Гуманизированные мыши NOG для интравагинального воздействия ВИЧ и лечения ВИЧ-инфекции

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Мы разработали протокол для генерации и оценки гуманизированной и человеческой иммунодефицита, зараженной вирусом NOG, мышиной модели на основе трансплантации стволовых клеток, внутривагинального воздействия вируса иммунодефицита человека и капель цифровой РНК ПЦР Количественная оценка.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Гуманизированные мыши обеспечивают сложную платформу для изучения вирусологии вируса иммунодефицита человека (ВИЧ) и тестирования противовирусных препаратов. Этот протокол описывает создание иммунной системы человека у взрослых мышей NOG. Здесь мы объясняем все практические шаги от изоляции пуповинной крови, полученных клетками CD34 человека и их последующей внутривенной трансплантации мышам, до манипуляции моделью через ВИЧ-инфекцию, комбинированной антиретровирусной терапии ( cART), и анализ крови. Приблизительно 75 000 hCD34 'клеток вводятся внутривенно в мышей и уровень человеческого химеризма, также известный как гуманизация, в периферической крови оценивается продольно в течение нескольких месяцев поток цитометрии. В общей сложности 75 000 клеток hCD34 дают 20%-50% клеток CD45 человека в периферической крови. Мыши восприимчивы к интравагинальной инфекции с ВИЧ и крови можно сделать один раз в неделю для анализа, и два раза в месяц в течение длительных периодов. Этот протокол описывает анализ для количественной оценки плазменной вирусной нагрузки с помощью капель цифрового ПЦР (ddPCR). Мы показываем, как мышей можно эффективно лечить с помощью стандартного режима cART в рационе. Доставка CART в виде обычного мышиного чау является значительной усовершенствованием экспериментальной модели. Эта модель может быть использована для доклинического анализа как системных, так и актуальных предэкспозиционных профилактических соединений, а также для тестирования новых методов лечения и стратегий лечения ВИЧ.

Introduction

Вирус иммунодефицита человека (ВИЧ) является хронической инфекцией с более чем 37 миллионов инфицированных людей во всем мире1. Комбинированная противовирусная терапия (cART) является спасительной терапией, но лечение по-прежнему оправдано. Таким образом, существует потребность в моделях животных, которые отражают иммунную систему человека и ее реакцию, с тем чтобы облегчить продолжение исследований в области ВИЧ. Несколько типов гуманизированных мышей, которые способны поддерживать клетки и ткани прививок были разработаны путем трансплантации человеческих клеток в сильно иммунодефицитных мышей2. Такие гуманизированные мыши подвержены ВИЧ-инфекции и являются важной альтернативой нечеловеческим моделям вирусов иммунодефицита приматов, поскольку они дешевле и проще в использовании, чем нечеловеческие приматы. Гуманизированные мыши способствовали исследованиям в области передачи вируса ВИЧ, патогенеза, профилактики и лечения3,4,5,6,8,9,10,11.

Мы представляем гибкую гуманизированную модельную систему исследований в области ВИЧ, разработанную путем пересадки пуповинной крови, полученных человеческими стволовыми клетками, мышам NOD. CG-PrkdcscidIl2rgtm1Sug/JicTac (NOG) фон. Помимо того, что нефетального происхождения, практическая биоинженерия этих мышей является менее технически требовательным по сравнению с микрохирургических процедур, участвующих в трансплантации крови печени-тимуса (BLT) построить.

Мы показываем, как установить ВИЧ-инфекцию с помощью интравагинальной передачи и как контролировать вирусную нагрузку плазмы с помощью чувствительной капли цифровой ПЦР (ddPCR) на основе установки. Впоследствии мы описываем создание стандартного CART, данного как часть ежедневной диеты мыши. Цель этих комбинированных методов заключается в снижении стресса для животных и содействовать крупномасштабным экспериментам, где время, затраченное на обработку каждого животного ограничено12.

У людей, CCR532 /WT или CCR5No32 / 32 генотип вызывает снижение восприимчивости к ВИЧ-инфекции с передатчиком / основателем вирусов13, и некоторые меры предосторожности должны быть приняты при биоинженерии гуманизированных мышей со стволовыми клетками для целей исследований ВИЧ. Это особенно верно в нашем регионе, потому что естественные варианты в гене CCR5, в частности, удаления 32 евро, более распространены в скандинавских и балтийских коренных народов по сравнению с остальным миром14,15. Таким образом, наш протокол включает в себя простой, высокопроизводительный анализ для скрининга донорских гематопоиетических стволовых клеток для вариантов CCR5 до трансплантации.

Для интравагинального воздействия мы выбрали передатчик / основатель R5 вирус RHPA4259, изолированные от женщины на ранней стадии инфекции, которая была инфицирована интравагинально16. Мы подвергли мышей вирусной дозе, которая была достаточна для успешной передачи у большинства мышей, но ниже 100% скорости передачи. Выбор такой дозы обеспечивает достаточный динамический диапазон в скорости передачи, что противовирусные эффекты кандидата на наркотики могут привести к защищенным животным в экспериментах по профилактике ВИЧ и снижению вирусной нагрузки для лечебных исследований.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все образцы пуповинной крови были получены в строгом соответствии с утвержденными на месте протоколами, включая информированное согласие родителей на анонимное донорство. Все эксперименты на животных были одобрены и проведены в строгом соответствии с датскими национальными правилами в соответствии с лицензией 2017-15-0201-01312.

ВНИМАНИЕ: С крайней осторожностью с ВИЧ-инфицированными мышами и кровью. Обеззараживание всех поверхностей и жидкостей, которые были в контакте с ВИЧ с подтвержденным ВИЧ дезинфицирующим средством(Таблица материалов).

1. Изоляция стволовых клеток человека CD34

  1. Сбор образцов пуповинной крови в EDTA покрытием трубки сбора крови после запланированных кесарева сечения или вагинальных родов и в соответствии с местными этическими утверждениями.
  2. Изолировать PMBCs от пуповинной крови плотности градиента разделения в соответствии с протоколом производителя.
  3. Изолировать клетки CD34 "из популяции PBMC путем предварительного обогащения антителами против общих маркеров для зрелых клеток, что вызывает перекрестное соединение клеток нежелательных линий с красными кровяными клетками. За этим следует обогащение клеток CD34 с использованием магнитных бусинок, согласно протоколу производителя.
    1. Определите количество живых клеток стандартным синим исключением trypan, повторно приостановив 10 злиц суспензии клеток в 90 Зл трипан синий. Добавьте 10 кЛ этого раствора к гемаситометру и подсчитайте несиние клетки, согласно протоколу производителя.
    2. Viably криоконсервации CD34 "клетки в 1 мл 10% DMSO в сыворотке крови плода (FBS) до дня трансплантации мыши.
    3. Viably криоконсервирует небольшую часть как изолированных (CD34) и сквозных клеток (CD34-) отдельно для оценки чистоты стволовых клеток CD34 (30 000 клеток каждого образца). Кроме того, проверьте чистоту на свежеобогащенных клетках (см. шаг 2 ниже).
    4. Заморозить часть не-гранулированного потока через (CD34-) для определения статуса CCR5No32. Клетки могут быть заморожены непосредственно без условного замораживания раствора, но наличие красных кровяных телец в гранулы могут препятствовать последующей ПЦР, если поток через гранулы.

2. Оценка чистоты стволовых клеток CD34 » с помощью цитометрии потока

  1. Оттепель изолированных ячеек (CD34) и сквозных клеток (CD34-). Вымойте клетки, отостановив клетки из каждого флакона в 9 мл буфера FACS комнатной температуры (RT), состоящего из 2% сыворотки крупного рогатого скота плода (FBS) в фосфат-буферированном сольне (PBS).
  2. Центрифуга в течение 5 мин при 300 х г на RT, чтобы пеллетные клетки.
  3. Слейте супернатант, resuspend клетки в оставшейся жидкости и передачи FACS труб. Повторите шаг стирки с 3 мл буфера FACS. После второго центрифугирования вылейте супернатант и повторно затяните клетки в оставшуюся жидкость.
  4. Добавьте 5 Зл из fc Receptor блокирующего раствора(Таблица материалов)и оставьте на 10 мин на RT. Не смойте блокирующий раствор FC Receptor.
  5. Добавьте смесь, содержащую предопределенные объемы антител против человека CD3 (клон SK7) BUV395, CD34 (клон AC136), FITC и CD45 (клон 2D1) APC (Таблица 1). Оставьте клетки на 30 минут на RT в темноте. Флюорофоры должны быть выбраны на основе параметров, которые могут быть оценены с имеющимися цитометрами потока, не требуя матрицы компенсации.
  6. Вымойте ячейки с 3 мл буфера FACS.
  7. Центрифуга в течение 5 мин при 300 х г на RT, чтобы гранулы клетки.
  8. Слейте супернатант и resuspend клетки в оставшейся жидкости.
    1. Повторите этот шаг стирки 2x, чтобы убедиться, что все несвязанные антитела были удалены.
  9. Запишите образцы на цитометр потока(Таблица материалов)и выполните анализ данных с соответствующим программным обеспечением. Стратегия gating представлена на рисунке 1A-F.

3. Генетический скрининг на варианты CCR5No32 в пуповинной крови

  1. Инкубировать 1,25 л негралетированного проточного потока с 11,25 л смеси ПЦР, содержащей 200 мкм смеси dNTP, 0,01 U/L высокой полимераза ДНК-полимераза, а также передние и обратные грунтовки, описанные в таблице 2.
    1. Отрегулируйте громкость с нуклеазой воды примерно до 12,5 л для каждой реакции ПЦР.
  2. Усилируйте геномные фрагменты с помощью велосипедной программы PCR, подробно описанной в таблице 3.
  3. Отделить продукты ПЦР на 2% агарозный гель13.
    1. Продукты ПЦР из аллелей дикого типа и аллели No32 дают фрагменты ПЦР из 196 базовых пар и 164 базовых парных диапазонов соответственно, что делает их легко различимыми по гелю электрофорасису13 (Рисунок 1G).

4. Внутривенная трансплантация стволовых клеток

ПРИМЕЧАНИЕ: Имея один человек подготовить клетки в лаборатории, а другой человек подготовить мышей и рабочее пространство для трансплантации является эффективным подходом.

  1. В животном учреждении, 4-6 ч до запланированной трансплантации стволовых клеток, облучать 6-7 недельных самки NOD. Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG) мыши (Таблица материалов) с 0,75 Gy с cs137 источник. Лучшая доза предварительного кондиционирования может варьироваться в зависимости от возраста мыши, источника радиации и других факторов. Этот процесс условия животных для успешного прививки с человеческими стволовыми клетками.
  2. В животном объекте, подготовить поток скамейке рабочего пространства и всех реагентов, прежде чем мышей или клеток в рабочее пространство.
    1. Поместите стерильную синюю площадку, чтобы покрыть рабочую поверхность скамьи потока. Приготовить стерильную марлю и острый контейнер.
    2. Поместите отопительную лампу, продифицированную 70% этанолом, в скамейку с пустой стерильной клеткой мыши под жарой.
  3. В лаборатории оттепель изолировала клетки CD34 и разбавляла их в 9 мл из 37 градусов по Цельсию.
  4. Центрифуги клетки на 350 х г в течение 5 минут на RT, отбросить супернатант по аспирации, и resuspend гранулы в 1 мл простой RPMI на 37 градусов по Цельсию.
  5. Определите количество клеток путем исключения trypan Blue и отрегулируйте громкость до 200 зл на мышь. Сделать дополнительные, чтобы принять во внимание возможные потери из-за последующих шагов обработки.
    1. Приготовьтесь к пересадке 75 000 клеток CD34 на 200 л в каждую мышь.
    2. Клетки могут храниться при 4 градусах Цельсия во время транспортировки на животное до пересадки. Избегайте держать клетки на льду, чтобы уменьшить агрегацию или слипания.
  6. В животном объекте, принести клетку с мышами в поток скамейке и передачи мышей в клетку под нагревательной лампой, чтобы удлинить кровеносные сосуды. Оставьте один конец клетки от источника тепла, так что мыши могут отойти от тепла, когда становится тепло. Мыши, которые переехали в конце клетки, вдали от источника тепла, достаточно тепло для успешного инъекции хвостовой вены.
  7. Загрузите 1 мл смазанного шприца выше отметки 800 л с подвешенными клетками CD34. Использование смазованного шприца 1 мл значительно облегчит внутривенную инъекцию и повысит точность этой техники.
  8. Прикрепите иглу 30 G 13 мм и приготовьте иглу и шприц для инъекций. Этот порядок работы позволяет быстрее загружать шприц, защищая целостность клеток, которые будут пересажены, учитывая возможный ущерб, который может произойти во время быстрого устремления клеток через такую небольшую калибровочную иглу. Заполните иглы концентратор с жидкостью, нажав поршень и удалить жидкость до 200 л знак иглы.
  9. Поместите нагретую мышь (шаг 4.6) в удерживающий, используемый для предоставления инъекций IV. Тщательно введите 200 л клеточной подвески в хвостовую вену мыши. Потратьте 2 s выполняя погружение и держите иглу введенную для приблизительно 2 s после завершения впрыска. Это гарантирует, что клетки мигрировали адекватно далеко от места инъекции до удаления иглы.
  10. По мере необходимости протрите хвост мыши стерильной марлей, чтобы удалить видимую кровь. Положите мышь обратно в неотапливаемую домашнюю клетку. Повторите процедуру инъекций с оставшимися мышами.

5. Сбор и обработка крови для анализа

ПРИМЕЧАНИЕ: Привляние клеток человека в периферической крови может быть оценено с помощью цитометрии потока 3-5 месяцев после трансплантации стволовых клеток человека.

  1. Нарисуйте образцы крови у мышей, используя местные методы, одобренные IACUC.
  2. Соберите максимум 70-100 л общей крови в стерильные микроцентрифугные трубки ПЦР, содержащие 10 кЛ 0,5 М ЭДТА (рН 8,0), чтобы избежать свертывания крови.

6. Оценка антропогенного прививки с помощью цитометрии потока

  1. Перенесите 40-50 л крови в трубки FACS.
  2. Добавьте 5 Зл блокирующего раствора fc Receptor, чтобы предотвратить неспецифические связывания антител и оставить на 10 мин на RT.
  3. Добавить смесь античеловеческих антител мыши, содержащую CD4 (клон SK3) BUV 496, CD8 (клон RPA-T8) BV421, CD3 (клон OKT3) FITC, CD19 (клон sj25c1) PE-Cy7, CD45 (клон 2D1) APC (Таблица 4) и оставить пятно в темноте на RT в течение 30 мин. Фторофоры должны быть выбраны на основе параметров, которые могут быть оценены с имеющимися цитометрами потока без необходимости матрицы компенсации.
  4. Добавьте 2 мл соответствующего буфера излжания красных кровяных телец к каждой трубке, чтобы линзировать красные кровяные тельца. Используйте буфер лисиса, специально сформулированный для окрашивания антител до получения ириса красных кровяных телец (подходящий пример приведен в таблице материалов). Vortex кратко обеспечить равное распределение клеток в растворе lysing и выйти на 10 мин на RT. Равное распределение клеток имеет важное значение.
  5. Добавьте 2 мл буфера FACS, чтобы остановить реакцию лиза.
  6. Центрифуга в течение 5 мин при 300 х г на RT, чтобы гранулы клетки.
  7. Слейте супернатант и вихрь осторожно, пока клетки не будут восстановлены.
  8. Добавьте 3 мл буфера FACS и центрифугу в течение 5 мин при 300 х г на RT.
  9. Слейте супернатант и resuspend клеток.
  10. Запись образцов на соответствующий цитометр потока и анализировать с помощью соответствующего программного обеспечения(Таблица материалов). Представительный анализ и результаты изображены на рисунке 2 и рисунке 3.

7. Интравагинальное воздействие ВИЧ

ПРИМЕЧАНИЕ: Вирус, используемый для интравагинального воздействия мышей может быть произведен с использованием ранее опубликованных протоколов17. Вирус хранится при -80 градусов по Цельсию и транспортируется между местами, хранящихся на сухом льду в соответствии с утвержденными на местном уровне протоколами. Вирус хранится на сухом льду до непосредственного контакта с мышами. Вирус может быть разбавлен в простой RPMI (избегайте RPMI, который антибиотиков или сывороточных добавок) для достижения соответствующей концентрации непосредственно перед воздействием (21400 МЕ были использованы для этого воздействия IVAG). После того, как генерируется, держать разбавленный запас на мокром льду на протяжении всей процедуры, чтобы избежать замораживания оттепели циклов, которые будут происходить, если разбавленный вирус был помещен обратно на сухой лед после таяния.

  1. Подготовьте все оборудование и пространство скамейки потока, как представлено на рисунке 4, прежде чем принести мышей или вирус овстоков (по аналогии с шагом 4.2).
    1. Поместите фокус нагревательной лампы в центре рабочего пространства, где мышь будет расположена во время процедуры воздействия ВИЧ. Отопительная лампа не обеспечит понижения температуры тела мышей. Другое оборудование, которое контролирует температуру также могут быть использованы, (например, подогревом гель площадку или циркулирующих теплой воды одеяло, в соответствии с местными правилами IACUC18).
    2. Принесите стерильные 20 юл пипетки советы и соответствующие пипетки в скамейке. Поместите контейнер с жидким дезинфицирующим средством(Таблица материалов)на скамейке для немедленной инактивации материалов и жидкостей, которые были в контакте с вирусом.
  2. Поместите мышь в камеру с 3% изофруран газа и бумажных полотенец. Этот процент газа будет анестезируть животных в течение 2-4 мин. Как и все другие материалы, используемые с иммунодефицитных мышей, анестезии аппарат должен быть должным образом дезинфицировать перед использованием.
  3. После обеззараживания перенесите мышь на стерильную синюю площадку под нагревательной лампой. Вставьте мышь музы в маску, снабжающую непрерывным 3% изофларанным газом для поддержания анестезии. Держите мышь у основания хвоста, живот вверх, с рукой поддержки мыши обратно, как показано на рисунке 4.
  4. С стерильной кончиком пипетки, стимулировать область половых органов, мягко поглаживая вверх к анусу, чтобы вызвать опорожнение прямой кишки, снимая давление на влагалище.
  5. Тщательно обнажить вагинального отверстия, обернув хвост мыши через пальцы, так что вульвы естественно открывается, возможно, с небольшим подталкивание с помощью стерильных кончик пипетки.
  6. Изменение пипетки наконечник и пипетка 20 зл и л вируса травматически во влагалище мыши, не создавая пузырьков. Не вставляйте кончик глубоко во влагалище. Скорее, с вульвы открыт, место пипетка наконечник на уровне вагинального отверстия, избежать углубляясь, чтобы устранить потенциал для ссадин во время процесса прививки, освободить вирус, и позволяют тяжести тянуть вирус во влагалище. Кроме того, используйте 22 G 1,25 мм тупой конец, прямая игла, как описано в Веселинович и др.6.
  7. Сохранить мышь в этом положении с влагалищем лицом вверх в течение 5 минут после воздействия, чтобы избежать гравитации индуцированной утечки вируса суспензии.
    1. Аккуратно поместите мышь в домашнюю клетку, заботясь о том, чтобы поместить мышь на спину.

8. Обработка образцов крови до анализа вирусной нагрузки

  1. Соберите кровь, как описано в разделе 5 выше.
  2. Centrifuge образцы крови в течение 5 мин на 500 х г на RT, чтобы отделить плазму и клетки.
  3. Соберите 40 qL плазмы для измерения вирусной нагрузки в новую стерильную трубку микроцентрифуги, одобренную ПЦР, и храните при температуре -80 градусов по Цельсию в течение по крайней мере 1 ч до дальнейшей обработки. Важно заморозить все образцы до извлечения РНК, чтобы избежать риска смещения от сравнения уровней РНК в образцах, которые не были заморожены до изоляции РНК в образцах, замороженных до изоляции РНК.
  4. Отрегулируйте объем крови обратно к первоначальному объему, добавив 40 qL суспензии средств (PBS с 2,5% бычьего сыворотки альбумина, 50 U/mL пенициллин G и стрептомицин, и 10 U/mL DNase, стерильные фильтруется на 0,22 мкм).
  5. Перенесите 15 зл скорректированного объема крови в новую одобренную ПЦР микроцентрифугу трубку.
  6. Добавьте 1 мл из 1x решения для лизиса РБК(Таблица материалов),вихрь, и инкубировать в течение 10 минут на RT.
  7. Центрифуга в течение 1 мин при 9600 х г на RT, чтобы пеллеты клеток.
  8. Аспирсупернатан тихие и оставить только крошечные белые клетки гранулы, потому что загрязнение красных кровяных клеток может препятствовать ПЦР.
  9. Храните гранулы при -80 градусах по Цельсию не менее 1 ч до дальнейшей обработки.
    ПРИМЕЧАНИЕ: Дополнительно, любая оставшаяся кровь от шага 8.4 может быть использована для анализа цитометрии потока, как описано выше в шаге 6.

9. Экстракция ДНК с использованием метода экстракции протеиназа K

  1. Извлеките ДНК из периферальных клеточных гранул (генерируется в шаге 8.8) с помощью метода экстракции K экстракции, как описано ниже. Этот метод был продемонстрирован для извлечения наивысшего выхода ДНК из небольшого объема крови, таких как, что требуется для серийных коллекций крови, используемых в этом исследовании19.
  2. Добавьте 25 л протеиназы K (20 мкг/мл) к 1 мл буфера 0,1 М. Трис.
  3. Vortex раствор протеиназа K кратко.
  4. Добавьте 50 зл и раствор протеиназа K к каждой клетке гранулы, которые будут перевариваться.
  5. Смешайте путем pipetting вверх и вниз и подтвердить повторное приостановление клеточной гранулы.
  6. Встряхните на термошейкере(Таблица материалов) при 400 об/мин (в зависимости от прибора) при 56 градусах по Цельсию на 1 ч. Лента трубки вниз, чтобы держать их на месте, если это необходимо.
  7. Немедленно и в том же термошейкере инактивируйте протеиназы K с перепадом температуры до 95 градусов по Цельсию, в то время как встряхивание продолжается еще 20 мин.
  8. Вихрь каждого образца.
  9. Поместите каждый образец при -80 градусов по Цельсию в течение как минимум 30 минут.
  10. Оттепели, затем центрифуги образцов на 17000 х г в течение 1 мин на RT, чтобы гранулы нежелательных клеточных фрагментов.
  11. Поместите ДНК-содержащий супернатант в новую микроцентрифуговую трубку.
  12. Шаблон ДНК готов к ПЦР. Шаблоны ДНК могут храниться при -80 градусов по Цельсию.

10. Экстракция РНК, синтез кДНК и количественная оценка вирусной РНК

  1. Изолировать РНК от размороженной плазмы мыши с вирусом РНК изоляции комплекта после протокола производителя (Таблица материалов).
  2. После добавления образца в столбец, добавьте на колонке DNase шаг лечения для обеспечения удаления всех ДНК в плазмеобразной образце.
    1. Для каждого образца добавьте 95 кЛ раствора DNase, свободного от RNase (смесь 2 l РНАЗе без DNase и 98-Л реакционный буфер) в столбец и инкубировать в течение 15 минут на РТ.
  3. Храните образцы РНК при -80 градусах по Цельсию, по крайней мере, 1 ч перед дальнейшей обработкой. Важно заморозить все образцы после извлечения РНК избежать риска смещения при сравнении образцов, которые не были заморожены в образцах, которые были заморожены.
  4. Синтезировать cDNA с помощью обратного шага транскриптазы с использованием реагентов, как описано ранее20. Убедитесь в том, чтобы добавить 0,5 л ингибитора RNase к реакции кДНК, чтобы избежать деградации РНК.
    1. Выполните синтез кДНК с программой, подробно описанной в таблице 5.
  5. Храните образцы кДНК при -80 градусах по Цельсию не менее 1 ч. Важно заморозить все образцы после синтеза кДНК, чтобы избежать риска предвзятости при сравнении образцов, которые не были заморожены с образцами, которые были заморожены.
  6. Подготовка образцов для ddPCR следующимобразом:
    1. Смешайте 3 злицу образца кДНК с 11 зл и смесью зонда ddPCR (без dUTP)20, 250 нм минорный паз-связывающий зонд, и 900 нМ каждого из передних и обратных грунтовок, как описано в таблице 6.
    2. Отрегулируйте общий объем ПЦР до 22 кв.м с нуклеазой-бесплатной водой.
  7. Эмульгировать PCR смеси с droplet Generation Oil для зондов на капельном генераторе в соответствии с протоколом производителя и предыдущими описаниями20.
  8. Выполнить программу PCR, как подробно описано в таблице 7.
    ПРИМЕЧАНИЕ: Последовательности праймера/зонда и программы ПЦР, отображаемые здесь, были специально разработаны и оптимизированы для чувствительного выявления штамма ВИЧ RHPA4259. Последовательности праймеров и зондов могут быть легко скорректированы для обнаружения любого другого штамма ВИЧ по своему выбору.
  9. Обнаружить флуоресценцию капель из образцов на считывателе капель и проанализировать результаты с соответствующим программным обеспечением в соответствии с протоколом производителя.

11. Лечение С АРТ-содержащих чау

  1. Кормите мышей гранулами, содержащими стандартный режим CART, содержащий 4800 мг/кг ралтегравир (RAL), 720 мг/кг тенофовир дисопроксил фумерат (TDF), и 520 мг/кг эмтрицитабин (FTC)21 (таблица 8). Эти дозы были определены при условии, что мышь весит 25 г и ест 4 г чау в день. Это соответствует суточной дозе 768 мг/кг RAL, 2,88 мг/кг TDF и 83 мг/кг FTC21.
  2. Используйте диету cART, которая была подготовлена внешним поставщиком (см. Таблица материалов) отпускаемых по рецепту лекарств. Другие компании потенциально могут также производить этот режим. Используйте диету cART красного цвета, чтобы легко отличить его от обычной мыши чау.
    1. Производить контроль чау диеты без CART в стандартный коричневый цвет для легкого различия.
  3. Для начала cART, подготовить стерильные клетки мыши с добавлением CART-содержащих чау диеты, а затем передать мышей из старой клетки в новую клетку.
    1. Мониторинг веса мышей и потребления CART-содержащих чау путем визуального осмотра, чтобы убедиться, что мыши приспосабливаются к изменению.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Стратегия анализа чистоты стволовых клеток изображена на рисунке 1. На рисунке 1A-C показана очищенная популяция CD34, а рисунок 1D-F CD34- поток, используемый для иллюстрации того, что минимальное количество популяции CD34 теряется в процессе изоляции. Чистота изолированных стволовых клеток CD34 была между 85%-95% с менее чем 1% Т-клеток загрязнения. На рисунке 1G изображены полосы CCR5 от одного взрослого донора управления человеком с генотипом CCR5No32/Wt, за которыми следуют полосы от двух доноров CCR5wt/wt и одного CCR5No32/WT стволовых клеток доноров. Частота генотипа CCR5No32/WT в группе из 19 доноров составила 15,8%(рисунок 1H). Это в согласии с более крупными эпидемиологическими исследованиями14,15 отчетности генотипа в до 23,6% исследованных лиц в Дании.

Уровни CD45 у человека в периферической крови мышей оценивались с помощью цитометрии потока через 3-5 месяцев после трансплантации стволовых клеток человека CD34. Стратегия gating представлена на рисунке 2A-E. Рисунок 3А и рисунок 3В иллюстрируют изменчивость между 10 и 16 отдельными мышами, получающими стволовые клетки от двух разных доноров. Трансплантация 75 000 клеток hCD34 дала 20%-50% человеческого CD45 в периферической крови. Все мыши разработали человеческие В и Т-клетки, в том числе как CD4- и CD8 "Т-клеток.

Для травматического интравагинального воздействия была использована установка, изображенная на рисунке 4. Мышей обезболивали в закрытой камере и держали под наркозом во время облучения. Мыши были проведены с влагалищем вверх в течение 5 минут после воздействия для обеспечения взаимодействия вирусного раствора с слизистыми поверхностями.

На рисунке 5А показано, что 64% случаев успешности передачи ВИЧ наблюдается с помощью этой модели. Мыши были оспорены с 21400 инфекционных единиц (IU) RHPA4259 интравагинально. Эта доза привела к тому, что 64% мышей заразились ВИЧ после вагинального воздействия. Для сравнения, данные из двух различных когорты мышей подвергаются через внутривенный маршрут включены. Как и ожидалось, 100% мышей стали ВИЧ-инфицированными с аналогичными дозами RHPA и дополнительным штаммом (YU2) с помощью этого маршрута.

На рисунке 5B изображены репрезентативные результаты трех мышей, которые были инфицированы ВИЧ и перешли на диету, содержащую стандартные CART. Мыши были переключены обратно в обычный мыши чау после 40 дней cART. В этой установке ассеа предел для обнаружения вирусной нагрузки составил 725 копий/мл. Вирусные нагрузки были все ниже предела обнаружения после 4 недель cART. После прекращения CART, вирус восстановился, отражая клинические данные22. Мыши на CART переносит изменения в диете, а также указано на рисунке 5C.

Figure 1
Рисунок 1: Представитель потока цитометрии gating стратегии для проверки чистоты стволовых клеток и CCR5 донорский вариант статуса. (A-C) Стратегия gating, используемая для изолированной популяции клеток CD34. Дублы и обломки исключены в панели A и B соответственно (FSC-A против FSC-H и FSC-A против SSC-A). (C) Частота CD34 "стволовых клеток и CD3" Т-клеток загрязнения. (D-F) Стратегия CD34-потока через gating. Проценты в воротах рассчитываются как доля родительской популяции. (G) Результаты CCR532 /WT PCR анализа. Лейн 1: ДНК от человека CCR5No32 /WT донора, полосы 2 и 3: два CCR5WT /WT доноров стволовых клеток человека, переулок 4: CCR5No32 /WT человека стволовых клеток донора. (H) Частота генотипа CCR5No32/WT в нашей группе из 19 образцов стволовых клеток составляет 15,8%. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Стратегия цитометрии потока для проверки прививок и дифференциации клеток человека. Общая популяция мононуклеаклеточных клеток у гуманизированных мышей была проанализирована с помощью цитометрии потока. (A) Процент клеток CD45 человека был определен как доля от общего числа зарегистрированных событий. (B) Даблты были впоследствии исключены на основе FSC-A/FSC-H gating. (C) Истинная популяция лимфоцитов была определена на основе размера и детализации. (D) Лимфоциты были затем охарактеризованы как либо CD3 "(Т-клетки) или CD19" (B-клетки). (E) CD3 "Т-клетки были либо CD4 "Т-клетки или CD8" Т-клетки. Проценты в воротах были рассчитаны как доля родительской популяции. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Представитель уровня гуманизации 4-5 месяцев после трансплантации стволовых клеток с клеточными подтипами фракций для 10 и 16 мышей, полученных от двух различных доноров человека. ()Моноядерная популяция клеток (MNC) от 10 и (B) 16 гуманизированных мышей были проанализированы с помощью цитометрии потока и закрыты, как представлено на рисунке 2. Доля клеток CD45 человека представлена как %hCD45 (всего MNC), а %B и %T -- клетки как фракция hCD45. Т-клетки были впоследствии разделены на %CD4 и %CD8. Каждая точка данных представляет собой одну мышь. Данные представлены в виде среднего значения sD. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Экспериментальная установка скамейки лаборатории для интравагинального воздействия мышей. Экспериментальная установка для воздействия ВИЧ гуманизированных мышей через интравагинальный маршрут. Процедура проводится на скамейке, где все реагенты и поверхности были стерилизованы до использования. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: Уровень передачи штамма ВИЧ через различные маршруты воздействия и эффективность и безопасность CART-содержащих чау в вирусном подавления. (A) Гуманизированные мыши NOG были успешно инфицированы двумя различными штаммами ВИЧ либо через интравагинальный или внутривенный маршрут. Мыши были выставлены с 21400 IUs RHPA4259 интравагинально, 5157 IUs IV с RHPA4259, или 3000 IUs IV с YU2. Подробная информация о IV воздействии гуманизированных мышей не включена в этот протокол. ВИЧ-инфекции успешно лечились с помощью режима CART, поставляемого через мышь чау. (B) Вирусная нагрузка снизилась до ниже обнаружения для всех трех мышей на CART и отскок появился после прекращения CART. Пунктирная линия указывает на предел количественной оценки в 725 экземпляров/мл. Мыши кормили cART чау был такой же вес развития, как мыши размещены на не-CART чау в течение того же периода времени, указывая не вкус предпочтения или побочные эффекты диеты CART. (C) Весы представлены как изменение склада по сравнению с началом CART. Каждая точка данных представляет собой среднее количество трех животных - SD. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Цель антител Клон Флюрофор
CD3 клон SK7 BUV395
CD34 клон AC136 FITC
CD45 клон 2D1 Apc

Таблица 1: Антитела, используемые для определения чистоты стволовых клеток. Предлагается многоцветная панель цитометрии потока для оценки чистоты стволовых клеток. В списке указаны цель антител, клон и фторфор.

Обнаружение CCR5-32 Грунтовки
Передняя грунтовка 5'CTTCATТАККСККККККККТ'3
Обратная грунтовка 5'TGAAGATAAGCCTCACACC'3

Таблица 2: CCR5 -32 вариант обнаружения ПЦР праймеры. Передние и обратные грунтовки, используемые для обнаружения удаления 32 bp в гене CCR5.

Нет. циклов 1 45 1
Температура (КК) 98 98/63/72 72 10
Время 30 с 10 с/30 с/15 с 5 мин.

Таблица 3: Программа обнаружения пЦР варианта CCR5-32. Велосипедная программа ПЦР, используемая для усиления гена CCR5.

Цель антител Клон Флюрофор
CD4 SK3 BUV 496
CD8 РПА-Т8 BV421
CD3 OKT3 FITC
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

Таблица 4: Антитела, используемые для определения гуманизации мыши. Предлагаемый многоцветный поток цитометрии панели для гуманизации. В списке указаны цель антител, клон и фторфор.

Нет. циклов 1 1
Температура (КК) 51 80 4
Время 45 мин. 15 мин.

Таблица 5: программа усиления кДНК. Программа, используемая для усиления дополнительной нити ДНК к вирусной РНК.

Количественная оценка ВИЧ Грунтовки
Передняя грунтовка 5'AGGGCAGCATAGAGAAAAa3
Обратная грунтовка 5'CAAAGGAATGGGGGTCTCTTT'3
Зонд FAM 5'ATCCCCACTCAACAGATGC'3

Таблица 6: праймеры по ВИЧ ddPCR. Праймеры и зонды, используемые для усиления ddPCR вирусной кДНК.

Нет. циклов 1 39 1
Температура (КК) 95 95/54.5 98 4
Время 10 мин. 30 с/1 мин 10 мин.

Таблица 7: Программа по ВИЧ ddPCR. Велосипедная программа ПЦР, используемая для усиления вирусной РНК.

Ралтегравир (RAL) 4800 мг/кг
Тенофовир disoproxil фуумат (TDF) 720 мг/кг
Эмтрицитабин (FTC) 520 мг/кг

Таблица 8: Мышь cART чау диета. Мышь чау диета была сформулирована как ранее опубликованные21. Чау-диета была сделана на основе стандартного мыши чау, и после производства, пища была облучена с 25 kGy и двойной мешок. Чау хранился при -20 градусов до использования.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Сильно иммунокомпромиссный штамм мыши NOD. CG-PrkdcscidIl2rgtm1Sug/JicTac (NOG) очень хорошо подходит для трансплантации человеческих клеток и тканей. Как врожденные, так и адаптивные иммунные пути у этих мышей скомпрометированы. NoG и NSG мышей гавани Prkdcнаучной мутации, что приводит к дефектной функции Т и B клеток. Кроме того, у этих мышей отсутствует функциональный интерлейкин-2 рецептор «Цепь» (общая гамма-цепь, IL2rg), который незаменим в связывающих комплексах многих ключевых цитокинов, таких как ИЛ-2, Ил-4, Ил-7, Ил-9, Ил-15 и Ил-21. Иммунодефицитные мыши, такие как NOG, пересаженные иммунной системой человека, являются мощным инструментом для изучения передачи ВИЧ и иммунологии. Вклады в этих областях, сделанные с использованием гуманизированных мышей были тщательно рассмотрены2,23,24,25,26. Использование этих мышей для изучения врожденных иммунных реакций человека также получить повышенное внимание27,28.

Целью данной рукописи является предоставление всеобъемлющего протокола процедур мыши и ddPCR, чтобы перейти от наивной мыши к данным о передаче и лечении ВИЧ. Наша система использовала ddPCR для количественной оценки вирусной РНК и ДНК. В реакции ddPCR реагенты разделены на до 20 000 капель, каждая из которых содержит одну отдельную микро-реакцию ПЦР. Усиление цели внутри капли приводит к положительному флуоресцентным сигналом для этой капли. Таким образом, считывание является двоичным и, применяя статистический анализ Пуассона, количество положительных реакций может быть непосредственно переведено на ряд копий шаблонов в первоначальном образце. Преимущество ddPCR заключается в его способности непосредственно количественно оконечной цели, независимой от стандартной кривой. Это особенно привлекательно при анализе образцов РНК, которые являются сложными для использования в качестве стандартных кривых ПЦР из-за их лабильной природы29. Кроме того, анализируя несколько копий одного и того же образца и объединяя отдельные точки данных для окончательной количественной выборки, двоичный характер ddPCR позволяет снизить предел обнаружения копий шаблонов на мл образца29. Это особенно важно в гуманизированной настройке мыши, где имеется лишь ограниченный образец материала и требуется высокая чувствительность.

Введение CART для гуманизированных мышей может быть сделано либо устные gavage или интраперитонеальных инъекций с растворами ТОРТ30,31,32, и, как показано недавно, путем формулировки в диете21. Одной из наших основных целей было внедрение режима CART в диете мыши, чтобы уменьшить потенциальную нагрузку на животных из-за дополнительных шагов обработки, присущих другим методам доставки лекарств. Доза лекарства, что мышь будет есть можно точно оценить на основе среднесуточного потребление пищи мышей33. Устная доставка через диету служит самым простым маршрутом доставки как с минимальным стрессом для животного, так и с минимальной нагрузкой для обработчика. Мы основывали нашу комбинацию противовирусных препаратов на предыдущих опубликованных исследованиях на гуманизированных мышах21,30. Кроме того, наша стратегия cART клинически актуальна, учитывая, что комбинированная комбинация лекарств, используемая клинически, перорально вводятся пациентами по всему миру.

Определенные ограничения отмечаются в отношении использования NOG мышей. Важно отметить, что человеческие Т-клетки у этих мышей культивируются в тимской среде мыши, в отличие от человеческой среды. В последнее время основное внимание уделяется генерации штаммов ксенорецией, которые имеют благоприятную среду для развития надежных иммунных реакций человека. Эти новые штаммы включают иммунодефицитных мышей, которые являются трансгенными для человеческих молекул MHC, таких как A2. Эти модели позволяют HLA-ограниченных антигенов Т-клеток ответы, которые приводят к улучшению созревания и эффектор функции адаптивной иммунной системы34. Другой подход заключается в замене генов мыши с ключевыми человеческими цитокинов для IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38, и IL-7/TSLP31. Такие модели получили повышенное внимание за их способность генерировать лучшую дифференциацию врожденных типов клеток. Наш протокол легко адаптируется для гуманизации и ВИЧ-инфекции мышей с использованием любого такого улучшенного генетического фонового иммунодефицита штамма.

Таким образом, простота и полезность описанного подхода облегчает проведение исследований в областях, связанных с ВИЧ, in vivo. Гуманизированные мыши могут быть очень мощным инструментом в руководстве исследований в направлении создания лучших гипотез исследования. Наряду с поколением более "человеческих" гуманизированных мышей с человеческими трансгенами, мы считаем, что наш стандартизированный протокол будет способствовать рационализации экспериментальных процедур в различных средах исследований.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не заявляют о конфликте интересов.

Acknowledgments

Авторы хотели бы поблагодарить сотрудников Фонда биомедицины животных Орхусского университета, в частности г-жу Джани Кер за усилия по содержанию колоний и за отслеживание веса мышей. Авторы хотели бы поблагодарить профессора Флориана Кляйна за разработку стандарта медицинской помощи и за руководство. Следующий реагент был получен в рамках программы NIH AIDS Reagent, Отдел по СПИДу, NIAID, NIH: pRHPA.c/2635 (кошка 11744) от д-ра Джона Каппеса и д-ра Кристины Охсенбауэр.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics