أنسوية NOG الفئران للتعرض لفيروس نقص المناعة البشرية داخل المهبل وعلاج عدوى فيروس نقص المناعة البشرية

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

لقد وضعنا بروتوكولا لتوليد وتقييم نموذج الماوس NOG المصاب بفيروس نقص المناعة البشرية الإنسان على أساس زرع الخلايا الجذعية، والتعرض لفيروس نقص المناعة البشرية داخل المهبل، وقطرات PCR RNA الرقمية التحديد الكمي.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

توفر الفئران الأنسّمة منصة متطورة لدراسة فيروس نقص المناعة البشرية (HIV) ولاختبار الأدوية المضادة للفيروسات. يصف هذا البروتوكول إنشاء جهاز مناعة بشري في فئران NOG البالغة. هنا ، نشرح جميع الخطوات العملية من عزل دم الحبل السري المستمدة من خلايا CD34 البشرية وزرعها عن طريق الوريد في الفئران ، إلى التلاعب في النموذج من خلال عدوى فيروس نقص المناعة البشرية ، والجمع بين العلاج المضاد للفيروسات القهقرية ( cART)، وأخذ عينات الدم. يتم حقن ما يقرب من 75000 hCD34 + الخلايا عن طريق الوريد في الفئران ومستوى التشيميرة البشرية ، والمعروفة أيضا باسم أنسنة ، في الدم المحيطي ويقدر طوليا لعدة أشهر عن طريق قياس التدفق الخلوي. ما مجموعه 75،000 hCD34 + الخلايا تسفر عن 20٪ -50٪ خلايا CD45+ الإنسان في الدم المحيطي. الفئران عرضة للعدوى داخل المهبل بفيروس نقص المناعة البشرية والدم يمكن أن تؤخذ عينات مرة واحدة أسبوعيا للتحليل، ومرتين شهريا لفترات طويلة. يصف هذا البروتوكول كمية كمية من الحمل الفيروسي البلازما باستخدام قطرة PCR الرقمية (ddPCR). نحن نظهر كيف يمكن التعامل مع الفئران بشكل فعال مع نظام cART القياسية للرعاية في النظام الغذائي. تسليم cART في شكل تشاو الماوس العادية هو صقل كبير للنموذج التجريبي. ويمكن استخدام هذا النموذج للتحليل قبل السريري لكل من مركبات الوقاية قبل التعرض الجهازية والموضعية وكذلك لاختبار العلاجات الجديدة واستراتيجيات علاج فيروس نقص المناعة البشرية.

Introduction

فيروس نقص المناعة البشرية (HIV) هو عدوى مزمنة مع أكثر من 37 مليون شخص مصاب في جميع أنحاء العالم1. مزيج العلاج المضاد للفيروسات (cART) هو العلاج المنقذ للحياة، ولكن لا يزال هناك ما يبرر العلاج. وبالتالي، هناك حاجة إلى نماذج الحيوانات التي تعكس جهاز المناعة البشري واستجاباته من أجل تسهيل البحوث المستمرة في مجال فيروس نقص المناعة البشرية. وقد وضعت أنواع متعددة من الفئران أنسنة قادرة على دعم الخلايا والأنسجة الترقيع عن طريق زرع الخلايا البشرية في الفئران نقص المناعة الشديد2. وهذه الفئران الأنمنية معرضة للإصابة بفيروس نقص المناعة البشرية وتوفر بديلا هاما لنماذج فيروس نقص المناعة سيميان الرئيسيات غير البشرية، لأنها أرخص وأبسط في الاستخدام من الرئيسيات غير البشرية. وقد سهلت الفئران أنسنة البحوث في انتقال فيروس نقص المناعة البشرية الفيروسية، الإمراض، والوقاية، والعلاج10،11.

نحن نقدم نظام نموذج إنساني مرن لأبحاث فيروس نقص المناعة البشرية التي تم تطويرها عن طريق زرع الخلايا الجذعية البشرية المشتقة من دم الحبل السري في فئران NOD. Cg-كورياالديمقراطيةscidIl2rgtm1Sug/JicTac (NOG) الخلفية. إلى جانب كونها من أصل غير الجنيني ، فإن الهندسة الحيوية العملية لهذه الفئران أقل تطلبًا من الناحية الفنية مقارنة بالعمليات الجراحية الدقيقة المشاركة في زراعة بناء الغدة الصعترية للدم الكبد (BLT).

نعرض كيفية تحديد عدوى فيروس نقص المناعة البشرية من خلال انتقال العدوى داخل المهبل وكيفية مراقبة الحمل الفيروسي البلازما مع القطرة الحساسة الرقمية PCR (ddPCR) القائم على الإعداد. في وقت لاحق، ونحن نصف إنشاء cART القياسية نظرا كجزء من النظام الغذائي الماوس اليومي. والهدف من هذه الأساليب مجتمعة هو الحد من الإجهاد على الحيوانات وتسهيل التجارب على نطاق واسع حيث الوقت الذي يقضيه في التعامل مع كل الحيوانات محدودة12.

في البشر، وCCR5Ο32/wt أو CCR5Ο32/ Ο32 يؤدي إلى انخفاض التعرض للإصابة بفيروس نقص المناعة البشرية مع الفيروسات المرسل / مؤسس13،ويجب اتخاذ بعض الاحتياطات عند الهندسة الحيوية أنسنة الفئران مع الخلايا الجذعية لغرض دراسات فيروس نقص المناعة البشرية. هذا صحيح بشكل خاص في منطقتنا لأن المتغيرات التي تحدث بشكل طبيعي في الجين CCR5 ، وخاصة عمليات الحذف 32 ، هي أكثر انتشارا في السكان الأصليين الاسكندنافية والبلطيق مقارنة ببقية العالم14،15. وهكذا، يتضمن بروتوكولنا فحصسهل وعالي الإنتاجية لفحص الخلايا الجذعية الهيماتوبوية المانحة للمتغيرات CCR5 قبل الزرع.

للتعرض داخل المهبل اخترنا الارسال / مؤسس R5 فيروس RHPA4259، معزولة عن امرأة في مرحلة مبكرة من العدوى الذين أصيبوا عن طريق المهبل16. لقد عرّضنا الفئران لجرعة فيروسية كانت كافية لإنتاج انتقال ناجح في غالبية الفئران، ولكن أقل من معدل انتقال 100%.. ويتيح اختيار هذه الجرعة نطاقا ً دينامياً كافياً في معدل انتقال العدوى بحيث يمكن أن تؤدي الآثار المضادة للفيروسات لمرشح المخدرات إلى حماية الحيوانات في تجارب الوقاية من فيروس نقص المناعة البشرية وانخفاض الحمل الفيروسي لدراسات العلاج.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تم الحصول على جميع عينات دم الحبل السري وفقا ً للبروتوكولات المعتمدة محلياً، بما في ذلك الموافقة المستنيرة على التبرع المجهول من قبل الوالدين. تمت الموافقة على جميع التجارب الحيوانية وتنفيذها وفقًا للأنظمة الوطنية الدنماركية بموجب الترخيص 2017-15-0201-01312.

تنبيه: التعامل مع الفئران المعرضة لفيروس نقص المناعة البشرية والدم بحذر شديد. تطهير جميع الأسطح والسوائل التي تم ملامسة فيروس نقص المناعة البشرية مع مطهر فيروس نقص المناعة البشرية وأكد(جدول المواد).

1. عزل الخلايا الجذعية CD34 + الإنسان

  1. جمع عينات دم الحبل السري في أنابيب جمع الدم المغلفة EDTA بعد العمليات القيصرية المخطط لها أو الولادات المهبلية ووفقا للموافقات الأخلاقية المحلية.
  2. عزل الشركات العسكرية والأمنية الخاصة من دم الحبل السري عن طريق فصل التدرج الكثافة وفقا لبروتوكول الشركة المصنعة.
  3. عزل خلايا CD34+ من السكان PBMC عن طريق أول ما قبل التخصيب مع الأجسام المضادة ضد علامات مشتركة للخلايا الناضجة، مما يؤدي إلى ربط الخلايا من الأنساب غير المرغوب فيها مع خلايا الدم الحمراء. ويتبع ذلك إثراء الخلايا CD34+ باستخدام الخرز المغناطيسي، وفقا لبروتوكول الشركة المصنعة.
    1. تحديد عدد الخلايا الحية عن طريق استبعاد أزرق trypan قياسي عن طريق إعادة تعليق 10 ميكرولتر من تعليق الخلية في 90 ميكرولتر من الأزرق trypan. أضف 10 ميكرولتر من هذا المحلول إلى مقياس الهيماكومتر وعد الخلايا غير الزرقاء، وفقًا لبروتوكول الشركة المصنعة.
    2. الاحتفاظ بالتبريد بشكل قابل للحفاظ على خلايا CD34+ في 1 مل من 10٪ DMSO في مصل الأبقار الجنين (FBS) حتى يوم زرع الماوس.
    3. Cryomaintain Viably جزء صغير من كل من المعزولة (CD34 +) وتدفق من خلال الخلايا (CD34-) بشكل منفصل لتقييم نقاء الخلايا الجذعية CD34 + (~ 30،000 الخلايا من كل عينة). بدلاً من ذلك، اختبر النقاء على الخلايا الغنية حديثًا (انظر الخطوة 2 أدناه).
    4. تجميد جزء من التدفق غير الحبيبات من خلال (CD34-) لتحديد حالة CCR5Ο32. يمكن تجميد الخلايا مباشرة دون حل تجميد مشروط ، ولكن وجود خلايا الدم الحمراء في بيليه يمكن أن تمنع PCR اللاحقة إذا كان التدفق من خلال بيليه.

2. تقييم CD34 + نقاء الخلايا الجذعية عن طريق قياس التدفق الخلوي

  1. إذابة الخلايا المعزولة (CD34+) والخلايا المتدفقة (CD34-). غسل الخلايا عن طريق إعادة تعليق الخلايا من كل قارورة في 9 مل من درجة حرارة الغرفة (RT) FACS العازلة، التي تتكون من 2٪ مصل الأبقار الجنين (FBS) في محلول مالى المخزنة مؤقتا ً بالفوسفات (PBS).
  2. الطرد المركزي لمدة 5 دقيقة في 300 × ز في RT إلى خلايا بيليه.
  3. صب قبالة supernatant، وإعادة تعليق الخلايا في السائل المتبقي ونقلها إلى أنابيب FACS. كرر خطوة الغسيل مع 3 مل من المخزن المؤقت FACS. بعد الطرد المركزي الثاني، صب قبالة supernatant وإعادة تعليق الخلايا في السائل المتبقي.
  4. إضافة 5 ميكرولتر من حل حجب مستقبلات FC(جدول المواد)وترك لمدة 10 دقيقة في RT. لا تغسل حل حجب مستقبلات FC.
  5. إضافة مزيج يحتوي على كميات محددة سلفا من الأجسام المضادة ضد CD3 الإنسان (استنساخ SK7) BUV395، CD34 (استنساخ AC136)، FITC، وCD45 (استنساخ 2D1) APC(الجدول 1). ترك الخلايا لمدة 30 دقيقة في RT في الظلام. يجب اختيار الفلوروفوريات على أساس المعلمات التي يمكن تقييمها باستخدام مقاييس التدفق الخلوي المتاحة دون الحاجة إلى مصفوفة تعويض.
  6. غسل الخلايا مع 3 مل من المخزن المؤقت FACS.
  7. الطرد المركزي لمدة 5 دقيقة في 300 × ز في RT لبيليه الخلايا.
  8. صب قبالة supernatant وإعادة تعليق الخلايا في السائل المتبقي.
    1. كرر هذه الخطوة الغسيل 2x لضمان إزالة جميع الأجسام المضادة غير المنضمة.
  9. تسجيل العينات على مقياس التدفق الخلوي(جدول المواد)وإجراء تحليل البيانات مع البرامج المناسبة. وترد استراتيجية الجاتينغ في الشكل 1ألف- واو.

3. الفحص الجيني للمتغيرات CCR5Ο32 في دم الحبل السري

  1. احتضان 1.25 ميكرولتر من التدفق غير الحبيبات من خلال مع 11.25 ميكرولتر من مزيج PCR يحتوي على 200 ميكرومتر من مزيج dNTP، 0.01 U/μL عالية الدقة الحمض النووي البوليميراز، والتمهيديات الأمامية والعكسية المفصلة في الجدول 2.
    1. ضبط مستوى الصوت مع المياه خالية من nuclease إلى ما يقرب من 12.5 ميكرولتر لكل تفاعل PCR.
  2. تضخيم شظايا الجينوم مع برنامج ركوب الدراجات PCR مفصلة في الجدول 3.
  3. فصل منتجات PCR على هلام agarose 2٪13.
    1. منتجات PCR من alleles نوع البرية وalleles Ο32 تسفر عن شظايا PCR من 196 زوجقاعدة و 164 نطاقات أزواج قاعدة على التوالي، مما يجعلها قابلة للتمييز بسهولة عن طريق الهلام الكهربائي13 (الشكل 1G).

4- زرع الخلايا الجذعية عن طريق الوريد

ملاحظة: وجود شخص واحد إعداد الخلايا في المختبر وشخص آخر إعداد الفئران ومساحة العمل لعمليات الزرع هو نهج فعال.

  1. في منشأة للحيوانات، 4-6 ساعة قبل زرع الخلايا الجذعية المخطط لها، تشعيع 6-7 أسابيع من العمر NOD الإناث. Cg-prkdcscid Il2rgtm1Sug/JicTac (NOG) الفئران(جدول المواد)مع 0.75 Gy مع مصدر Cs137. قد تختلف أفضل جرعة مسبقة بناءً على عمر الفأر ومصدر الإشعاع وعوامل أخرى. هذه العملية الظروف الحيوانات لتطعيم ناجحة مع الخلايا الجذعية البشرية.
  2. في منشأة للحيوانات، قم بإعداد مساحة عمل مقعد التدفق وجميع الكواشف قبل إحضار الفئران أو الخلايا إلى مساحة العمل.
    1. ضع وسادة زرقاء معقمة لتغطية سطح العمل لمقاعد البدلاء. إعداد الشاش المعقم وحاوية حادة.
    2. ضع مصباح تدفئة مطهرًا بالإيثانول بنسبة 70٪ في مقعد التدفق مع قفص فأر معقم فارغ تحت الحرارة.
  3. في المختبر، إذابة خلايا CD34+ المعزولة وتمييعها في 9 مل من 37 درجة مئوية عادي RPMI.
  4. الطرد المركزي الخلايا في 350 × ز لمدة 5 دقيقة في RT، تجاهل supernatant عن طريق الطموح، وإعادة تعليق بيليه في 1 مل من RPMI عادي في 37 درجة مئوية.
  5. تحديد عدد الخلايا عن طريق استبعاد الأزرق trypan، وضبط مستوى الصوت إلى 200 ميكرولتر لكل فأرة. جعل اضافية لتأخذ في الاعتبار الخسارة المحتملة بسبب خطوات المناولة اللاحقة.
    1. الاستعداد لزرع 75،000 CD34 + الخلايا لكل 200 ميكرولتر في كل فأرة.
    2. يمكن الاحتفاظ بالخلايا عند 4 درجات مئوية أثناء نقلها إلى منشأة الحيوان قبل عملية الزرع. تجنب إبقاء الخلايا على الجليد للحد من التجميع أو التكتل.
  6. في منشأة الحيوان، وجلب القفص مع الفئران في مقاعد البدلاء تدفق ونقل الفئران إلى القفص تحت مصباح التدفئة لتمدد الأوعية الدموية. ترك نهاية واحدة من القفص بعيدا عن مصدر الحرارة بحيث الفئران يمكن أن تتحرك بعيدا عن الحرارة عند أن تصبح دافئة. الفئران التي انتقلت إلى نهاية القفص ، بعيدا عن مصدر الحرارة ، دافئة بما فيه الكفاية لحقن الوريد الذيل ناجحة.
  7. قم بتحميل حقنة مشحمة 1 مل إلى أعلى علامة 800 ميكرولتر مع خلايا CD34+ المعلقة. استخدام مشحم 1 مل حقنة سوف تخفف بشكل كبير من الحقن عن طريق الوريد وزيادة دقة هذه التقنية.
  8. إرفاق إبرة 30 G 13 مم وإعداد الإبرة والحقن للحقن. يسمح هذا الترتيب من العملية للحقنة ليتم تحميلها بشكل أسرع مع حماية سلامة الخلايا التي سيتم زرعها نظرا للضرر المحتمل الذي يمكن أن يحدث خلال التطلع السريع للخلايا من خلال إبرة قياس صغيرة من هذا القبيل. ملء محور إبرة مع السائل عن طريق الضغط على المكبس وإزالة السائل وصولا الى علامة 200 ميكرولتر من الإبرة.
  9. ضع فأرًا ساخنًا (الخطوة 4.6) في الكبّاب المستخدم في إعطاء حقن IV. حقن بعناية 200 ميكرولتر من تعليق الخلية في الوريد الذيل من الماوس. قضاء 2 ق أداء الهبوط والحفاظ على الإبرة إدراجها لمدة 2 ق تقريبا بعد الانتهاء من الحقن. وهذا يضمن أن الخلايا قد هاجرت بشكل كاف بعيدا عن موقع الحقن قبل إزالة الإبرة.
  10. كما يلزم مسح ذيل الفأر بشاش معقم لإزالة أي دم مرئي. وضع الماوس مرة أخرى في قفص المنزل غير ساخنة. كرر إجراء الحقن مع الفئران المتبقية.

5. جمع الدم ومعالجته ا

ملاحظة: يمكن تقييم تطعيم الخلايا البشرية في الدم المحيطي عن طريق قياس التدفق الخلوي بعد 3-5 أشهر من زرع الخلايا الجذعية البشرية.

  1. سحب عينات الدم من الفئران باستخدام التقنيات المحلية المعتمدة من IACUC.
  2. جمع ما أقصى من 70-100 ميكرولتر من إجمالي الدم في أنابيب مركزية دقيقة معقمة PCR تحتوي على 10 ميكرولتر من 0.5 M EDTA (درجة الحموضة = 8.0) لتجنب تخثر الدم.

6. تقييم تطعيم الإنسان عن طريق قياس التدفق الخلوي

  1. نقل 40-50 ميكرولتر من الدم إلى أنابيب FACS.
  2. إضافة 5 μL من حل كتلة مستقبلات FC لمنع الربط غير محدد من الأجسام المضادة وترك لمدة 10 دقيقة في RT.
  3. إضافة الماوس المضادة للأجسام المضادة للإنسان مزيج يحتوي على CD4 (استنساخ SK3) BUV 496، CD8 (استنساخ RPA-T8) BV421، CD3 (استنساخ OKT3) FITC، CD19 (استنساخ sj25c1) PE-Cy7، CD45 (استنساخ 2D1) APC(الجدول 4)وترك لوصمة عار في الظلام في RT لمدة 30 دقيقة. يجب اختيار الفلوروفوريات على أساس المعلمات التي يمكن تقييمها مع أجهزة قياس التدفق المتاحة دون الحاجة إلى مصفوفة التعويض.
  4. إضافة 2 مل من خلية الدم الحمراء المناسبة العازلة إلى كل أنبوب لخلايا الدم الحمراء. استخدام العازلة الانخلاس وضعت خصيصا لتلطيخ الأجسام المضادة قبل تحليل خلايا الدم الحمراء (يتم إعطاء مثال مناسب في جدول المواد). دوامة لفترة وجيزة لضمان التوزيع المتساوي للخلايا في حل الخلايا وتترك لمدة 10 دقيقة في RT. التوزيع المتساوي للخلايا مهم.
  5. إضافة 2 مل من المخزن المؤقت FACS لوقف رد فعل الانالوسط.
  6. الطرد المركزي لمدة 5 دقيقة في 300 × ز في RT لبيليه الخلايا.
  7. صب قبالة supernatant والدوامة بلطف حتى يتم إعادة تعليق الخلايا.
  8. أضف 3 مل من المخزن المؤقت FACS والطرد المركزي لمدة 5 دقيقة عند 300 × ز في RT.
  9. صب قبالة supernatant وإعادة تعليق الخلايا.
  10. تسجيل العينات على مقياس التدفق الخلوي المناسب وتحليل باستخدام البرامج المناسبة(جدول المواد). يتم تصوير التحليل التمثيلي والنتائج في الشكل 2 والشكل 3.

7 - التعرض لفيروس نقص المناعة البشرية أثناء المهبل

ملاحظة: يمكن إنتاج الفيروس المستخدم في التعرض داخل المهبل للفئران باستخدام البروتوكولات المنشورة سابقًا17. يتم الاحتفاظ بالفيروس عند -80 درجة مئوية ونقله بين المواقع أثناء تخزينه على الجليد الجاف باتباع البروتوكولات المعتمدة محليًا. يتم تخزين الفيروس على الجليد الجاف حتى مباشرة قبل التعرض للفئران. يمكن تخفيف الفيروس إلى RPMI عادي (تجنب RPMI التي تحتوي على المضادات الحيوية أو إضافات المصل) لتحقيق التركيز المناسب مباشرة قبل التعرض (تم استخدام 21400 IUs لهذا التعرض IVAG). وبمجرد توليدها، احتفظ بالمخزون المخفف على الجليد الرطب طوال العملية لتجنب دورات التجمد والذوبان التي قد تحدث إذا تم وضع الفيروس المخفف مرة أخرى على الجليد الجاف بمجرد إذابة الجليد.

  1. إعداد جميع المعدات وتدفق مساحة العمل مقاعد البدلاء كما هو معروض في الشكل 4 قبل جلب الفئران أو الفيروس في مقاعد البدلاء تدفق (على غرار الخطوة 4.2).
    1. ضع تركيز مصباح التدفئة في وسط مساحة العمل حيث سيتم وضع الماوس أثناء إجراء التعرض لفيروس نقص المناعة البشرية. سوف مصباح التدفئة ضمان عدم انخفاض في درجة حرارة الجسم من الفئران. يمكن أيضًا استخدام المعدات الأخرى التي تتحكم في درجة الحرارة ، (على سبيل المثال ، وسادة هلام ساخنة أو بطانية مياه دافئة متداولة ، وفقًا للوائح IACUC المحلية18).
    2. جلب العقيمة 20 ميكرولتر ماصة نصائح وماصة مناسبة في مقاعد البدلاء. ضع حاوية مع مطهر سائل(جدول المواد)في مقاعد البدلاء للتعطيل الفوري للمواد والسوائل التي تم على اتصال مع الفيروس.
  2. وضع الماوس في غرفة مع 3٪ غاز الإيسولوران والمناشف الورقية. هذه النسبة المئوية من الغاز سوف تُسهّم الحيوانات في غضون 2-4 دقيقة. كما هو الحال مع جميع المواد الأخرى المستخدمة مع الفئران نقص المناعة ، يجب تطهير جهاز التخدير بشكل صحيح قبل الاستخدام.
  3. مرة واحدة بولاية، ونقل الماوس إلى لوحة زرقاء معقمة تحت مصباح التدفئة. إدراج أنمجر الماوس في قناع توريد غاز isoflurane المستمر 3٪ للحفاظ على التخدير. عقد الماوس في قاعدة الذيل، والمعدة التي تواجه، مع يدك دعم الماوس مرة أخرى كما هو مبين في الشكل 4.
  4. مع طرف ماصة معقمة، وتحفيز المنطقة التناسلية عن طريق التمسيد بلطف صعودا نحو الشرج للحث على إفراغ المستقيم، وتخفيف الضغط على المهبل.
  5. عارية بعناية فتح المهبل عن طريق التفاف ذيل الماوس عبر أصابعك مثل أن الفرج يفتح بشكل طبيعي، وربما مع دفع طفيف باستخدام طرف ماصة معقمة.
  6. تغيير تلميح ماصة و20 ميكرولتر من الفيروس atraumatically في المهبل الماوس دون خلق فقاعات. لا تدخل البقشيش في عمق المهبل. بدلا من ذلك، مع فتح الفرج، ضع طرف ماصة على مستوى فتحة المهبل، وتجنب الذهاب أعمق للقضاء على احتمال سحجات أثناء عملية التلقيح، والإفراج عن الفيروس، والسماح للجاذبية لسحب الفيروس في المهبل. بدلا من ذلك، استخدم 22 G 1.25 مم حادة نهاية، إبرة مستقيمة،كما هو موضح في Veselinovic وآخرون.
  7. الاحتفاظ بالماوس في هذا الموقف مع المهبل التي تواجه لمدة 5 دقيقة بعد التعرض لتجنب تسرب الجاذبية الناجمة عن تعليق الفيروس.
    1. وضع الماوس بعناية في قفص المنزل، مع الحرص على وضع الماوس على ظهره.

8. معالجة عينات الدم قبل تحليل الحمل الفيروسي

  1. جمع الدم على النحو المبين في القسم 5 أعلاه.
  2. الطرد المركزي عينات الدم لمدة 5 دقيقة في 500 × ز في RT لفصل البلازما والخلايا.
  3. جمع 40 ميكرولتر من البلازما لقياس الحمل الفيروسي في أنبوب طرد مركزي صغير جديد معقم معتمد من PCR وتخزينه عند -80 درجة مئوية لمدة ساعة واحدة على الأقل حتى تتم المعالجة. من المهم تجميد جميع العينات قبل استخراج الحمض النووي الريبي لتجنب خطر التحيز من مقارنة مستويات الحمض النووي الريبي في العينات التي لم يتم تجميدها قبل عزل الجيش الملكي النيبالي إلى عينات مجمدة قبل عزل الجيش الملكي النيبالي.
  4. ضبط حجم الدم مرة أخرى إلى الحجم الأصلي عن طريق إضافة 40 ميكرولتر من وسائل الإعلام تعليق (PBS مع 2.5٪ الزلال مصل البقر، 50 U/mL البنسلين G وstreptomycin، و 10 U/mL DNase، معقمة تصفية في 0.22 ميكرومتر).
  5. نقل 15 ميكرولتر من حجم الدم المعدل إلى أنبوب طرد مركزي صغير جديد معتمد من PCR.
  6. إضافة 1 مل من محلول الليزّة RBC 1x(جدول المواد)،دوامة، واحتضان لمدة 10 دقيقة في RT.
  7. الطرد المركزي لمدة دقيقة واحدة في 9600 × ز في RT إلى خلايا بيليه.
  8. يستنشق supernatant وترك فقط بيليه الخلية البيضاء الصغيرة، وذلك لأن تلوث خلايا الدم الحمراء يمكن أن تمنع PCR.
  9. تخزين بيليه في -80 درجة مئوية لمدة ساعة واحدة على الأقل حتى مزيد من المعالجة.
    ملاحظة: اختيارياً، يمكن استخدام أي دم متبقي من الخطوة 8.4 لتحليل قياس التدفق الخلوي، كما هو موضح أعلاه في الخطوة 6.

9. استخراج الحمض النووي باستخدام طريقة استخراج البروتينات K

  1. استخراج الحمض النووي من كريات الخلايا الطرفية (ولدت في الخطوة 8.8) باستخدام طريقة استخراج البروتينات K كما هو موضح أدناه. وقد ثبت هذا الأسلوب لاستخراج أعلى غلة الحمض النووي من كمية صغيرة من الدم مثل تلك المطلوبة لمجموعات الدم المسلسل المستخدمة في هذه الدراسة19.
  2. أضف 25 ميكرولتر من البروتينات K (20 ميكروغرام/مل) إلى 1 مل من 0.1M Tris المخزن المؤقت.
  3. دوامة محلول بروتيناز K لفترة وجيزة.
  4. أضف 50 ميكرولتر من محلول البروتينات K إلى كل خلية بيليه ليتم هضمها.
  5. مزيج عن طريق الأنابيب صعودا وهبوطا وتأكيد إعادة تعليق بيليه الخلية.
  6. يهز على thermoshaker(جدول المواد)في 400 دورة في الدقيقة (اعتمادا على الصك) في 56 درجة مئوية لمدة 1 ساعة أنابيب الشريط إلى أسفل لعقد لهم في مكان، إذا لزم الأمر.
  7. على الفور وفي نفس thermoshaker، تعطيل البروتينات K مع تحول درجة الحرارة إلى 95 درجة مئوية في حين يستمر اهتزاز لمدة 20 دقيقة إضافية.
  8. دوامة كل عينة.
  9. ضع كل عينة على -80 درجة مئوية لمدة لا تقل عن 30 دقيقة.
  10. ذوبان، ثم الطرد المركزي العينات في 17،000 ز لمدة 1 دقيقة في RT لبيليه شظايا الخلوية غير المرغوب فيها.
  11. ضع الـ"سوبرناتانت" المحتوي على الحمض النووي في أنبوب طرد مركزي صغير جديد.
  12. قالب الحمض النووي جاهز لـ PCR. يمكن تخزين قوالب الحمض النووي عند -80 درجة مئوية.

10. استخراج الحمض النووي الريبي، وتوليف cDNA، وقياس كمية ddPCR من الحمض النووي الريبي الفيروسي

  1. عزل الحمض النووي الريبي من بلازما الماوس المذابة مع مجموعة عزل الحمض النووي الريبي الفيروس بعد بروتوكول الشركة المصنعة(جدول المواد).
  2. بعد إضافة العينة إلى العمود، أضف خطوة علاج DNase على العمود لضمان إزالة جميع الحمض النووي في عينة البلازما.
    1. لكل عينة، إضافة 95 ميكرولتر من RNase خالية من المناز الحل (مزيج 2 μL خالية من الرناز DNase و 98 μL العازلة رد فعل) إلى العمود واحتضان لمدة 15 دقيقة في RT.
  3. تخزين عينات الجيش الملكي النيبالي في -80 درجة مئوية لمدة ساعة واحدة على الأقل قبل مزيد من المعالجة. من المهم تجميد جميع العينات بعد استخراج الحمض النووي الريبي تجنب خطر التحيز عند مقارنة العينات التي لم يتم تجميدها إلى العينات التي تم تجميدها.
  4. تجميع cDNA باستخدام خطوة النسخة العكسية باستخدام الكواشف كما هو موضح سابقا20. تأكد من إضافة 0.5 ميكرولتر من مثبط RNase إلى رد فعل cDNA لتجنب تدهور الحمض النووي الريبي.
    1. إجراء تجميع cDNA مع البرنامج المفصل في الجدول 5.
  5. تخزين عينات cDNA في -80 درجة مئوية لمدة ساعة واحدة على الأقل. من المهم تجميد جميع العينات بعد تخليق الحمض النووي الكلوين تجنب خطر التحيز عند مقارنة العينات التي لم يتم تجميدها إلى العينات التي تم تجميدها.
  6. إعداد عينات لddPCR على النحو التالي20:
    1. مزيج 3 μL من عينة cDNA مع 11 ميكرولتر من خليط التحقيق ddPCR (لا dUTP)20،250 nM طفيفة الأخدود ملزمة التحقيق، و 900 nM من كل من التمهيديات الأمامية والعكسية كما هو مفصل في الجدول 6.
    2. ضبط إجمالي حجم PCR إلى 22 ميكرولتر مع المياه الخالية من nuclease.
  7. استحلاب PCR يمزج مع زيت جيل قطرة للتحقيقات على مولد قطرة وفقا لبروتوكول الشركة المصنعة والأوصاف السابقة20.
  8. تشغيل برنامج PCR كما هو مفصل في الجدول 7.
    ملاحظة: تم تصميم تسلسل التمهيدي / التحقيق وبرامج PCR المعروضة هنا بشكل خاص وتحسينها للكشف الحساس عن سلالة فيروس نقص المناعة البشرية RHPA4259. يمكن بسهولة ضبط تسلسل التمهيدي والمسبار للكشف عن أي سلالة أخرى من فيروس نقص المناعة البشرية من الاختيار.
  9. الكشف عن الفلورة قطرات من العينات على قارئ قطرة، وتحليل النتائج مع البرامج المناسبة وفقا لبروتوكول الشركة المصنعة.

11. العلاج مع cART التي تحتوي على تشاو

  1. الفئران تغذية مع الكريات التي تحتوي على نظام cART القياسية التي تحتوي على 4,800 ملغ/كغ raltegravir (RAL), 720 ملغ/كغ تينوفوفير ديسوبروكسيل فومارات (TDF), و 520 ملغ/كغ emtricitabine (FTC)21 (الجدول 8). تم تحديد هذه الجرعات على افتراض أن الفأر يزن 25 غرام ويأكل 4 غرام من تشاو يوميا. وهذا يعادل جرعة يومية قدرها 768 ملغم/كغ من RAL، و2.88 ملغم/كغ من TDF، و83 ملغم/كغ من لجنة الممارسات التجارية المنصفة21.
  2. استخدام نظام غذائي cART التي تم إعدادها من قبل بائع خارجي (انظر جدول المواد)من الأدوية التي تصرف بوصفة طبية. ويمكن لشركات أخرى أن تنتج هذا النظام أيضاً. استخدام نظام غذائي cART الأحمر الملونة لتمييزه بسهولة من تشاو الماوس العادي.
    1. إنتاج نظام غذائي تشو التحكم دون cART في اللون البني القياسية لتمييز سهل.
  3. لبدء cART، وإعداد أقفاص الفئران العقيمة مع إضافة النظام الغذائي تشاو cART التي تحتوي على، ومن ثم نقل الفئران من القفص القديم إلى القفص الجديد.
    1. مراقبة أوزان الفئران واستهلاك تشاو التي تحتوي على cART عن طريق التفتيش البصري للتأكد من أن الفئران تتكيف مع التغيير.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ويصور استراتيجية الجاتينغ لتحليل نقاء الخلايا الجذعية في الشكل 1. يوضح الشكل 1A-C عدد CD34+ المنقى والشكل 1D-F تدفق CD34- المستخدم لتوضيح أن الحد الأدنى من السكان CD34+ يتم فقدانفي عملية العزل. كانت نقاء الخلايا الجذعية المعزولة CD34+ بين 85٪ -95٪ مع أقل من 1٪ تلوث الخلايا التائية. يصور الشكل 1G نطاقات CCR5 من متبرع واحد للتحكم البشري البالغ مع النمط الجيني CCR5/wt ، تليها نطاقات من اثنين من CCR5wt/wt وواحد CCR5Ο32 /wt المتبرعين بالخلايا الجذعية. وكان تواتر النمط الجيني CCR5Ο32/wt في مجموعة من 19 متبرعاً 15.8٪(الشكل 1H). هذا هو الاتفاق مع الدراسات الوبائية أكبر14،15 الإبلاغ عن النمط الجيني في ما يصل إلى 23.6 ٪ من الأشخاص الذين تم التحقيق معهم في الدنمارك.

تم تقييم مستويات CD45+ البشرية في الدم المحيطي للفئران عن طريق قياس التدفق الخلوي بعد 3-5 أشهر من زرع الخلايا الجذعية CD34+ البشرية. وترد استراتيجية الجاتينغ في الشكل 2A-E. يوضح الشكل 3A والشكل 3B التباين بين 10 و16 فأرًا فرديًا يتلقون خلايا جذعية من متبرعين مختلفين. زرع 75،000 hCD34 + الخلايا أسفرت عن 20٪ -50٪ CD45 الإنسان + في الدم المحيطي. وضعت جميع الفئران الإنسان B وT الخلايا، بما في ذلك كل من CD4- وCD8 + الخلايا التائية.

بالنسبة للتعرضات المهبلية الرضية، تم استخدام الإعداد المبين في الشكل 4. تم تخدير الفئران في غرفة مغلقة وأبقى تحت التخدير أثناء التعرض. وعقدت الفئران مع المهبل التي تواجه ما يصل لمدة 5 دقيقة بعد التعرض لضمان تفاعل حل الفيروس مع الأسطح المخاطية.

ويبين الشكل 5A معدل نجاح انتقال فيروس نقص المناعة البشرية البالغ 64 في المائة الذي لوحظ باستخدام هذا النموذج. تم تحدي الفئران مع 21400 وحدة معدية (IU) من RHPA4259 داخل المهبل. وأسفرت هذه الجرعة عن إصابة 64% من الفئران بفيروس نقص المناعة البشرية بعد التعرض المهبلي. للمقارنة، يتم تضمين البيانات من مجموعتين مختلفتين من الفئران المعرضة من خلال طريق وريدي. كما هو متوقع، أصبح 100٪ من الفئران فيروس نقص المناعة البشرية + مع جرعات مماثلة من RHPA وسلالة إضافية (YU2) باستخدام هذا الطريق.

يصور الشكل 5B النتائج التمثيلية من ثلاثة فئران أصيبت بفيروس نقص المناعة البشرية وتحولت إلى نظام غذائي يحتوي على cART القياسية. تم تبديل الفئران مرة أخرى إلى تشاو الماوس العادية بعد 40 يوما من cART. في إعداد هذا التنظير، كان الحد الأقصى للكشف عن الحمل الفيروسي 725 نسخة/مل. وكانت الأحمال الفيروسية كلها أقل من حد الكشف بعد 4 أسابيع من cART. بعد وقف cART، انتعشالفيروس، مما يعكس البيانات السريرية22. الفئران على cART تتسامح مع التغيير في النظام الغذائي وكذلك كما هو مبين في الشكل 5C.

Figure 1
الشكل 1: استراتيجية قياس التدفق الخلوي التمثيلي للتحقق من نقاء الخلايا الجذعية وحالة متغير المانحين CCR5. (A-C) استراتيجية الجاتينغ المستخدمة لخلايا CD34 المعزولة. وتستثنى الدوبلتس والحطام في اللوحة A وB على التوالي (FSC-A مقابل FSC-H و FSC-A مقابل SSC-A). (C)تردد CD34 + الخلايا الجذعية وCD3 + تلوث الخلايا التائية. (D-F) وCD34- تدفق من خلال استراتيجية الجاتينغ. يتم حساب النسب المئوية في البوابات كجزء من السكان الأصليين. (G)نتائج تحليل CCR5Ο32/wt PCR. حارة 1: الحمض النووي من المتبرع CCR532/wt الإنسان، الممرات 2 و 3: اثنين CCR5wt/wt المتبرعين الخلايا الجذعية البشرية، حارة 4: A CCR5Ο32/wt المانحة الخلايا الجذعية البشرية. (H)تردد النمط الجيني CCR5Ο32/wt في مجموعتنا من 19 عينات الخلايا الجذعية هو 15.8٪. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: تدفق استراتيجية التقطيع الخلوي للتحقق من صحة تطعيم الخلايا البشرية والتمايز. تم تحليل إجمالي عدد الخلايا أحادية النواة من الفئران الإنسانية عن طريق قياس التدفق الخلوي. (أ)تم تحديد النسبة المئوية لخلايا CD45 البشرية كجزء صغير من إجمالي الأحداث المسجلة. (ب)استُبعدت الدوبلتس فيما بعد استناداً إلى اتفاقية الخدمات المالية-A/FSC-H. (ج)تم تعريف الخلايا اللمفاوية الحقيقية على أساس الحجم والحبيبي. (D)ثم وصفت الخلايا اللمفاوية إما CD3 + (الخلايا التائية) أو CD19 + (الخلايا B). (E)كانت خلايا CD3 + T إما خلايا CD4 + T أو خلايا CD8 + T. حسبت النسب المئوية في البوابات كجزء من السكان الأصليين. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: مستويات أنسنة تمثيلية بعد 4-5 أشهر من زرع الخلايا الجذعية مع كسور من النوع الفرعي للخلايا لـ 10 و 16 فأرًا تم إنشاؤها من متبرعين بشريين مختلفين. (أ)تم تحليل عدد الخلايا أحادية النواة (MNC) من 10 و(B)16 الفئران أنسنة عن طريق قياس الخلايا تدفق وبوابات كما هو مُعرض في الشكل 2. يتم تقديم جزء من خلايا CD45+ البشرية كـ %hCD45 (من إجمالي MNC)، و %B و %T الخلايا كجزء من hCD45. تم تقسيم الخلايا التائية في وقت لاحق إلى %CD4 و %CD8. تمثل كل نقطة بيانات ماوس واحد. يتم تقديم البيانات على أنها تعني ± SD. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: إعداد مقاعد البدلاء المختبر التجريبي للتعرض داخل المهبل من الفئران. الإعداد التجريبي لتعرض الفئران الإنسانية لفيروس نقص المناعة البشرية من خلال الطريق المهبلي. يتم تنفيذ الإجراء في مقعد التدفق حيث تم تعقيم جميع الكواشف والأسطح قبل الاستخدام. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 5
الشكل 5: معدل انتقال سلالة فيروس نقص المناعة البشرية من خلال طرق التعرض المختلفة وفعالية وسلامة تشاو المحتوي على المعالجة بالمضادات القهقرية في قمع الفيروس. (أ)تم إصابة فئران NOG الأنومينة بنجاح بسلالات مختلفة من فيروس نقص المناعة البشرية إما عن طريق المهبل أو عن طريق الوريد. تعرضت الفئران مع 21400 IUs من RHPA4259 داخل المهبل ، 5157 IUs IV مع RHPA4259 ، أو 3000 IUs IV مع YU2. لا يتضمن هذا البروتوكول التفاصيل المتعلقة بالتعرض الوريدي للفئران الإنسانية. تم علاج عدوى فيروس نقص المناعة البشرية بنجاح مع نظام cART تسليمها من خلال تشاو الماوس. (ب)انخفض الحمل الفيروسي إلى ما دون الكشف عن جميع الفئران الثلاثة على cART وانتعاش ظهرت بعد وقف cART. يشير الخط المنقط إلى حد القياس الكمي عند 725 نسخة/مل. الفئران التي تتغذى مع تشاو cART كان تطور الوزن مماثلة الفئران التي تقع على تشاو غير cART خلال نفس الفترة الزمنية، مما يشير إلى عدم تفضيل الذوق أو الآثار الجانبية للنظام الغذائي cART. (C)يتم تقديم الأوزان كتغيير أضعاف مقارنة مع بداية cART. تمثل كل نقطة بيانات متوسط ثلاثة أنواع من الحيوانات ± SD. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

هدف الأجسام المضادة استنساخ فلوروفور
CD3 استنساخ SK7 BUV395
CD34 استنساخ AC136 FITC
CD45 استنساخ 2D1 Apc

الجدول 1: الأجسام المضادة المستخدمة لتحديد نقاء الخلايا الجذعية. اقترح لوحة التدفق الخلوي متعدد الألوان لتقييم نقاء الخلايا الجذعية. المدرجة هي هدف الأجسام المضادة، استنساخ، والفلوروفور.

الكشف عن CCR5Ο32 الاشعال
التمهيدي إلى الأمام 5'CTTCATACCACCTGCAGCT'3
التمهيدي العكسي 5'TGAAGATAGCCTCACAGCC'3

الجدول 2: CCR5Ο32 كشف البديل التمهيديPCR. التمهيديات الأمامية والعكسية المستخدمة للكشف عن حذف 32 نقطة بريتيش بتروليوم في الجين CCR5.

لا. من دورات 1 45 1
درجة الحرارة (°C) 98 98/63/72 72 10
الوقت 30 s 10 s/30 s/15 s 5 دقيقة

الجدول 3: CCR5Ο32 البديل الكشف برنامج PCR. برنامج ركوب الدراجات PCR المستخدمة لتضخيم الجين CCR5.

هدف الأجسام المضادة استنساخ فلوروفور
CD4 SK3 BUV 496
CD8 الجيش الوطني الرواندي - T8 BV421
CD3 OKT3 FITC
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

الجدول 4: الأجسام المضادة المستخدمة لتحديد أنسّة الفئران. اقترح لوحة التدفق متعدد الألوان للأنسمة. المدرجة هي هدف الأجسام المضادة، استنساخ، والفلوروفور.

لا. من دورات 1 1
درجة الحرارة (°C) 51 80 4
الوقت 45 دقيقة 15 دقيقة

الجدول 5: برنامج تضخيم الحمض النووي. برنامج يستخدم لتضخيم الحمض النووي حبلا تكميلية إلى الحمض النووي الريبي الفيروسي.

تحديد كمية فيروس نقص المناعة البشرية الاشعال
التمهيدي إلى الأمام 5'AGGGCAGCATAGAGCAAAaa'3
التمهيدي العكسي 5'CAAGGAATGGGGGTTCTTT'3
FAM التحقيق 5'ATCCCCACTTCAACAGATGC'3

الجدول 6: الالتمهيديات المتعلقة بفيروس نقص المناعة البشرية ومتلازمة نقص المناعة المكتسب (الإيدز). الكبيات والمسابير المستخدمة لتضخيم ddPCR من cDNA الفيروسية.

لا. من دورات 1 39 1
درجة الحرارة (°C) 95 95/54.5 98 4
الوقت 10 دقيقة 30 دقيقة/دقيقة 10 دقيقة

الجدول 7: برنامج ddPCR المتعلق بفيروس نقص المناعة البشرية. برنامج ركوب الدراجات PCR المستخدمة لتضخيم الحمض النووي الريبي الفيروسي.

راليغرافير (رال) 4800 ملغم/كغ
تينوفوفير ديسوبروكسيل فومارات (TDF) 720 ملغم/كغ
Emtricitabine (FTC) 520 ملغم/كغ

الجدول 8: الماوس cART تشاو النظام الغذائي. وقد وضعت حمية تشاو الماوس كما نشرت سابقا21. وقدم النظام الغذائي تشاو على قاعدة من تشاو الماوس القياسية، وبعد الإنتاج، وكان الغذاء- تشعيع مع 25 kGy ومزدوج معبأة. تم تخزين الطعام عند -20 درجة مئوية حتى الاستخدام.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

سلالة الفأر المنقوصة بشدة NOD. Cg-كوريادscidIl2rgtm1Sug/JicTac (NOG) هو مناسب للغاية لزرع الخلايا والأنسجة البشرية. يتم اختراق كل من المسارات المناعية الفطرية والتكيفية في هذه الفئران. NOG والفئران NSG تؤوي طفرةمبيد ة Prkdc التي تؤدي إلى وظيفة خلية T و B معيبة. وعلاوة على ذلك، تفتقر هذه الفئران إلى سلسلة مستقبلات إنترلوكين-2 الوظيفية (سلسلة غاما المشتركة، IL2rg) التي لا غنى عنها في مجمعات ملزمة للعديد من السيتوكينات الرئيسية مثل IL-2، IL-4، IL-7، IL-9، IL-15، وIL-21. الفئران الفيولفيت، مثل NOG، المزروعة مع جهاز المناعة البشري هي أداة قوية لدراسة انتقال فيروس نقص المناعة البشرية وعلم المناعة. وقد استعرضت المساهمات في هذه المجالات باستخدام الفئران أنسنة على نطاق واسع2،23،24،25،26. استخدام هذه الفئران لدراسة الاستجابات المناعية الفطرية البشرية تكتسب أيضا اهتماما متزايدا27،28.

الهدف من هذه المخطوطة هو توفير بروتوكول شامل من إجراءات الماوس وddPCR للانتقال من الماوس الساذج إلى بيانات نقل فيروس نقص المناعة البشرية والعلاج. استخدم نظامنا ddPCR للقياس الكمي للحمض النووي الريبي الفيروسي والحمض النووي. في رد فعل ddPCR ، يتم تقسيم المواد المتفاعلة إلى ما يصل إلى 20،000 قطرات ، يحتوي كل منها على تفاعل واحد منفصل من PCR. تضخيم الهدف داخل قطرة يؤدي إلى إشارة الفلورسنت إيجابية لتلك القطرات. وبالتالي ، فإن القراءة ثنائية وعن طريق تطبيق التحليلات الإحصائية بواسون ، يمكن ترجمة عدد ردود الفعل الإيجابية مباشرة إلى عدد من نسخ القالب في العينة الأصلية. تكمن فائدة ddPCR في قدرته على تحديد الهدف بشكل مباشر بشكل مستقل عن منحنى قياسي. هذا هو جذاب بشكل خاص عند تحليل عينات الجيش الملكي النيبالي التي تشكل تحديا للاستفادة من المنحنيات القياسية PCR بسبب طبيعتها labile29. وعلاوة على ذلك، من خلال تحليل النسخ المتماثلة متعددة من نفس العينة ودمج نقاط البيانات الفردية للقياس الكمي العينة النهائية، الطبيعة الثنائية لddPCR يجعل من الممكن لخفض حد الكشف عن نسخ القالب لكل مل من العينة29. هذا مهم بشكل خاص في إعداد الماوس الإنساني ، حيث تتوفر مواد عينة محدودة فقط وتتطلب حساسية عالية.

يمكن أن يتم إدارة cART للفئران أنسنة إما عن طريق الفم gavage أو الحقن داخل البلغية مع حلول cART30،31،32، وكما هو مبين مؤخرا ، عن طريق صياغة في النظام الغذائي21. كان أحد أهدافنا الرئيسية هو تنفيذ نظام cART في النظام الغذائي للفأر للحد من الضغط المحتمل على الحيوانات بسبب خطوات المناولة الإضافية الكامنة في طرق توصيل الأدوية الأخرى. يمكن تقدير جرعة الدواء التي سيأكلها الفأر بدقة استنادًا إلى متوسط المدخول الغذائي اليومي للفئران33. التسليم عن طريق الفم من خلال النظام الغذائي بمثابة أسهل طريق التسليم مع كل من الحد الأدنى من الإجهاد للللحيوانات والحد الأدنى من عبء العمل للمعالج. استندنا مزيجنا من الأدوية المضادة للفيروسات على الدراسات المنشورة السابقة في الفئران أنسنة21،30. وعلاوة على ذلك، لدينا استراتيجية cART ذات الصلة سريريا بالنظر إلى أن تركيبة الدواء المستخدمة سريريا تدار شفويا من قبل المرضى في جميع أنحاء العالم.

ويلاحظ بعض القيود فيما يتعلق باستخدام الفئران NOG. الأهم من ذلك ، تزرع الخلايا التائية البشرية في هذه الفئران في بيئة ثيوم الماوس ، بدلا من البيئة البشرية. وينصب التركيز مؤخرا على توليد سلالات xenorecipient التي لديها بيئة مواتية لتطوير استجابات قوية المناعية البشرية. وتشمل هذه السلالات الجديدة الفئران نقص المناعة التي هي المعدلة وراثيا لجزيئات MHC الإنسان، مثل A2. تمكن هذه النماذج HLA المقيدة مستضد الاستجابات الخلايا التالتي التي تؤدي إلى تحسين النضج ووظائف التأثير من نظام المناعة التكيفية34. نهج آخر هو استبدال جينات الماوس مع السيتوكينات البشرية الرئيسية لIL-3/GM-CSF35،IL-636،IL-1537،TPO، M-CSF38،وIL-7/TSLP31. وقد اكتسبت هذه النماذج اهتماما متزايدا لقدرتها على توليد تمييز أفضل لأنواع الخلايا الفطرية. بروتوكولنا هو قابل للتكيف بسهولة لإضفاء الطابع الإنساني والعدوى بفيروس نقص المناعة البشرية من الفئران باستخدام أي من هذه السلالة الوراثية المعززة نقص المناعة الوراثية.

وخلاصة القول إن سهولة وفائدة النهج الموصوف تيسر إجراء البحوث في الميادين المتصلة بفيروس نقص المناعة البشرية في الجسم الحي. يمكن أن تكون الفئران الأنسّمة أداة قوية جدًا في توجيه الأبحاث نحو توليد فرضيات بحثية أفضل. وإلى جانب توليد المزيد من الفئران الإنسانية "البشرية" مع الجينات البشرية، نعتقد أن بروتوكولنا الموحد سيسهم في تبسيط الإجراءات التجريبية عبر بيئات بحثية مختلفة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ولا يعلن صاحبا البلاغ أي تضارب في المصالح.

Acknowledgments

ويود المؤلفون أن يشكروا موظفي مرفق الطب الحيوي للحيوانات في جامعة آرهوس، ولا سيما السيدة جاني كور على جهود صيانة المستعمرات وتتبع أوزان الفئران. ويود المؤلفون أن يشكروا البروفيسور فلوريان كلاين على تطويره معيار الرعاية وللتوجيه. تم الحصول على الكاشف التالي من خلال برنامج كاشف الإيدز في المعاهد القومية للصحة، شعبة الإيدز، NIAID، المعاهد القومية للصحة: pRHPA.c/2635 (القط رقم 11744) من الدكتور جون كاباس والدكتورة كريستينا أوكسنباور.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics