Gehumaniseerde NOG Muizen voor intravaginale HIV Blootstelling en behandeling van HIV-infectie

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

We hebben een protocol ontwikkeld voor de generatie en evaluatie van een gehumaniseerd en menselijk immunodeficiëntievirus besmet NOG muismodel op basis van stamceltransplantatie, intravaginale blootstelling aan het menselijke immunodeficiëntievirus en druppeldigitale PCR RNA Kwantificering.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Gehumaniseerde muizen bieden een geavanceerd platform om menselijke immunodeficiëntievirus (HIV) virologie te bestuderen en antivirale geneesmiddelen te testen. Dit protocol beschrijft de oprichting van een menselijk immuunsysteem bij volwassen NOG muizen. Hier leggen we alle praktische stappen uit van isolatie van navelstrengbloed afkomstig van menselijke CD34+ cellen en hun daaropvolgende intraveneuze transplantatie in de muizen, tot de manipulatie van het model door hiv-infectie, combinatie antiretrovirale therapie ( cART) en bloedafname. Ongeveer 75.000 hCD34+ cellen worden intraveneus geïnjecteerd in de muizen en het niveau van menselijk chimerisme, ook bekend als humanisering, in het perifere bloed wordt in de lengterichting geschat voor maanden door flow cytometrie. Een totaal van 75.000 hCD34+ cellen levert 20%–50% menselijke CD45+ cellen op in het perifere bloed. De muizen zijn gevoelig voor intravaginale infectie met HIV en bloed kan eenmaal per week worden bemonsterd voor analyse, en twee maal per maand voor langere perioden. Dit protocol beschrijft een test voor kwantificering van plasma virale belasting met behulp van druppel digitale PCR (ddPCR). We laten zien hoe de muizen effectief kunnen worden behandeld met een standaard-of-care cART-regime in het dieet. De levering van cART in de vorm van gewone muis chow is een aanzienlijke verfijning van het experimentele model. Dit model kan worden gebruikt voor preklinische analyse van zowel systemische als actuele pre-exposure profylaxeverbindingen en voor het testen van nieuwe behandelingen en HIV-genezingsstrategieën.

Introduction

Menselijk immunodeficiëntievirus (HIV) is een chronische infectie met meer dan 37 miljoen geïnfecteerde personen wereldwijd1. Combinatie antivirale therapie (cART) is een levensreddende therapie, maar een remedie is nog steeds gerechtvaardigd. Er is dus behoefte aan diermodellen die het menselijk immuunsysteem en de reacties ervan weerspiegelen om verder onderzoek naar HIV te vergemakkelijken. Meerdere soorten gehumaniseerde muizen die cel- en weefselengraftment kunnen ondersteunen, zijn ontwikkeld door menselijke cellen te transplanteren in ernstig immunodeficiënte muizen2. Dergelijke gehumaniseerde muizen zijn gevoelig voor HIV-infectie en bieden een belangrijk alternatief voor niet-menselijke primaat simian immunodeficiëntie virus modellen, omdat ze goedkoper en eenvoudiger te gebruiken dan niet-menselijke primaten. Gehumaniseerde muizen hebben onderzoek naar hiv-virale overdracht, pathogenese, preventie en behandeling3,4,5,6,7,8,9,10,11vergemakkelijkt.

We presenteren een flexibel gehumaniseerd modelsysteem voor HIV-onderzoek ontwikkeld door het transplanteren van navelstrengbloed afkomstige menselijke stamcellen in muizen van de NOD. Cg-PrkdcscidIl2rgtm1Sug/ JicTac (NOG) achtergrond. Naast het feit dat van niet-foetale oorsprong, de praktische bio-engineering van deze muizen is minder technisch veeleisend in vergelijking met de microchirurgische procedures die betrokken zijn bij de transplantatie van de bloed-lever-thymus (BLT) constructie.

We laten zien hoe je hiv-infectie vast te stellen door middel van intravaginale transmissie en hoe het plasma virale belasting te controleren met een gevoelige druppel digitale PCR (ddPCR) gebaseerde setup. Vervolgens beschrijven we de oprichting van standaard cART gegeven als onderdeel van de dagelijkse muis dieet. Het doel van deze gecombineerde methoden is om stress voor de dieren te verminderen en grootschalige experimenten te vergemakkelijken waarbij de tijd die wordt besteed aan het hanteren van elk dier beperkt is12.

Bij mensen veroorzaakt een CCR5Δ32/wt of CCR5Δ32/ Δ32 genotype een verminderde gevoeligheid voor hiv-infectie met zender/stichtersvirussen13, en sommige voorzorgsmaatregelen moeten worden genomen bij bio-engineering gehumaniseerde muizen met stamcellen voor hiv-studies. Dit geldt vooral in onze regio omdat natuurlijk voorkomende varianten in het CCR5-gen, met name Δ32-deleties, vaker voorkomen in Scandinavische en Baltische inheemse populaties in vergelijking met de rest van de wereld14,15. Zo bevat ons protocol een eenvoudige, hoge doorvoertest voor het screenen van donorhematopoietische stamcellen voor CCR5-varianten voorafgaand aan transplantatie.

Voor de intravaginale blootstelling kozen we de zender / oprichter R5 virus RHPA4259, geïsoleerd van een vrouw in een vroeg stadium van infectie die intravaginale besmet was16. We stelden de muizen bloot aan een virale dosis die voldoende was om een succesvolle overdracht in de meerderheid van de muizen op te leveren, maar onder een 100% transmissiesnelheid. Het kiezen van een dergelijke dosis maakt een voldoende dynamisch bereik in transmissiesnelheid mogelijk, zodat antivirale effecten van een kandidaat-geneesmiddel kunnen leiden tot beschermde dieren in hiv-preventie-experimenten en verminderde virale belasting voor behandelingsstudies.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle navelstrengbloedmonsters werden verkregen in strikte overeenstemming met lokaal goedgekeurde protocollen, waaronder geïnformeerde toestemming van anonieme donatie door de ouders. Alle dierproeven werden goedgekeurd en uitgevoerd in strikte overeenstemming met de Deense nationale regelgeving in het kader van de licentie 2017-15-0201-01312.

LET OP: Omgaan met hiv blootgestelde muizen en bloed met uiterste voorzichtigheid. Ontsmetten alle oppervlakken en vloeistoffen die in contact zijn geweest met HIV met een bevestigd HIV-ontsmettingsmiddel (Tabel van materialen).

1. Isolatie van menselijke CD34+ stamcellen

  1. Verzamel navelstrengbloedmonsters in EDTA-gecoate bloedafnamebuizen na geplande keizersnedes of vaginale geboorten en volgens lokale ethische goedkeuringen.
  2. Isoleer PMBC's van navelstrengbloed door scheiding van dichtheidsgradiënt volgens het protocol van de fabrikant.
  3. Oleer cd34+ cellen van de PBMC-populatie door eerst vooraf te verrijken met antilichamen tegen gemeenschappelijke markers voor volwassen cellen, wat kruiskoppelingen van cellen van ongewenste geslachten met rode bloedcellen induceert. Dit wordt gevolgd door CD34 + celverrijking met behulp van magnetische kralen, volgens het protocol van de fabrikant.
    1. Bepaal het aantal levende cellen door standaard trypan blauwe uitsluiting door 10 μL celvering in 90 μL trypanblauw opnieuw op te schorten. Voeg 10 μL van deze oplossing toe aan een hemacytometer en tel niet-blauwe cellen, volgens het protocol van de fabrikant.
    2. Viably cryopreservatie CD34+ cellen in 1 mL van 10% DMSO in foetaal runderserum (FBS) tot de dag van muistransplantatie.
    3. Viably cryopreserve een kleine fractie van zowel geïsoleerde (CD34+) en flow-through cellen (CD34-) afzonderlijk voor de beoordeling van CD34 + stamcelzuiverheid (~ 30.000 cellen van elk monster). U ook de zuiverheid testen op vers verrijkte cellen (zie stap 2 hieronder).
    4. Bevries een fractie van niet-pelleted flow-through (CD34-) voor bepaling van de CCR5Δ32-status. Cellen kunnen direct worden ingevroren zonder geconditioneerde vriesoplossing, maar de aanwezigheid van rode bloedcellen in de pellet kan de daaropvolgende PCR remmen als de doorstroom wordt gepelleteerd.

2. Beoordeling van de zuiverheid van cd34+ stamcellen via stroomcytometrie

  1. Ontdooi de geïsoleerde cellen (CD34+) en doorstroomcellen (CD34-). Was de cellen door de cellen van elke flacon opnieuw op te schorten in 9 mL kamertemperatuur (RT) FACS-buffer, bestaande uit 2% foetaal runderserum (FBS) in fosfaatgebufferde zoutoplossing (PBS).
  2. Centrifugeer gedurende 5 min bij 300 x g bij RT naar pelletcellen.
  3. Giet de supernatant af, breg de cellen in de resterende vloeistof opnieuw op en breng over naar FACS-buizen. Herhaal de wasstap met 3 mL FACS buffer. Na de tweede centrifugering, giet de supernatant en resuspend de cellen in de resterende vloeistof.
  4. Voeg 5 μL fc receptor-blokkeringsoplossing(Tabel met materialen)toe en laat gedurende 10 min bij RT. Spoel de fc-receptorblokkeringsoplossing niet af.
  5. Voeg de mix toe die vooraf bepaalde hoeveelheden antilichamen bevat tegen menselijke CD3 (kloon SK7) BUV395, CD34 (kloon AC136), FITC en CD45 (kloon 2D1) APC(tabel 1). Laat de cellen 30 min bij RT in het donker. De fluorophoren moeten worden gekozen op basis van parameters die kunnen worden beoordeeld met beschikbare stroomcytometers zonder dat een compensatiematrix nodig is.
  6. Was de cellen met 3 mL FACS buffer.
  7. Centrifugeer gedurende 5 min bij 300 x g bij RT om de cellen te pelleteren.
  8. Giet de supernatant af en breg de cellen in de resterende vloeistof opnieuw op.
    1. Herhaal deze wasstap 2x om ervoor te zorgen dat alle ongebonden antilichamen zijn verwijderd.
  9. Neem de monsters op op de flow cytometer(Tabel met materialen)en voer data-analyse uit met de juiste software. De gatingstrategie wordt gepresenteerd in figuur 1A–F.

3. Genetische screening op CCR5Δ32 varianten in navelstrengbloed

  1. Incubeer 1,25 μL niet-pelleted flow-through met 11,25 μL PCR-mix met 200 μM dNTP-mix, 0,01 U/μL high fidelity DNA polymerase en de voorwaartse en omgekeerde primers die zijn beschreven in tabel 2.
    1. Pas het volume aan met nuclease-vrij water op ongeveer 12,5 μL voor elke PCR-reactie.
  2. Versterk de genomische fragmenten met het PCR-fietsprogramma, beschreven in tabel 3.
  3. Scheid de PCR producten op een 2% agarose gel13.
    1. PCR-producten van de wilde soorten allelen en de Δ32 allelen leveren PCR-fragmenten op van respectievelijk 196 basisparen en 164 basisparen, waardoor ze gemakkelijk te onderscheiden zijn door gelelektroforese13 (figuur 1G).

4. Intraveneuze stamceltransplantatie

OPMERKING: Het hebben van een persoon de voorbereiding van de cellen in het laboratorium en een andere persoon de muizen en werkruimte voor te bereiden op transplantaties is een efficiënte aanpak.

  1. In een dierenfaciliteit bestraalt 4-6 uur voor de geplande transplantatie van de stamcellen 6-7 weken oude vrouwelijke NOD. Cg-Prkdcscid Il2rgtm1Sug/ JicTac (NOG) muizen (Tabel van materialen) met 0,75 Gy met een Cs137 bron. De beste conditionerende dosis kan variëren op basis van de leeftijd van de muis, de bron van straling en andere factoren. Dit proces voorwaarden de dieren voor succesvolle engraftment met menselijke stamcellen.
  2. Bereid in een dierenfaciliteit de werkruimte van de stroombank en alle reagentia voor voordat u de muizen of cellen naar de werkruimte brengt.
    1. Plaats een steriele blauwe pad om het werkoppervlak van de stroombank te bedekken. Bereid steriel gaas en een scherpe container.
    2. Plaats een verwarmingslamp gedesinfecteerd met 70% ethanol in de stroombank met een lege steriele muizenkooi onder de hitte.
  3. In het laboratorium, ontdooien geïsoleerde CD34 + cellen en verdun ze in 9 mL van 37 ° C gewone RPMI.
  4. Centrifugeer de cellen op 350 x g voor 5 min bij RT, gooi de supernatant door aspiratie weg en bredig de pellet opnieuw op in 1 mL van gewone RPMI bij 37 °C.
  5. Bepaal het celtelling door het aantal blauwe uitsluiting te proberen en pas het volume aan op 200 μL per muis. Maak extra om rekening te houden met mogelijk verlies als gevolg van de daaropvolgende handling stappen.
    1. Bereid je voor om 75.000 CD34+ cellen per 200 μL in elke muis te transplanteren.
    2. De cellen kunnen bij 4 °C worden gehouden tijdens het transport naar de dierenfaciliteit vóór de transplantatie. Vermijd het houden van de cellen op ijs om aggregatie of samenklonteren te verminderen.
  6. Breng in de dierenfaciliteit de kooi met de muizen in de stroombank en breng de muizen naar de kooi onder de verwarmingslamp om de bloedvaten te verwijden. Laat een uiteinde van de kooi uit de buurt van de warmtebron, zodat de muizen kunnen weg van de hitte bij het warm worden. Muizen die zijn verhuisd naar het einde van de kooi, uit de buurt van de warmtebron, zijn voldoende warm voor een succesvolle staartader injectie.
  7. Laad een 1 mL gesmeerde spuit tot boven de 800 μL-markering met zwevende CD34+-cellen. Met behulp van een gesmeerde 1 mL spuit zal drastisch verlichten van de intraveneuze injectie en verhoging van de precisie van deze techniek.
  8. Bevestig een naald van 30 G 13 mm en bereid de naald en spuit voor op injectie. Deze volgorde van werking maakt het mogelijk om de spuit sneller te laden en tegelijkertijd de integriteit van de te transplanteren cellen te beschermen, gezien de mogelijke schade die kan optreden tijdens de snelle aspiratie van cellen door zo'n kleine meternaald. Vul de naaldnaaf met vloeistof door op de zuiger te drukken en verwijder vloeistof tot de 200 μL-markering van de naald.
  9. Plaats een verwarmde muis (stap 4.6) in een restrainer die wordt gebruikt voor het geven van INFUUS-injecties. Injecteer voorzichtig 200 μL van de celsuspensie in de staartader van de muis. Breng 2 s het uitvoeren van de duik en houd de naald ingevoegd voor ongeveer 2 s na voltooiing van de injectie. Dit zorgt ervoor dat de cellen voldoende ver van de injectieplaats zijn gemigreerd voordat de naald wordt verwijderd.
  10. Veeg indien nodig de muisstaart met steriel gaas om zichtbaar bloed te verwijderen. Zet de muis terug in zijn niet-verwarmde huiskooi. Herhaal de injectieprocedure met de resterende muizen.

5. Bloedafname en -verwerking voor analyse

OPMERKING: Menselijke celengraftment in het perifere bloed kan worden geëvalueerd via stroomcytometrie 3-5 maanden na menselijke stamceltransplantatie.

  1. Haal bloedmonsters van de muizen met behulp van lokale IACUC-goedgekeurde technieken.
  2. Verzamel maximaal 70-100 μL totaal bloed in steriele PCR microcentrifugebuizen met 10 μL van 0,5 M EDTA (pH = 8,0) om stolling van bloed te voorkomen.

6. Evaluatie van menselijke engraftment via stroomcytometrie

  1. Breng 40-50 μL bloed over naar FACS-buizen.
  2. Voeg 5 μL fc receptor-blokkeringsoplossing toe om niet-specifieke binding van antilichamen te voorkomen en laat gedurende 10 min bij RT.
  3. Voeg de muis anti-menselijke antilichaammix met CD4 (kloon SK3) BUV 496 toe, CD8 (kloon RPA-T8) BV421, CD3 (kloon OKT3) FITC, CD19 (kloon sj25c1) PE-Cy7, CD45 (kloon 2D1) APC(Tabel 4)en laat in het donker bij RT vlekken voor 30 min. Fluorophores moeten worden gekozen op basis van parameters die kunnen worden beoordeeld met de beschikbare stroomcytometers zonder dat een compensatiematrix nodig is.
  4. Voeg 2 mL van een geschikte rode bloedcel lysing buffer toe aan elke buis om de rode bloedcellen lyse. Gebruik een lysisbuffer die speciaal is geformuleerd voor antilichaamvlekken voorafgaand aan rode bloedcellyse (een geschikt voorbeeld wordt gegeven in de Materiaaltabel). Vortex kort om gelijke verdeling van de cellen in de lysing oplossing te garanderen en laat voor 10 min bij RT. Gelijke verdeling van de cellen is belangrijk.
  5. Voeg 2 mL FACS buffer toe om de lysisreactie te stoppen.
  6. Centrifugeer gedurende 5 min bij 300 x g bij RT om de cellen te pelleteren.
  7. Giet de supernatant en vortex voorzichtig af totdat de cellen opnieuw worden opgehangen.
  8. Voeg 3 mL FACS buffer en centrifuge toe voor 5 min bij 300 x g bij RT.
  9. Giet de supernatant af en breg de cellen opnieuw op.
  10. Neem de monsters op een geschikte flow cytometer en analyseer met behulp van de juiste software(Tabel met materialen). Representatieve analyses en resultaten zijn afgebeeld in figuur 2 en figuur 3.

7. Intravaginale hiv-blootstelling

OPMERKING: Het virus dat wordt gebruikt voor intravaginale blootstelling van de muizen kan worden geproduceerd met behulp van eerder gepubliceerde protocollen17. Het virus wordt op -80 °C gehouden en tussen locaties getransporteerd terwijl het wordt opgeslagen op droogijs volgens lokaal goedgekeurde protocollen. Het virus wordt opgeslagen op droogijs tot vlak voor de blootstelling van de muizen. Het virus kan worden verdund tot gewone RPMI (vermijd RPMI met antibiotica of serumadditieven) om de juiste concentratie te bereiken vlak voor blootstelling (21.400 IUs werden gebruikt voor deze IVAG-blootstelling). Eenmaal gegenereerd, houd de verdunde voorraad op nat ijs gedurende de procedure om bevriezing-dooi cycli die zouden optreden als het verdunde virus werd terug geplaatst op droog ijs eenmaal ontdooid te voorkomen.

  1. Bereid alle apparatuur en flow bench werkruimte zoals gepresenteerd in figuur 4 voor het brengen van de muizen of het virus in de flow bank (vergelijkbaar met stap 4.2).
    1. Plaats de focus van de verwarmingslamp in het midden van de werkruimte waar de muis zich tijdens de hiv-blootstellingsprocedure bevindt. De verwarmingslamp zorgt voor geen afname van de lichaamstemperatuur van de muizen. Andere apparatuur die de temperatuur regelt, kan ook worden gebruikt (bijvoorbeeld een verwarmd gelpad of een circulerende warmwaterdeken, volgens de lokale IACUC-voorschriften18).
    2. Breng steriele 20 μL pipet tips en een geschikte pipet in de bank. Plaats een container met vloeibaar ontsmettingsmiddel(Tabel van Materialen)in de bank voor onmiddellijke inactivering van materialen en vloeistoffen die in contact zijn geweest met het virus.
  2. Plaats een muis in een kamer met 3% isoflurane gas en papieren handdoeken. Dit gaspercentage zal de dieren binnen 2-4 min verdoven. Net als bij alle andere materialen die worden gebruikt met immunodeficiënte muizen, moet het anesthesieapparaat voor gebruik naar behoren worden gedesinfecteerd.
  3. Zodra verdoofd, breng de muis naar een steriele blauwe pad onder de verwarmingslamp. Steek de muis snuit in een masker leveren continue 3% isoflurane gas om anesthesie te handhaven. Houd de muis aan de basis van de staart, maag naar boven gericht, met uw hand ter ondersteuning van de muis terug zoals afgebeeld in figuur 4.
  4. Met een steriele pipet tip, stimuleren het genitale gebied door zachtjes streelde omhoog naar de anus te induceren lediging van het rectum, het verlichten van de druk op de vagina.
  5. Voorzichtig bloot de vaginale opening door het verpakken van de muis staart over je vingers zodanig dat de vulva natuurlijk opent, misschien met lichte nudging met behulp van een steriele pipet tip.
  6. Verander de pipettip en pipet 20 μL virus atraumatisch in de muisvagina zonder bellen te creëren. Steek de punt niet diep in de vagina. Integendeel, met de vulva geopend, plaats de pipet tip op het niveau van de vaginale opening, vermijd dieper gaan om het potentieel voor schaafwonden te elimineren tijdens het inentingsproces, laat het virus los, en laat de zwaartekracht om het virus te trekken in de vagina. U ook een 22 G 1,25 mm stompe, rechte naald gebruiken, zoals beschreven in Veselinovic et al.6.
  7. Bewaar de muis in deze positie met de vagina naar boven voor 5 min na blootstelling aan de zwaartekracht geïnduceerde lekkage van het virus schorsing te voorkomen.
    1. Plaats de muis voorzichtig in de kooi van het huis, waarbij u ervoor zorgt dat de muis op zijn rug wordt geplaatst.

8. Verwerking van bloedmonsters voorafgaand aan virale belastinganalyse

  1. Verzamel bloed zoals beschreven in punt 5 hierboven.
  2. Centrifugeer de bloedmonsters gedurende 5 min bij 500 x g bij RT om het plasma en de cellen te scheiden.
  3. Verzamel 40 μL plasma voor virale belastingsmeting in een nieuwe steriele PCR-goedgekeurde microcentrifugebuis en bewaar op -80 °C gedurende ten minste 1 uur tot verdere verwerking. Het is belangrijk om alle monsters te bevriezen vóór RNA-extractie om het risico van bias te voorkomen van het vergelijken van RNA-niveaus in monsters die niet zijn bevroren voordat RNA isolatie is bevroren aan monsters bevroren voorafgaand aan RNA isolatie.
  4. Pas het bloedvolume weer aan het oorspronkelijke volume aan door 40 μL suspensiemedia toe te voegen (PBS met 2,5% runderserumalbumine, 50 U/mL penicilline G en streptomycine, en 10 U/mL DNase, steriel gefilterd op 0,22 μm).
  5. Breng 15 μL van het aangepaste bloedvolume over naar een nieuwe PCR-goedgekeurde microcentrifugebuis.
  6. Voeg 1 mL 1x RBC lysis oplossing (Table of Materials),vortex, en incuberen voor 10 min bij RT.
  7. Centrifugeer gedurende 1 min bij 9.600 x g bij RT naar pelletcellen.
  8. Aanzuigen supernatant en laat alleen de kleine witte cel pellet, omdat rode bloedcellen besmetting pcr kan remmen.
  9. Bewaar pellet op -80 °C gedurende ten minste 1 uur tot verdere verwerking.
    OPMERKING: Optioneel kan eventueel het resterende bloed uit stap 8.4 worden gebruikt voor stroomcytometrieanalyse, zoals hierboven beschreven in stap 6.

9. DNA-extractie met behulp van een eiwitase K-extractiemethode

  1. Extract DNA uit perifere cel pellets (gegenereerd in stap 8.8) met behulp van een proteinase K extractie methode zoals hieronder beschreven. Deze methode is aangetoond om de hoogste DNA-opbrengst te extraheren uit een klein volume bloed, zoals die nodig is voor de seriële bloedcollecties die in deze studie worden gebruikt19.
  2. Voeg 25 μL proteinase K (20 μg/mL) toe aan 1 mL van 0,1 M Tris buffer.
  3. Vortex de proteinase K oplossing kort.
  4. Voeg 50 μL van de proteinase K-oplossing toe aan elke te verteren celpellet.
  5. Mix door op en neer te stampen en bevestig de hersuspensie van de celpellet.
  6. Schud op een thermoshaker(Tafel van materialen)bij 400 tpm (afhankelijk van het instrument) bij 56 °C gedurende 1 uur. Tapebuizen naar beneden om ze op hun plaats te houden, indien nodig.
  7. Onmiddellijk en in dezelfde thermoshaker, inactiveren proteinase K met een temperatuur verschuiving naar 95 °C, terwijl het schudden blijft voor een extra 20 min.
  8. Vortex elk monster.
  9. Plaats elk monster minimaal 30 min op -80 °C.
  10. Ontdooi, centrifugeer de monsters vervolgens op 17.000 x g voor 1 min bij RT om ongewenste cellulaire fragmenten te pelleteren.
  11. Plaats het DNA-bevattende supernatant in een nieuwe microcentrifugebuis.
  12. De DNA-sjabloon is klaar voor PCR. De DNA-sjablonen kunnen worden opgeslagen bij -80 °C.

10. RNA-extractie, cDNA-synthese en ddPCR-kwantificering van viraal RNA

  1. Oleer RNA van ontdooid muisplasma met een virus RNA isolatiekit volgens het protocol van de fabrikant(Tabel met materialen).
  2. Voeg na toevoeging van het monster aan de kolom een dnase behandelingsstap op de kolom toe om ervoor te zorgen dat alle DNA in het plasmamonster wordt verwijderd.
    1. Voeg voor elk monster 95 μL RNase-vrije DNase-oplossing (meng 2 μL RNAse-vrije DNase en 98 μL reactiebuffer) toe aan de kolom en broed gedurende 15 min bij RT.
  3. Bewaar de RNA-monsters minstens 1 uur bij -80 °C voordat u verder wordt verwerkt. Het is belangrijk om alle monsters te bevriezen na RNA-extractie vermijd het risico van bias bij het vergelijken van monsters die niet zijn ingevroren met monsters die zijn ingevroren.
  4. Synthetiseren cDNA met behulp van een omgekeerde transcriptase stap met behulp van reagentia zoals eerder beschreven20. Zorg ervoor dat u 0,5 μL van een RNase-remmer aan de cDNA-reactie toevoegt om afbraak van het RNA te voorkomen.
    1. Voer cDNA-synthese uit met het programma dat is beschreven in tabel 5.
  5. Bewaar de cDNA-monsters minstens 1 uur op -80 °C. Het is belangrijk om alle monsters te bevriezen na cDNA synthese te voorkomen dat het risico van bias bij het vergelijken van monsters die niet zijn bevroren met monsters die werden bevroren.
  6. Monsters voor ddPCR opstellen alsvolgt:
    1. Meng 3 μL van het cDNA-monster met 11 μL van het ddPCR-sondemengsel (geen dUTP)20, 250 nM kleine groefbindingsssssonde en 900 nM van elk van de voorwaartse en omgekeerde primers zoals beschreven in tabel 6.
    2. Pas het totale PCR-volume aan op 22 μL met nuclease-vrij water.
  7. Emulsificeren van de PCR mengt met Droplet Generation Oil for Probes op een druppelgenerator volgens het protocol van de fabrikant en eerdere beschrijvingen20.
  8. Voer het PCR-programma uit zoals beschreven in tabel 7.
    OPMERKING: De primer / sonde sequenties en PCR-programma's hier weergegeven zijn speciaal ontworpen en geoptimaliseerd voor gevoelige detectie van de HIV-stam RHPA4259. Primer- en sondesequenties kunnen eenvoudig worden aangepast om elke andere HIV-stam naar keuze te detecteren.
  9. Detecteer druppelfluorescentie van de monsters op een druppellezer en analyseer de resultaten met de juiste software volgens het protocol van de fabrikant.

11. Behandeling met cART-bevattende chow

  1. Voedermuizen met pellets die een standaard cART-regime bevatten dat 4.800 mg/kg raltegravir (RAL), 720 mg/kg tenofovir disoproxil fumarate (TDF) en 520 mg/kg emtricitabine (FTC)21 (Tabel 8) bevat. Deze doses werden bepaald in de veronderstelling dat een muis weegt 25 g en eet 4 g chow per dag. Dit komt overeen met een dagelijkse dosis van 768 mg/kg RAL, 2,88 mg/kg TDF en 83 mg/kg FTC21.
  2. Gebruik een cART dieet dat is bereid door een externe leverancier (Zie Tabel met materialen)van geneesmiddelen op recept. Andere bedrijven kunnen dit regime mogelijk ook produceren. Gebruik een cART dieet rood gekleurd om gemakkelijk te onderscheiden van gewone muis chow.
    1. Produceer een control chow dieet zonder cART in een standaard bruine kleur voor gemakkelijk onderscheid.
  3. Voor de initiatie van cART, bereiden steriele muiskooien met de toevoeging van cART-bevattende chow dieet, en breng vervolgens de muizen van de oude kooi naar de nieuwe kooi.
    1. Controleer de gewichten van de muizen en de consumptie van cART-bevattende chow door visuele inspectie om ervoor te zorgen dat de muizen zich aanpassen aan de verandering.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De gatingstrategie voor de analyse van de zuiverheid van stamcellen is afgebeeld in figuur 1. Figuur 1A-C toont de gezuiverde CD34+ populatie en figuur 1D-F de CD34-flow-through die wordt gebruikt om te illustreren dat de minimale hoeveelheid cd34+ populatie verloren gaat in het isolatieproces. De zuiverheid van geïsoleerde CD34+ stamcellen lag tussen 85%-95% met minder dan 1% T-celverontreiniging. Figuur 1G toont CCR5-banden van één volwassen donor van menselijke controle met het CCR5Δ32/wt genotype, gevolgd door banden van twee CCR5wt/wt en één CCR5Δ32/wt stamceldonoren. De frequentie van het genotype CCR5Δ32/wt in een groep van 19 donoren was 15,8% (figuur 1H). Dit is in overeenstemming met grotere epidemiologische studies14,15 het genotype melden bij maximaal 23,6% van de onderzochte personen in Denemarken.

Menselijke CD45+ niveaus in muizen perifeer bloed werd beoordeeld via stroomcytometrie 3-5 maanden na transplantatie van menselijke CD34 + stamcellen. De gating strategie wordt gepresenteerd in figuur 2A-E. Figuur 3A en figuur 3B illustreren de variabiliteit tussen 10 en 16 individuele muizen die stamcellen ontvangen van twee verschillende donoren. Transplantatie van 75.000 hCD34+ cellen leverde 20%–50% menselijke CD45+ op in het perifere bloed. Alle muizen ontwikkelden menselijke B- en T-cellen, waaronder zowel CD4- als CD8+ T-cellen.

Voor atraumatische intravaginale blootstellingen werd de opstelling in figuur 4 gebruikt. Muizen werden verdoofd in een gesloten kamer en onder narcose gehouden tijdens de blootstelling. Muizen werden gehouden met de vagina geconfronteerd met 5 min na blootstelling aan virus oplossing betrokkenheid met slijmvlies oppervlakken te garanderen.

Figuur 5A toont het slagingspercentage van 64% hiv-overdracht dat wordt waargenomen met behulp van dit model. Muizen werden uitgedaagd met 21.400 infectieuze eenheden (IU) van RHPA4259 intravaginaal. Deze dosis resulteerde in 64% van de muizen steeds HIV besmet na vaginale blootstelling. Ter vergelijking, gegevens van twee verschillende cohorten muizen blootgesteld via een intraveneuze route zijn opgenomen. Zoals verwacht, 100% van de muizen werd HIV + met vergelijkbare doses RHPA en een extra stam (YU2) met behulp van deze route.

Figuur 5B toont representatieve resultaten van drie muizen die besmet waren met HIV en overschakelden op een dieet dat standaard cART bevat. Muizen werden na 40 dagen cART teruggezet naar gewone muizenchow. In deze testopstelling was de limiet voor virale belastingdetectie 725 exemplaren/mL. Virale ladingen lagen allemaal onder de detectielimiet na 4 weken cART. Na stopzetting van cART veerde het virus op en spiegelde klinische gegevens22. Muizen op cART tolereerden de verandering in dieet goed zoals aangegeven in figuur 5C.

Figure 1
Figuur 1: Representatieve flow cytometriegatingstrategie voor validatie van stamcelzuiverheid en CCR5 donorvariantstatus. (AC) De gating strategie die wordt gebruikt voor de geïsoleerde CD34 + celpopulatie. Doublets en puin zijn exclusief in respectievelijk paneel A en B (FSC-A vs. FSC-H en FSC-A vs. SSC-A). (C) De frequentie van CD34+ stamcellen en CD3+ T-celverontreiniging. (DF) De CD34-flow-through gating strategie. Percentages in poorten worden berekend als een fractie van de ouderpopulatie. (G) De resultaten van een CCR5Δ32/wt PCR-analyse. Rijstrook 1: DNA van een menselijke CCR5Δ32/wt donor, rijstroken 2 en 3: twee CCR5wt/wt menselijke stamceldonoren, rijstrook 4: Een CCR5Δ32/wt menselijke stamceldonor. (H) De frequentie van het genotype CCR5Δ32/wt in onze groep van 19 stamcelmonsters is 15,8%. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Flow cytometrie gating strategie voor validatie van menselijke cel engraftment en differentiatie. De totale mononucleaire celpopulatie van gehumaniseerde muizen werd geanalyseerd via stroomcytometrie. (A) Het percentage menselijke CD45+ cellen werd bepaald als een fractie van de totale geregistreerde gebeurtenissen. (B) Doublets werden vervolgens uitgesloten op basis van FSC-A/FSC-H gating. (C) De ware lymfocytenpopulatie werd gedefinieerd op basis van grootte en granulariteit. (D) Lymfocyten werden vervolgens gekarakteriseerd als CD3+ (T-cellen) of CD19+ (B-cellen). (E) CD3+ T-cellen waren CD4+ T-cellen of CD8+ T-cellen. Percentages in poorten werden berekend als een fractie van de ouderpopulatie. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: Representatieve humaniseringsniveaus 4-5 maanden na stamceltransplantatie met celsubtypefracties voor 10 en 16 muizen gegenereerd uit twee verschillende menselijke donoren. (A) De mononucleaire celpopulatie (MNC) van 10 enb) 16 gehumaniseerde muizen werden geanalyseerd via stroomcytometrie en gated zoals gepresenteerd in figuur 2. De fractie van menselijke CD45+-cellen wordt gepresenteerd als %hCD45 (van totaal MNC) en %B- en %T-cellen als een fractie van hCD45. T-cellen werden vervolgens opgedeeld in %CD4 en %CD8. Elk gegevenspunt vertegenwoordigt één muis. Gegevens worden gepresenteerd als gemiddelde ± SD. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: Experimentele lab bank setup voor intravaginale blootstelling van muizen. Experimentele opstelling voor hiv-blootstelling van gehumaniseerde muizen via de intravaginale route. De procedure wordt uitgevoerd in een flow bank waar alle reagentia en oppervlakken zijn gesteriliseerd voorafgaand aan het gebruik. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: Overdracht van hiv-stam via verschillende blootstellingsroutes en werkzaamheid en veiligheid van cART-bevattende chow bij virale onderdrukking. (A) Gehumaniseerde NOG muizen werden met succes besmet met twee verschillende stammen van HIV via ofwel de intravaginale of de intraveneuze route. Muizen werden blootgesteld met 21.400 IUs van RHPA4259 intravaginaal, 5.157 IUs IV met RHPA4259, of 3.000 IUs IV met YU2. Details met betrekking tot iv blootstelling van gehumaniseerde muizen zijn niet opgenomen in dit protocol. HIV-infecties werden met succes behandeld met een cART-regime geleverd door middel van muis chow. (B) De virale belasting daalde tot onder detectie voor alle drie muizen op cART en rebound ontstond na de stopzetting van cART. De stippellijn geeft de grens van de kwantificering aan bij 725 exemplaren/mL. Muizen gevoed met cART chow had een vergelijkbaar gewicht ontwikkeling als muizen gehuisvest op niet-cART chow tijdens dezelfde periode, wat aangeeft geen smaak-voorkeur of bijwerkingen van het cART dieet. (C) Gewichten worden gepresenteerd als vouwverandering ten opzichte van het begin van cART. Elk gegevenspunt vertegenwoordigt het gemiddelde van drie dieren ± SD. Klik hier om een grotere versie van dit cijfer te bekijken.

Antilichaam doel Kloon Fluorophore Fluorophore
CD3 kloon SK7 BUV395 BUV395
CD34 kloon AC136 Fitc
CD45 kloon 2D1 Apc

Tabel 1: Antilichamen die worden gebruikt voor de bepaling van de zuiverheid van stamcellen. Voorgestelde multicolor flow cytometrie paneel voor de evaluatie van stamcelzuiverheid. Vermeld zijn het antilichaam doel, de kloon, en de fluorophore.

CCR5Δ32 detectie Inleidingen
Voorwaartse primer 5'CTTCATTACACCTGCAGCT'3
Omgekeerde primer 5'TGAAGATAAGCCTCACAGCC'3

Tabel 2: CCR5Δ32 variant detectie PCR primers. Voorwaartse en omgekeerde primers die worden gebruikt voor de detectie van de 32 bp verwijdering in het CCR5-gen.

№. van cycli 1 45 1
Temperatuur (°C) 98 98/63/72 72 10
Tijd 30 s 10 s/30 s/15 s 5 min

Tabel 3: CCR5Δ32 variant detectie PCR programma. PCR fietsprogramma gebruikt voor versterking van het CCR5 gen.

Antilichaam doel Kloon Fluorophore Fluorophore
CD4 SK3 BUV 496
CD8 RPA-T8 RPA-T8 BV421
CD3 OKT3 OKT3 Fitc
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

Tabel 4: Antilichamen die worden gebruikt voor de bepaling van de vermenselijking van muizen. Voorgesteld multicolor flow cytometrie paneel voor humanisering. Vermeld zijn het antilichaam doel, de kloon, en de fluorophore.

№. van cycli 1 1
Temperatuur (°C) 51 80 4
Tijd 45 min 15 min

Tabel 5: cDNA-versterkingsprogramma. Programma dat wordt gebruikt voor het amplification van complementair streng DNA naar het virale RNA.

HIV-kwantificering Inleidingen
Voorwaartse primer 5'AGGGCAGCATAGAGCAAAAA'3
Omgekeerde primer 5'CAAAGGAATGGGGGTTCTTT'3
FAM-sonde 5'ATCCCCACTTCAACAGATGC'3

Tabel 6: HIV ddPCR primers. Primers en sondes gebruikt voor ddPCR versterking van virale cDNA.

№. van cycli 1 39 1
Temperatuur (°C) 95 95/54.5 98 4
Tijd 10 min 30 s/1 min 10 min

Tabel 7: HIV ddPCR programma. PCR fietsprogramma gebruikt voor versterking van virale RNA.

Raltegravir (RAL) 4800 mg/kg
Tenofovir disoproxil fumarate (TDF) 720 mg/kg
Emtricitabine (FTC) 520 mg/kg

Tabel 8: Muis cART chow dieet. Muis chow dieet werd geformuleerd als eerder gepubliceerd21. Het chow dieet werd gemaakt op basis van standaard muis chow, en na de productie, het voedsel werd γ-bestraald met 25 kGy en dubbele zakken. De chow werd opgeslagen bij -20 °C tot gebruik.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De ernstig immuungecompromitteerde muisstam NOD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) is uitermate geschikt voor transplantatie van menselijke cellen en weefsels. Zowel aangeboren als adaptieve immuuntrajecten bij deze muizen zijn gecompromitteerd. NOG- en NSG-muizen herbergen een Prkdcscid mutatie die resulteert in een defecte T- en B-celfunctie. Bovendien missen deze muizen een functionele interleukine-2 receptor γ-keten (gemeenschappelijke gammaketen, IL2rg) die onmisbaar is in de bindende complexen van vele belangrijke cytokinen zoals IL-2, IL-4, IL-7, IL-9, IL-15 en IL-21. Immunodeficiënte muizen, zoals de NOG, getransplanteerd met een menselijk immuunsysteem zijn een krachtig instrument voor de studie van HIV-overdracht en immunologie. De bijdragen op deze gebieden met behulp van gehumaniseerde muizen zijn uitgebreid herzien2,23,24,25,26. Het gebruik van deze muizen om menselijke aangeboren immuunreacties te bestuderen krijgt ook meer aandacht27,28.

Het doel van dit manuscript is om een uitgebreid protocol van muis en ddPCR procedures te leveren om van een naïeve muis naar HIV-transmissie en behandelingsgegevens te gaan. Ons systeem maakte gebruik van ddPCR voor kwantificering van viraal RNA en DNA. In een ddPCR-reactie worden de reactanten verdeeld in maximaal 20.000 druppels, elk met een enkele, afzonderlijke micro-PCR-reactie. De versterking van een doel in een druppel leidt tot een positief fluorescerend signaal voor die druppel. Zo is de uitlezing binair en door poisson statistische analyses toe te passen, kan het aantal positieve reacties direct worden vertaald naar een aantal sjabloonkopieën in het oorspronkelijke voorbeeld. Het voordeel van ddPCR ligt in het vermogen om een doel dat onafhankelijk is van een standaardcurve rechtstreeks te kwantificeren. Dit is vooral aantrekkelijk bij het analyseren van RNA monsters die uitdagend zijn om te gebruiken als PCR standaard curven als gevolg van hun labile karakter29. Bovendien maakt het binaire karakter van ddPCR het mogelijk om door meerdere replica's van hetzelfde monster te analyseren en de afzonderlijke gegevenspunten voor de uiteindelijke monsterkwantileren samen te voegen. Dit is vooral belangrijk in een gehumaniseerde muisinstelling, waar slechts beperkt monstermateriaal beschikbaar is en een hoge gevoeligheid vereist is.

Toediening van cART aan gehumaniseerde muizen kan worden gedaan door orale gavage of intraperitoneale injecties met oplossingen van cART30,31,32, en zoals onlangs aangetoond, door formulering in het dieet21. Een van onze belangrijkste doelstellingen was de implementatie van een cART-regime in het muizendieet om potentiële stress op de dieren te verminderen als gevolg van de extra behandelingsstappen die inherent zijn aan andere methoden voor het leveren van geneesmiddelen. De dosis geneesmiddel dat een muis zal eten kan nauwkeurig worden geschat op basis van de gemiddelde dagelijkse voedselinname van de muizen33. Orale levering via het dieet dient als de gemakkelijkste leveringsroute met zowel minimale stress voor het dier als minimale werklast voor de handler. We baseerden onze combinatie van antivirale geneesmiddelen op eerder gepubliceerde studies bij gehumaniseerde muizen21,30. Bovendien is onze cART-strategie klinisch relevant gezien het feit dat de medicijncombinatie die klinisch wordt gebruikt, mondeling wordt toegediend door patiënten over de hele wereld.

Bepaalde beperkingen worden opgemerkt met betrekking tot het gebruik van NOG muizen. Belangrijk is dat menselijke T-cellen in deze muizen worden gekweekt in een muisthymische omgeving, in tegenstelling tot een menselijke omgeving. De recente focus ligt op het genereren van xenoontvanger stammen die een gunstige omgeving voor de ontwikkeling van robuuste menselijke immuunreacties hebben. Deze nieuwe stammen omvatten immunodeficiënte muizen die transgeen zijn voor menselijke MHC moleculen, zoals A2. Deze modellen maken HLA-beperkte antigeen T-celreacties mogelijk die resulteren in betere rijping en effectorfuncties van het adaptieve immuunsysteem34. Een andere benadering is het vervangen van muisgenen door belangrijke menselijke cytokinen voor IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38en IL-7/TSLP31. Dergelijke modellen hebben meer aandacht gekregen voor hun vermogen om een betere differentiatie van aangeboren celtypes te genereren. Ons protocol is gemakkelijk aanpasbaar voor de humanisering en HIV-infectie van muizen met behulp van een dergelijke verbeterde genetische achtergrond immunodeficiëntie stam.

Samengevat, het gemak en nut van de beschreven aanpak vergemakkelijkt onderzoek in HIV-gerelateerde gebieden in vivo. Gehumaniseerde muizen kunnen een zeer krachtig instrument zijn om onderzoek te sturen naar het genereren van betere onderzoekshypothesen. Samen met de generatie van meer "menselijke" gehumaniseerde muizen met menselijke transgenen, geloven we dat ons gestandaardiseerde protocol zal bijdragen aan het stroomlijnen van experimentele procedures in verschillende onderzoeksomgevingen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren geen belangenconflicten.

Acknowledgments

De auteurs willen de medewerkers van de Biomedicine Animal Facility van de Universiteit van Aarhus, in het bijzonder mevrouw Jani Kær, bedanken voor de inspanningen van de kolonieen en voor het bijhouden van muisgewichten. De auteurs willen professor Florian Klein bedanken voor de ontwikkeling van standaard-of-care cART en voor begeleiding. De volgende reagens werd verkregen via de NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pRHPA.c/2635 (cat# 11744) van Dr. John Kappes en Dr Christina Ochsenbauer.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics