP (rechts) op de aangegeven tijdpunten. Schaal staven = 50 μm. (B) analyse van de expressie van de aangegeven merkers in het differentiëren van Episomal HIPSC-nihil (boven) en Episomal HIPSC-NIP (bodem) cellen door real-time QRT-PCR. Voor elke markeerstift is het tijdpunt met de hoogste expressie gebruikt als kalibratie monster. Primers gebruikt voor ISL1 zijn specifiek voor het endogene gen. (C) immunokleuring voor de pan-neuronale marker TUJ1 (rood) en craniale MN marker PHOX2B (groen) in gedifferentieerde (dag 6) Episomal HIPSC-nihil (links) en Episomal HIPSC-NIP (rechts) cellen. Kernen zijn counterstained met DAPI. Schaalbalk voor alle panelen: 50 μm. (D) analyse van de expressie van HB9 en PHOX2B in het differentiëren van Episomal HIPSC-nihil (boven) en Episomal HIPSC-NIP (bodem) cellen door real-time QRT-PCR. Dag 0 is gebruikt als kalibratie monster. PCR de inleidingen en de methodes worden gerapporteerd in de Santis et al., 201812. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplementary Figure 2
Aanvullende figuur S2: MN differentiatie met behulp van DS2U iPSCs. (A) helderveld beelden van differentiëren DS2U-nihil (links) en DS2U-NIP (rechts) op de aangegeven tijdpunten. Schaal staven = 50 μm. (B) analyse van de expressie van de aangegeven merkers in het differentiëren van DS2U-nihil (boven) en DS2U-NIP (bodem) cellen door real-time QRT-PCR. Voor elke markeerder is het tijdpunt met de hoogste expressie gebruikt als kalibratie monster. Primers gebruikt voor ISL1 zijn specifiek voor het endogene gen. (C) immunokleuring voor de pan-neuronale marker TUJ1 (rood) en craniale MN marker PHOX2B (groen) in gedifferentieerde (dag 6) DS2U-nihil (links) en DS2U-NIP (rechts) cellen. Kernen zijn counterstained met DAPI. Schaal staven = 50 μm. (D) analyse van de uitdrukking van HB9 en PHOX2B in het differentiëren van DS2U-nihil (boven) en DS2U-NIP (bodem) cellen door real-time QRT-PCR. Dag 0 is gebruikt als kalibratie monster. PCR de inleidingen en de methodes worden gerapporteerd in de Santis et al., 201812. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplementary Figure 3
Aanvullend figuur S3: HOX genexpressie. Aanalyse van de uitdrukking van vier verschillende HOX genen (HOX a2, HOX B1, HOX A4, HOX B5) na 5 dagen van differentiatie van IPSC-nihil en IPSC-nihil + Ra cellen door real-time QRT-PCR. IPSC-nihil op dag 0 is gebruikt als de kalibrator steekproef. (B) analyse van de uitdrukking van vier verschillende HOX genen (HOX a2, HOX B1, HOX A4, HOX B5) na 5 dagen van differentiatie van IPSC-NIP en IPSC-NIP + Ra cellen door real-time QRT-PCR. IPSC-NIP op dag 0 is gebruikt als de kalibrator steekproef. (C) PCR de paren van de inleiding. Klik hier om een grotere versie van dit cijfer te bekijken.

Supplementary Figure 4
Supplementair cijfer S4: doxycycline de analyse van de inductie. (A) analyse door real-time QRT-PCR van de expressie van exogene Ngn2 in IPSC-nihil (boven) en IPSC-NIP (bodem) cellen onbehandeld of gekweekt voor 24 h in aanwezigheid van doxycycline bij verschillende concentratie (0,5 μm, 1,0 μm, 2,0 μm). Ngn2 werd geanalyseerd met primers specifiek voor het exogene muis gen. De ouderlijke iPSC lijn, verstoken van nihil en NIP constructies, is opgenomen in de analyse als een controle. De uitdrukking van de transgenen in iPSC-NIL en iPSC-NIP was verwaarloosbaar in afwezigheid van doxycycline. iPSC-NIL en iPSC-NIP op dag 0 zijn gebruikt als kalibrator monsters. (B) analyse door real-time QRT-PCR van de expressie van exogene Ngn2 in het differentiëren van IPSC-nihil (links) en IPSC-NIP (rechts) cellen op de aangegeven tijdstippen van het protocol. Ngn2 werd geanalyseerd met primers specifiek voor het exogene muis gen. iPSC-NIL en iPSC-NIP op dag 0 zijn gebruikt als kalibrator monsters. PCR de inleidingen en de methodes worden gerapporteerd in de Santis et al., 201812. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dit protocol maakt het mogelijk om efficiënt te converteren menselijke iPSCs in spinale en craniale motor neuronen dankzij de buitenbaarmoederlijke expressie van Lineage-specifieke transcriptiefactoren. Deze transgenen worden afleidbaar door doxycycline en stabiel geïntegreerd in het genoom dankzij een piggyBac op transposon gebaseerde vector. In een gemengde populatie, zal een of meerdere exemplaren van de piggyBac vector willekeurig worden geïntegreerd in het genoom van de individuele cellen, het verhogen van het risico van genoom integriteit veranderingen. Bovendien kan een progressieve selectie van iPSC subklonen voorkomen in de tijd, met mogelijke gevolgen voor differentiatie en voor vergelijkende analyse van de ziekte en de controlecellen lijnen. Totaal, iPSC-afgeleide MNs verkregen met dit protocol zal ongeschikt zijn voor regeneratieve geneeskunde. Echter, onze methode kan bijzonder nuttig zijn voor in vitro motor neuron ziektemodel lering. Belangrijke punten van kracht worden vertegenwoordigd door de uiterst vereenvoudigde cultuuromstandigheden, de snelheid van MN conversie, de hoge mate van rijping van iPSC-afgeleide MNs en de mogelijkheid om zowel spinale en craniale MNs te verkrijgen, zoals eerder aangetoond door analyse van specifieke markergenen expressie12. De robuustheid van het protocol wordt aangetoond door de reproduceerbaarheid ervan. Tot nu toe hebben we met succes toegepast dit protocol meer dan 30 keer voor spinale en/of craniale MN generatie, de beoordeling van de resultaten door marker en/of functionele analyses. We hebben met succes gehandhaafd motor neuron culturen voor maximaal twee maanden zonder duidelijke daling van de levensvatbaarheid. Bovendien, zodra de stabiel transduced iPSC lijn is verkregen, elk experiment kan worden gestart door doxycycline inductie zonder de noodzaak van nieuwe transfectie. Virale vectoren zijn ook niet vereist. De hier gepresenteerde representatieve resultaten zijn verkregen door electroporating iPSCs met de cel Electroporation systeem aangegeven in de tabel van materialen. Andere Electroporation methoden kunnen echter alternatieve opties vertegenwoordigen. Omgekeerd, in onze ervaring, transfectie systemen op basis van lipofection zijn geen goede optie voor pluripotente stamcellen12. Cel populaties verkregen aan het einde van het proces zijn bijna uitsluitend samengesteld uit MNs, het vermijden van de noodzaak voor verdere zuivering (bijv. door FACS). Zoals we eerder toonde12, het protocol maakt het verkrijgen van 90% TUJ1-positieve cellen, waarvan 95% waar ook PHOX2B positief in NIP-afgeleide culturen.

We kunnen enkele kritische punten bedenken die nauwkeurig in aanmerking moeten worden genomen. Ten eerste is de kwaliteit van de initiële populatie van iPSCs van cruciaal belang om een homogene en consistente omzetting in MNs te garanderen. culturen die een substantieel deel van differentiatie (meer dan 5-10%) moet worden vermeden. We hebben het protocol met behulp van de menselijke iPSC medium beschreven in de tabel van materialen als het onderhoud medium voor niet-gedifferentieerde iPSCs. Andere in de handel verkrijgbare gedefinieerde media kunnen geldige alternatieve opties vertegenwoordigen, ondanks dat we dit punt in het huidige werk niet experimenteel hebben aangepakt. Aangezien de samenstelling van de media de proliferatie graad van de beginnende cel bevolking kan beïnvloeden, zou de aanpassing van het protocol aan andere onderhoudsmedia optimalisering van de aanvankelijke dichtheid bij dag 0 moeten vereisen. Na transfectie, is het belangrijk om cellen onder antibiotische selectie voor minstens 2 weken te houden om stabiele cel lijnen te verkrijgen. Het kan wenselijk zijn dat sommige toepassingen klonale lijnen afleiden na piggyBac integratie, om een meer homogene populatie te verkrijgen in termen van niveaus van transgene expressie en een betere controle van de integratie sites. Dichtheid van de cellen op dag 0, de tijd van doxycycline naast het medium, is een cruciale parameter. Zoals vermeld in de representatieve resultaten sectie, schatten we een optimale dichtheid van de cellen om de reproduceerbaarheid te garanderen. We kunnen niet uitsluiten dat andere pluripotente stamcellijnen kunnen vereisen verschillende initiële dichtheid, die moet worden empirisch bepaald in proef experimenten, zoals de duplicatie snelheid kan aanzienlijk verschillen tussen de individuele lijnen. De middelgrote schakelaar aan Neurobasal/B27 moet na 48 h voorkomen sinds doxycycline inductie (sectie 3,3): de differentiatie kan langzamer en minder efficiënt resulteren als de cellen niet 2 gehele dagen in het middel DMEM/F12 worden gehouden. Dissociatie op dag 5 moet worden uitgevoerd zonder te benadrukken differentiërende cellen. De tijd van incubatie met het reagens van de cel dissociatie (stap 3,4) kan van partij aan partij verschillen en zou zorgvuldig in proef experimenten moeten worden geschat. Bij incubatie met de cel dissociatie reagens, de hele cel monolayer los van de plaat. Vervolgens moet het zorgvuldig worden gescheiden door het pipetteren, zoals beschreven in punt 3,4, om de cel integriteit te behouden en om mechanische stress te voorkomen, die een negatieve invloed kunnen hebben op het onderhoud van de cel cultuur buiten D5. Tot slot hebben we gemerkt dat na re-plating MNs hechten beter op weefselcultuur plastic dan glas. Polymeer-dekglaasjes zorgen voor een optimale cel aanhankelijkheid en geschikte optische eigenschappen zijn een goede optie voor microscopie-gebaseerde toepassingen.

Onze methode is een directe "programmering" van pluripotente cellen in een MN lot, en niet recapituleren de tussenliggende stappen waardoor embryonale cellen verwerven een MN identiteit tijdens in vivo ontwikkeling, zoals de initiële specificatie van neurale Ectoderm en patroon langs de dorso-buik en rostro-caudale assen. Daarom zou het niet geschikt zijn om de menselijke MN-specificatie in vitro te modelleren, bijvoorbeeld, moleculaire mechanismen onderliggende differentiatie. Aan de andere kant, ons protocol maakt het genereren van een aanzienlijke hoeveelheid van de wervelkolom of craniale MNs zonder de noodzaak van verdere reiniging. Ook rekening houdend met de mate van rijping bereikt, dit is een nuttig instrument voor het bestuderen van de moleculaire basis van neurodegeneratieve ziekten van het motor neuron. Een consistent aantal iPSC lijnen met pathogene mutaties in motor neuron ziekte-gerelateerde genen is geproduceerd door de wetenschappelijke gemeenschap in de afgelopen jaren. Collecties van MN "programmeerbare" iPSC lijnen kunnen daarom gemakkelijk worden gegenereerd door een stabiele integratie van nihil en NIP modules in die Mutant iPSC lijnen. We kunnen voorstellen, als een mogelijke toekomstige toepassing van de methode, de karakterisering van de cel-autonome determinanten die verschillende gevoeligheid verleent aan individuele MN subtypen, door het vergelijken van Side-by-side craniale en spinale MNs verkregen uit iPSCs met dezelfde genetische achtergrond. Bovendien, effectieve omzetting van iPSCs in MNs in vereenvoudigde cultuuromstandigheden die minimale manipulatie (dwz, zonder overgang door embryoid organen) nodig en dat kan gemakkelijk schaalbaar, kan sterk vergemakkelijken geautomatiseerde High-throughput drug screening benaderingen voor motor neuron ziekten. In vitro modellering van volwassen-begin neurodegeneratieve ziekten kan worden uitdagend als gevolg van de foetale-achtige aard van iPSC-afgeleide neuronen14. Eerdere strategieën bedacht te versnellen veroudering van MNs afgeleid door conventionele differentiatie van iPSCs, zoals progerin overexpressie15, kunnen worden gecombineerd met onze methode om betere ziektemodellen te verkrijgen.

De hier beschreven methode, gebaseerd op de afleidbaar uitdrukking van transcriptiefactoren die door een piggyBac vector worden bemiddeld, kan op andere veroorzaakte cel types worden toegepast. Wij hebben eerder aangetoond dat de skelet cellen van de spier van menselijke iPSCs door uitdrukking van BAF60c en Myod16kunnen worden verkregen. Evenzo kunnen we voor ogen de mogelijkheid om de methode uit te breiden tot andere soorten van de cel van belang, met inbegrip van andere neuronale subtypen en astrocyten, door piggyBac-gemedieerde expressie van de juiste sets van programmering factoren17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen

Acknowledgments

De auteurs willen de Imaging Facility te bedanken bij Center for Life Nano Science, Istituto Italiano di tecnologia, voor ondersteuning en technisch advies. Wij zijn dankbaar voor de leden van het centrum voor het leven nano wetenschap voor nuttige discussie. Dit werk werd gedeeltelijk gesteund door een toelage van AriSLA (proef toelage 2016 "StressFUS") aan AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics