Ratones NOG humanizados para la exposición y tratamiento del VIH intravaginal

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hemos desarrollado un protocolo para la generación y evaluación de un modelo de ratón NOG infectado por el virus de inmunodeficiencia humana y humanizado basado en el trasplante de células madre, la exposición al virus de inmunodeficiencia humana intravaginal y el ARN PCR digital de gotas Cuantificación.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Los ratones humanizados proporcionan una plataforma sofisticada para estudiar la virología del virus de inmunodeficiencia humana (VIH) y para probar los medicamentos antivirales. Este protocolo describe el establecimiento de un sistema inmunitario humano en ratones NOG adultos. Aquí, explicamos todos los pasos prácticos desde el aislamiento de las células CD34+ humanas derivadas de la sangre del cordón umbilical y su posterior trasplante intravenoso en ratones, hasta la manipulación del modelo a través de la infección por VIH, la terapia antirretroviral combinada ( cART), y el muestreo de sangre. Aproximadamente 75.000 células hCD34+ se inyectan por vía intravenosa en los ratones y el nivel de chimerismo humano, también conocido como humanización, en la sangre periférica se estima longitudinalmente durante meses por citometría de flujo. Un total de 75.000 células hCD34+ produce entre un 20% y un 50% de células CD45+ humanas en la sangre periférica. Los ratones son susceptibles a la infección intravaginal con VIH y la sangre se puede tomar muestras una vez por semana para su análisis, y dos veces al mes durante períodos prolongados. Este protocolo describe un ensayo para la cuantificación de la carga viral plasmática utilizando PCR digital de gotas (ddPCR). Mostramos cómo los ratones pueden ser tratados eficazmente con un régimen de cART estándar de cuidado en la dieta. La entrega de cART en forma de chow de ratón regular es un refinamiento significativo del modelo experimental. Este modelo se puede utilizar para el análisis preclínico de compuestos de profilaxis previas a la exposición sistémicas y tópicas, así como para la prueba de nuevos tratamientos y estrategias de curación del VIH.

Introduction

El virus de la inmunodeficiencia humana (VIH) es una infección crónica con más de 37 millones de personas infectadas en todo el mundo1. La terapia antiviral combinada (cART) es una terapia que salva vidas, pero una cura todavía está justificada. Por lo tanto, es necesario modelos animales que reflejen el sistema inmunitario humano y sus respuestas para facilitar la investigación continua en el VIH. Múltiples tipos de ratones humanizados que son capaces de apoyar el injerto celular y tisular se han desarrollado trasplantando células humanas en ratones gravemente inmunodeficientes2. Estos ratones humanizados son susceptibles a la infección por el VIH y proporcionan una alternativa importante a los modelos de virus de inmunodeficiencia simio primateno no humano, ya que son más baratos y más fáciles de usar que los primates no humanos. Los ratones humanizados han facilitado la investigación en transmisión viral del VIH, patogénesis, prevención y tratamiento3,4,5,6,7,8,9,10,11.

Presentamos un sistema modelo humanizado flexible para la investigación del VIH desarrollado mediante el trasplante de células madre humanas derivadas de la sangre de cordón umbilical en ratones del NOD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) fondo. Además de ser de origen no fetal, la bioingeniería práctica de estos ratones es menos técnicamente exigente en comparación con los procedimientos microquirúrgicos involucrados en el trasplante de la construcción de sangre-hígado-timo (BLT).

Mostramos cómo establecer la infección por VIH a través de la transmisión intravaginal y cómo monitorear la carga viral plasmática con una configuración sensible basada en PCR digital de gotas (ddPCR). Posteriormente, describimos el establecimiento de cART estándar dado como parte de la dieta diaria del ratón. El objetivo de estos métodos combinados es reducir el estrés a los animales y facilitar experimentos a gran escala en los que el tiempo dedicado al manejo de cada animal es limitado12.

En los seres humanos, un genotipo CCR532/wt o CCR532/32 provoca una menor susceptibilidad a la infección por VIH con los virus del transmisor/fundador13,y se deben tomar algunas precauciones cuando se deben tomar algunas precauciones cuando se bioingeniería de ratones humanizados con células madre con el fin de realizar estudios sobre el VIH. Esto es especialmente cierto en nuestra región porque las variantes naturales en el gen CCR5, en particular las deleciones de 32, son más frecuentes en las poblaciones nativas escandinavas y bálticas en comparación con el resto del mundo14,15. Por lo tanto, nuestro protocolo incluye un ensayo fácil y de alto rendimiento para el cribado de células madre hematopoyéticas de donantes para variantes ccr5 antes del trasplante.

Para la exposición intravaginal elegimos el virus transmisor/fundador R5 RHPA4259, aislado de una mujer en una etapa temprana de la infección que fue infectada por vía intravaginal16. Explamos a los ratones a una dosis viral que fue suficiente para producir una transmisión exitosa en la mayoría de los ratones, pero por debajo de una tasa de transmisión del 100%. La elección de una dosis de este tipo permite un rango dinámico suficiente en la velocidad de transmisión, de modo que los efectos antivirales de un candidato a un medicamento pueden dar lugar a animales protegidos en experimentos de prevención del VIH y disminución de la carga viral para los estudios de tratamiento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todas las muestras de sangre de cordón umbilical se obtuvieron en estricta conformidad con los protocolos aprobados localmente, incluyendo el consentimiento informado de la donación anónima por parte de los padres. Todos los experimentos con animales fueron aprobados y realizados en estricta conformidad con la normativa nacional danesa bajo la licencia 2017-15-0201-01312.

ADVERTENCIA: Manipule los ratones y la sangre expuestos al VIH con extrema precaución. Descontaminar todas las superficies y líquidos que han estado en contacto con el VIH con un desinfectante confirmado del VIH(Tabla de Materiales).

1. Aislamiento de células madre HUMANAs CD34+

  1. Recopile muestras de sangre de cordón umbilical en tubos de recolección de sangre recubiertos con EDTA después de secciones de cesárea planificadas o partos vaginales y de acuerdo con las aprobaciones éticas locales.
  2. Aísle los PMBC de la sangre del cordón umbilical por separación densidad-gradiente de acuerdo con el protocolo del fabricante.
  3. Aísle las células CD34+ de la población de PBMC enriqueciéndose primero con anticuerpos contra marcadores comunes para células maduras, lo que induce la reticulación de células de linajes no deseados con glóbulos rojos. Esto es seguido por el enriquecimiento de células CD34+ usando cuentas magnéticas, según el protocolo del fabricante.
    1. Determine el recuento de células vivas por exclusión estándar de trypan azul mediante la reposición de 10 sL de suspensión celular en 90 s de color azul trypan. Añadir 10 l de esta solución a un hemacitómetro y contar las células no azules, de acuerdo con el protocolo del fabricante.
    2. Células crioconservación visibilmente CD34+ en 1 ml de DMSO al 10% en suero bovino fetal (FBS) hasta el día del trasplante de ratón.
    3. Crioconserva visitable una pequeña fracción de células aisladas (CD34+) y de flujo (CD34-) por separado para evaluar la pureza de las células madre CD34+ (30.000 células de cada muestra). Alternativamente, pruebe la pureza en células recién enriquecidas (ver paso 2 a continuación).
    4. Congele una fracción de flujo no peletado (CD34-) para determinar el estado CCR5n.o 32. Las células se pueden congelar directamente sin solución de congelación condicionada, pero la presencia de glóbulos rojos en el pellet puede inhibir la PCR posterior si el flujo a través es peletizado.

2. Evaluar la pureza de las células madre CD34+ a través de la citometría de flujo

  1. Descongelar las células aisladas (CD34+) y las células de flujo a través (CD34-). Lavar las células mediante la reanimación de las células de cada vial en 9 ml de tampón FACS a temperatura ambiente (RT), que consiste en 2% de suero bovino fetal (FBS) en solución salina con fosfato (PBS).
  2. Centrífuga durante 5 min a 300 x g a RT a las células de pellets.
  3. Vierta el sobrenadante, resuspenda las células del líquido restante y transfiera a los tubos FACS. Repita el paso de lavado con 3 ml de tampón FACS. Después de la segunda centrifugación, vierta el sobrenadante y resuspenda las células en el líquido restante.
  4. Añadir 5 l de solución de bloqueo del receptor Fc(Tabla de materiales)y dejar durante 10 minutos en RT. No lave la solución de bloqueo del receptor Fc.
  5. Agregue la mezcla que contiene volúmenes predeterminados de anticuerpos contra CD3 humano (clon SK7) BUV395, CD34 (clon AC136), FITC y CD45 (clon 2D1) APC (Tabla 1). Deje las celdas durante 30 minutos en RT en la oscuridad. Los fluoróforos deben elegirse en función de parámetros que puedan evaluarse con los citometros de flujo disponibles sin necesidad de una matriz de compensación.
  6. Lave las células con 3 ml de tampón FACS.
  7. Centrífuga durante 5 min a 300 x g a RT para peletizar las células.
  8. Vierta el sobrenadante y resuspenda las células del líquido restante.
    1. Repita este paso de lavado 2x para asegurarse de que se han eliminado todos los anticuerpos no unidos.
  9. Registre las muestras en el citometro de flujo(Tabla de materiales)y realice el análisis de datos con el software adecuado. La estrategia de gating se presenta en la Figura 1A–F.

3. Examen genético para las variantes ccr532 en la sangre del cordón umbilical

  1. Incubar 1,25 l de flujo no peletado con 11,25 l de mezcla de PCR que contiene 200 m de mezcla dNTP, 0,01 U/L de polimerasa de ADN de alta fidelidad de 0,01 U/L, y las imprimaciones delanteras e inversas detalladas en el Cuadro 2.
    1. Ajuste el volumen con agua libre de nucleasas a aproximadamente 12,5 l para cada reacción de PCR.
  2. Amplifique los fragmentos genómicos con el programa de ciclismo PCR detallado en la Tabla 3.
  3. Separe los productos de PCR en un gel de agarosa del 2%13.
    1. Los productos de PCR de los alelos de tipo salvaje y los alelos 32 producen fragmentos de PCR de 196 pares de base y 164 bandas de pares de base respectivamente, haciéndolos fácilmente distinguibles por electroforesis de gel13 (Figura 1G).

4. Trasplante de células madre intravenosas

NOTA: Hacer que una persona prepare las células en el laboratorio y otra persona prepare los ratones y el espacio de trabajo para los trasplantes es un enfoque eficiente.

  1. En una instalación animal, 4-6 h antes del trasplante planeado de las células madre, irradiar DE 6 a 7 semanas de edad hembra NOD. Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG)ratones (Tabla de materiales) con 0.75 Gy con una fuente Cs137. La mejor dosis de preacondicionamiento puede variar en función de la edad del ratón, la fuente de radiación y otros factores. Este proceso condiciona a los animales para un injerto exitoso con células madre humanas.
  2. En una instalación animal, prepare el espacio de trabajo del banco de flujo y todos los reactivos antes de llevar los ratones o celdas al espacio de trabajo.
    1. Coloque una almohadilla azul estéril para cubrir la superficie de trabajo del banco de flujo. Prepare una gasa estéril y un recipiente para objetos punzantes.
    2. Coloque una lámpara de calefacción desinfectada con 70% de etanol en el banco de flujo con una jaula de ratón estéril vacía debajo del calor.
  3. En el laboratorio, descongelar las células CD34+ aisladas y diluirlas en 9 ml de RPMI simple de 37 oC.
  4. Centrifugar las células a 350 x g durante 5 min a RT, desechar el sobrenadante por aspiración y resuspender el pellet en 1 ml de RPMI normal a 37 oC.
  5. Determine el recuento de celdas mediante la exclusión azul de trypan y ajuste el volumen a 200 s por ratón. Haga un extra para tener en cuenta la posible pérdida debido a los pasos de manipulación posteriores.
    1. Prepárese para trasplantar 75.000 células CD34+ por cada ratón.
    2. Las células se pueden mantener a 4 oC durante el transporte a las instalaciones del animal antes del trasplante. Evite mantener las células en hielo para reducir la agregación o el aglutinamiento.
  6. En las instalaciones de animales, lleve la jaula con los ratones al banco de flujo y transfiera los ratones a la jaula bajo la lámpara de calentamiento para dilatar los vasos sanguíneos. Deje un extremo de la jaula lejos de la fuente de calor para que los ratones puedan alejarse del calor al calentarse. Los ratones que se han movido al final de la jaula, lejos de la fuente de calor, están lo suficientemente calientes para una inyección exitosa de vena de cola.
  7. Cargue una jeringa lubricada de 1 ml por encima de la marca de 800 ml con células CD34+ suspendidas. El uso de una jeringa lubricada de 1 ml aliviará drásticamente la inyección intravenosa y aumentará la precisión de esta técnica.
  8. Coloque una aguja de 30 G 13 mm y prepare la aguja y la jeringa para inyección. Este orden de operación permite que la jeringa se cargue más rápido mientras se protege la integridad de las células a trasplantar dado el posible daño que puede ocurrir durante la rápida aspiración de las células a través de una aguja de calibre tan pequeño. Llene el cubo de la aguja con líquido presionando el émbolo y retire el líquido hasta la marca de 200 ml de la aguja.
  9. Coloque un ratón calentado (paso 4.6) en un restrainer utilizado para administrar inyecciones intravenosas. Inyecte cuidadosamente 200 s de la suspensión celular en la vena de la cola del ratón. Pasar 2 s realizando la inmersión y mantener la aguja insertada durante aproximadamente 2 s después de la finalización de la inyección. Esto garantiza que las células hayan migrado adecuadamente lejos del lugar de inyección antes de retirar la aguja.
  10. Según sea necesario, limpie la cola del ratón con gasa estéril para eliminar cualquier sangre visible. Vuelva a colocar el ratón en su jaula doméstica no calentada. Repita el procedimiento de inyección con los ratones restantes.

5. Recolección y procesamiento de sangre para análisis

NOTA: El injerto de células humanas en la sangre periférica se puede evaluar a través de la citometría de flujo 3-5 meses después del trasplante de células madre humanas.

  1. Extraiga muestras de sangre de los ratones utilizando técnicas locales aprobadas por la IACUC.
  2. Recoger un máximo de 70–100 l de sangre total en tubos estériles de microcentrífuga de PCR que contengan 10 ml de 0,5 M EDTA (pH a 8,0) para evitar la coagulación de la sangre.

6. Evaluación del injerto humano a través de la citometría de flujo

  1. Transfiera de 40 a 50 l de sangre a los tubos FACS.
  2. Añadir 5 l de solución de bloqueo del receptor Fc para evitar la unión inespecífica de anticuerpos y dejar durante 10 minutos en RT.
  3. Añadir la mezcla de anticuerpos antihumanos del ratón que contiene CD4 (clon SK3) BUV 496, CD8 (clon RPA-T8) BV421, CD3 (clon OKT3) FITC, CD19 (clon sj25c1) PE-Cy7, CD45 (clon 2D1) APC(Tabla 4) y dejar manchar en la oscuridad a RT durante 30 min. Los fluoróforos deben elegirse en función de parámetros que puedan evaluarse con los citometros de flujo disponibles sin necesidad de una matriz de compensación.
  4. Agregue 2 ml de un tampón de lising de glóbulos rojos apropiado a cada tubo para cargar los glóbulos rojos. Utilice un tampón de lisis formulado específicamente para la tinción de anticuerpos antes de la lisis de glóbulos rojos (un ejemplo adecuado se da en la Tabla de Materiales). Vortex brevemente para asegurar la distribución equitativa de las células en la solución de lising y dejar durante 10 minutos en RT. La distribución igual de las células es importante.
  5. Agregue 2 ml de búfer FACS para detener la reacción de lisis.
  6. Centrífuga durante 5 min a 300 x g a RT para peletizar las células.
  7. Vierta suavemente el sobrenadante y el vórtice hasta que las células se resuspendan.
  8. Añadir 3 ml de tampón FACS y centrífuga durante 5 min a 300 x g en RT.
  9. Vierta el sobrenadante y resuspenda las células.
  10. Registre las muestras en un citómetro de flujo adecuado y analice utilizando el software adecuado(Tabla de materiales). El análisis y los resultados representativos se describen en la Figura 2 y la Figura 3.

7. Exposición intravaginal al VIH

NOTA: El virus utilizado para la exposición intravaginal de los ratones se puede producir utilizando los protocolos17publicados anteriormente. El virus se mantiene a -80 oC y se transporta entre lugares mientras se almacena en hielo seco siguiendo protocolos aprobados localmente. El virus se almacena en hielo seco hasta inmediatamente antes de la exposición de los ratones. El virus se puede diluir en RPMI simple (evitar RPMI que tiene antibióticos o aditivos séricos) para lograr la concentración adecuada inmediatamente antes de la exposición (se utilizaron 21.400 UUs para esta exposición al IVAG). Una vez generado, mantener el stock diluido sobre hielo húmedo durante todo el procedimiento para evitar los ciclos de congelación de descongelación que se producirían si el virus diluido se coloca de nuevo en hielo seco una vez descongelado.

  1. Prepare todo el equipo y el espacio de trabajo del banco de flujo como se presenta en la Figura 4 antes de llevar los ratones o virus al banco de flujo (similar al paso 4.2).
    1. Coloque el foco de la lámpara de calefacción en el centro del espacio de trabajo donde se ubicará el ratón durante el procedimiento de exposición al VIH. La lámpara de calentamiento garantizará que no disminuya la temperatura corporal de los ratones. También se pueden utilizar otros equipos que controlan la temperatura (por ejemplo, una almohadilla de gel caliente o una manta de agua caliente circulante, de acuerdo con las regulaciones locales de la IACUC18).
    2. Lleve las puntas estériles de la pipeta de 20 l y una pipeta apropiada en el banco. Colocar un recipiente con desinfectante líquido(Tabla de Materiales)en el banco para la inactivación inmediata de materiales y líquidos que hayan estado en contacto con el virus.
  2. Coloque un ratón en una cámara con un 3% de gas isoflurano y toallas de papel. Este porcentaje de gas anestesiará a los animales en un plazo de 2-4 min. Al igual que con todos los demás materiales utilizados con ratones inmunodeficientes, el aparato de anestesia debe desinfectarse adecuadamente antes de su uso.
  3. Una vez anestesiado, transfiera el ratón a una almohadilla azul estéril debajo de la lámpara de calentamiento. Inserte el hocico del ratón en una máscara que suministra gas isoflurano continuo al 3% para mantener la anestesia. Sostenga el ratón en la base de la cola, el estómago mirando hacia arriba, con la mano apoyando el ratón hacia atrás como se muestra en la Figura 4.
  4. Con una punta de pipeta estéril, estimula el área genital acariciando suavemente hacia arriba hacia el ano para inducir el vaciado del recto, aliviando la presión en la vagina.
  5. Deslumbra cuidadosamente la abertura vaginal envolviendo la cola del ratón a través de los dedos de tal forma que la vulva se abra naturalmente, tal vez con un ligero empujón usando una punta de pipeta estéril.
  6. Cambie la punta de la pipeta y la pipeta de 20 ml de virus atraumaticalmente en la vagina del ratón sin crear burbujas. No inserte la punta profundamente en la vagina. Más bien, con la vulva abierta, coloque la punta de la pipeta a nivel de la abertura vaginal, evite profundizar para eliminar el potencial de abrasiones durante el proceso de inoculación, libere el virus y permita que la gravedad tire del virus hacia la vagina. Alternativamente, utilice una aguja recta de extremo romo de 22 G 1,25 mm, como se describe en Veselinovic et al.6.
  7. Conservar el ratón en esta posición con la vagina hacia arriba durante 5 minutos después de la exposición para evitar fugas inducidas por gravedad de la suspensión del virus.
    1. Coloque cuidadosamente el ratón en la jaula de casa, teniendo cuidado de colocar el ratón sobre su espalda.

8. Procesamiento de muestras de sangre antes del análisis de carga viral

  1. Recoja la sangre como se describe en la sección 5 anterior.
  2. Centrifugar las muestras de sangre durante 5 min a 500 x g en RT para separar el plasma y las células.
  3. Recoger 40 s l de plasma para la medición de la carga viral en un nuevo tubo de microcentrífuga estéril aprobado por PCR y almacenar a -80 oC durante al menos 1 h hasta su posterior procesamiento. Es importante congelar todas las muestras antes de la extracción de ARN para evitar el riesgo de sesgo de comparar los niveles de ARN en muestras que no se han congelado antes del aislamiento del ARN a muestras congeladas antes del aislamiento del ARN.
  4. Ajustar el volumen de sangre de nuevo al volumen original añadiendo 40 l de medios de suspensión (PBS con albúmina sérica bovina 2,5%, 50 U/ml de penicilina G y estreptomicina, y 10 U/ml dNase, filtrado estéril a 0,22 m).
  5. Transfiera 15 ml del volumen sanguíneo ajustado a un nuevo tubo de microcentrífuga aprobado por PCR.
  6. Añadir 1 mL de 1x solución de lisis RBC(Tabla de Materiales),vórtice, e incubar durante 10 min a RT.
  7. Centrífuga durante 1 min a 9.600 x g a RT a las células de pellets.
  8. Aspirar sobrenadante y dejar sólo el pequeño pellet de células blancas, porque la contaminación de glóbulos rojos puede inhibir la PCR.
  9. Conservar el pellet a -80oC durante al menos 1 h hasta su posterior procesamiento.
    NOTA: Opcionalmente, cualquier sangre restante del paso 8.4 se puede utilizar para el análisis de citometría de flujo, como se describe anteriormente en el paso 6.

9. Extracción de ADN mediante un método de extracción de proteinasa K

  1. Extraer ADN de pellets de células periféricas (generados en el paso 8.8) utilizando un método de extracción de proteinasa K como se describe a continuación. Este método se ha demostrado para extraer el mayor rendimiento de ADN de un pequeño volumen de sangre como el requerido para las colecciones de sangre en serie utilizadas en este estudio19.
  2. Añadir 25 ml de proteinasa K (20 g/ml) a 1 ml de tampón Tris de 0,1 M.
  3. Vortex la solución de proteinasa K brevemente.
  4. Añadir 50 l de la solución de proteína K a cada pellet celular a digerir.
  5. Mezclar pipeteando hacia arriba y hacia abajo y confirmar la resuspensión del pellet celular.
  6. Agitar en un termoagitador(Tabla de Materiales)a 400 rpm (dependiendo del instrumento) a 56 oC durante 1 h. Tubos de cinta hacia abajo para mantenerlos en su lugar, si es necesario.
  7. Inmediatamente y en el mismo termoagitador, inactivar la proteinasa K con un cambio de temperatura a 95 oC mientras el temblor continúa durante 20 minutos adicionales.
  8. Vórtice cada muestra.
  9. Coloque cada muestra a -80 oC durante un mínimo de 30 min.
  10. Descongelar, luego centrifugar las muestras a 17.000 x g durante 1 min a RT para pellet fragmentos celulares no deseados.
  11. Coloque el sobrenadante que contiene ADN en un nuevo tubo de microcentrífuga.
  12. La plantilla de ADN está lista para PCR. Las plantillas de ADN se pueden almacenar a -80 oC.

10. Extracción de ARN, síntesis de ADNc y cuantificación ddPCR del ARN viral

  1. Aísle el ARN del plasma del ratón descongelado con un kit de aislamiento de ARN de virus siguiendo el protocolo del fabricante(Tabla de materiales).
  2. Después de añadir la muestra a la columna, agregue un paso de tratamiento DNase en la columna para asegurar la eliminación de todo el ADN en la muestra de plasma.
    1. Para cada muestra, agregue 95 ml de solución de DNase libre de RNase (mezcle 2 SNase libre de ARN y tampón de reacción de 98 l) a la columna e incubar durante 15 minutos a RT.
  3. Almacene las muestras de ARN a -80 oC durante al menos 1 h antes de su posterior procesamiento. Es importante congelar todas las muestras después de la extracción de ARN evitar el riesgo de sesgo al comparar muestras que no se han congelado con muestras que se congelaron.
  4. Sintetizar cDNA usando un paso de transcriptasa inversa utilizando reactivos como se describió anteriormente20. Asegúrese de añadir 0,5 ml de un inhibidor de la RNase a la reacción de ADNc para evitar la degradación del ARN.
    1. Realice la síntesis de ADNc con el programa detallado en la Tabla 5.
  5. Almacene las muestras de ADNc a -80 oC durante al menos 1 h. Es importante congelar todas las muestras después de la síntesis de ADNc evitar el riesgo de sesgo al comparar muestras que no se han congelado con muestras que se congelaron.
  6. Prepare las muestras para ddPCR de la siguiente manera20:
    1. Mezclar 3 l de la muestra de ADN con 11 l de la mezcla de sonda ddPCR (sin dUTP)20, 250 nM sonda de unión de ranuras menores, y 900 nM de cada una de las imprimaciones delanteras e inversas, tal como se detalla en el Cuadro 6.
    2. Ajuste el volumen total de PCR a 22 l con agua libre de nucleasas.
  7. Emulsionar las mezclas de PCR con el aceite de generación de gotas para sondas en un generador de gotas de acuerdo con el protocolo del fabricante y las descripciones anteriores20.
  8. Ejecute el programa PCR como se detalla en la Tabla 7.
    NOTA: Las secuencias de imprimación/sonda y los programas de PCR que se muestran aquí han sido diseñados y optimizados específicamente para la detección sensible de la cepa de VIH RHPA4259. Las secuencias de imprimación y sonda se pueden ajustar fácilmente para detectar cualquier otra cepa de VIH de su elección.
  9. Detecte la fluorescencia de las gotas de las muestras en un lector de gotas y analice los resultados con el software adecuado de acuerdo con el protocolo del fabricante.

11. Tratamiento con chow que contiene cART

  1. Ratones piensos con pellets que contengan un régimen estándar de cART que contenga 4.800 mg/kg de raltegravir (RAL), 720 mg/kg de tenofovir disoproxilo fumarato (TDF) y 520 mg/kg de emtricitabina (FTC)21 (Tabla 8). Estas dosis se determinaron suponiendo que un ratón pesa 25 g y come 4 g de comida por día. Esto corresponde a una dosis diaria de 768 mg/kg RAL, 2,88 mg/kg TDF y 83 mg/kg FTC21.
  2. Utilice una dieta cART que ha sido preparada por un proveedor externo (Ver Tabla de Materiales)de medicamentos recetados. Otras empresas potencialmente también podrían producir este régimen. Utilice una dieta cART de color rojo para distinguirla fácilmente de la comida normal de ratón.
    1. Producir una dieta de comida de control sin cART en un color marrón estándar para una fácil distinción.
  3. Para iniciar el cART, preparar jaulas de ratón estériles con la adición de dieta de chow que contiene cART, y luego transferir los ratones de la vieja jaula a la nueva jaula.
    1. Supervisar el peso de los ratones y el consumo de chow que contiene cART mediante inspección visual para asegurarse de que los ratones se están ajustando al cambio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La estrategia de gating para el análisis de la pureza de las células madre se muestra en la Figura 1. La Figura 1A–C muestra la población CD34+ purificada y la Figura 1D–F el flujo-a través del CD34 utilizado para ilustrar que la cantidad mínima de la población CD34+ se pierde en el proceso de aislamiento. La pureza de las células madre aisladas CD34+ fue de entre 85%-95% con menos del 1% de contaminación de las células T. La Figura 1G representa las bandas CCR5 de un donante de control humano adulto con el genotipo CCR532/wt, seguido de bandas de dos donantes CCR5wt/wt y un CCR532/wt de células madre. La frecuencia del genotipo CCR532/wt en un grupo de 19 donantes fue del 15,8%(Figura 1H). Esto está de acuerdo con estudios epidemiológicos más amplios14,15 que informan del genotipo en hasta el 23,6% de las personas investigadas en Dinamarca.

Los niveles de CD45+ humanos en sangre periférica de ratones se evaluaron mediante citometría de flujo de 3 a 5 meses después del trasplante de células madre CD34+ humanas. La estrategia de gating se presenta en la Figura 2A–E. La Figura 3A y la Figura 3B ilustran la variabilidad entre 10 y 16 ratones individuales que reciben células madre de dos donantes diferentes. El trasplante de 75.000 células hCD34+ produjo un CD45+ humano del 20%–50% en la sangre periférica. Todos los ratones desarrollaron células B y T humanas, incluidas las células T CD4 y CD8+.

Para las exposiciones intravaginales atraumáticas, se utilizó la configuración que se muestra en la Figura 4. Los ratones fueron anestesiados en una cámara cerrada y mantenidos bajo anestesia durante la exposición. Los ratones se sostuvieron con la vagina hacia arriba durante 5 minutos después de la exposición para garantizar el compromiso de la solución de virus con las superficies mucosas.

La Figura 5A muestra la tasa de éxito de transmisión del VIH del 64% observada con este modelo. Los ratones fueron desafiados con 21.400 unidades infecciosas (UI) de RHPA4259 por vía intravaginal. Esta dosis dio lugar a que el 64% de los ratones se infectaran con el VIH después de la exposición vaginal. Para la comparación, se incluyen los datos de dos cohortes diferentes de ratones expuestos a través de una vía intravenosa. Como era de esperar, el 100% de los ratones se convirtieron en VIH+ con dosis similares de RHPA y una cepa adicional (YU2) utilizando esta ruta.

La Figura 5B muestra los resultados representativos de tres ratones que se infectaron con el VIH y cambiaron a una dieta que contiene cART estándar. Los ratones fueron cambiados de nuevo a la comida regular del ratón después de 40 días de cART. En esta configuración de ensayo, el límite para la detección de carga viral fue de 725 copias/ml. Las cargas virales estaban por debajo del límite de detección después de 4 semanas de cART. Después del cese del cART, el virus repuntó, reflejando los datos clínicos22. Los ratones con cART toleraron el cambio en la dieta, así como se indica en la Figura 5C.

Figure 1
Figura 1: Estrategia representativa de la citometría de flujo para la validación de la pureza de las células madre y el estado de la variante del donante CCR5. (AC) La estrategia de gating utilizada para la población celular aislada CD34+. Los dobletes y los escombros están excluidos en los paneles A y B respectivamente (FSC-A frente a FSC-H y FSC-A frente a SSC-A). (C) La frecuencia de las células madre CD34+ y la contaminación de las células T CD3+. (DF) La estrategia de paso de flujo a través de CD34. Los porcentajes en las puertas se calculan como una fracción de la población primaria. (G) Los resultados de un análisis de PCR CCR532/wt. Carril 1: ADN de un donante humano CCR532/wt, carriles 2 y 3: dos donantes de células madre humanas CCR5wt /wt, carril 4: Un donante de células madre humanas CCR5 32/wt. (H) La frecuencia del genotipo CCR532/wt en nuestro grupo de 19 muestras de células madre es del 15,8%. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Estrategia de gating de citometría de flujo para la validación del injerto y diferenciación de células humanas. La población total de células mononucleares de ratones humanizados se analizó a través de la citometría de flujo. (A) El porcentaje de células CD45+ humanas se determinó como una fracción del total de eventos registrados. (B) Posteriormente se excluyeron los dobletes basados en el gating FSC-A/FSC-H. (C) La verdadera población de linfocitos se definió en función del tamaño y la granularidad. (D) Los linfocitos se caracterizaron entonces como CD3+ (células T) o CD19+ (células B). (E) Las células T CD3+ eran células T CD4+ o células T CD8+. Los porcentajes en las puertas se calcularon como una fracción de la población padre. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Niveles representativos de humanización 4-5 meses después del trasplante de células madre con fracciones de subtipo celular para 10 y 16 ratones generados a partir de dos donantes humanos diferentes. (A) La población de células mononucleares (MNC) de 10 y (B) 16 ratones humanizados se analizaron a través de citometría de flujo y se encerrados como se presenta en la Figura 2. La fracción de las células CD45+ humanas se presenta como %hCD45 (del Total de Células MNC) y células %B y %T como una fracción de hCD45. Las células T se dividieron posteriormente en %CD4 y %CD8. Cada punto de datos representa un mouse. Los datos se presentan como media sd. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Configuración experimental del banco de laboratorio para la exposición intravaginal de ratones. Configuración experimental para la exposición al VIH de ratones humanizados a través de la vía intravaginal. El procedimiento se realiza en un banco de flujo donde todos los reactivos y superficies han sido esterilizados antes de su uso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Tasa de transmisión de la tensión del VIH a través de diferentes vías de exposición y eficacia y seguridad de la chow que contiene cart en la supresión viral. (A) Los ratones NOG humanizados se infectaron con éxito con dos cepas diferentes del VIH a través de la vía intravaginal o intravenosa. Los ratones fueron expuestos con 21,400 UI de RHPA4259 por vía intravaginal, 5,157 UI IV con RHPA4259, o 3,000 UI IV con YU2. Los detalles relativos a la exposición intravenosa de ratones humanizados no están incluidos en este protocolo. Las infecciones por VIH se trataron con éxito con un régimen de cART suministrado a través de la comida de ratón. (B) La carga viral disminuyó a la detección inferior para los tres ratones en el cART y el rebote surgió después del cese del cART. La línea punteada indica el límite de cuantificación a 725 copias/ml. Los ratones alimentados con chow cART tuvieron un desarrollo de peso similar al de los ratones alojados en la dieta de cART no cART durante el mismo período de tiempo, lo que indica que no hay preferencia de sabor o efectos secundarios de la dieta cART. (C) Los pesos se presentan como cambio de plegado en comparación con el inicio del cART. Cada punto de datos representa la media de tres animales - SD. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Objetivo de anticuerpos Clon Fluoróforo
CD3 clonar SK7 BUV395
CD34 clon AC136 Fitc
CD45 clonar 2D1 Apc

Tabla 1: Anticuerpos utilizados para determinar la pureza de las células madre. Panel de citometría de flujo multicolor sugerido para la evaluación de la pureza de las células madre. Listados son el objetivo de anticuerpos, el clon y el fluoróforo.

Detección CCR5-32 Imprimaciones
Imprimación delantera 5'CTTCATTACACCTGCAGCT'3
Imprimación inversa 5'TGAAGATAAGCCTCACAGCC'3

Tabla 2: Imprimaciones PCR de detección de variantes CCR5-32. Imprimaciones delanteras y inversas utilizadas para la detección de la deleción de 32 bp en el gen CCR5.

No. de Ciclos 1 45 1
Temperatura (C) 98 98/63/72 72 10
hora 30 s 10 s/30 s/15 s 5 min

Tabla 3: Programa PCR de detección de variantes CCR5-32. Programa de ciclismo PCR utilizado para la amplificación del gen CCR5.

Objetivo de anticuerpos Clon Fluoróforo
CD4 SK3 BUV 496
CD8 RPA-T8 BV421
CD3 OKT3 Fitc
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

Tabla 4: Anticuerpos utilizados para la determinación de la humanización del ratón. Panel de citometría de flujo multicolor sugerido para la humanización. Listados son el objetivo de anticuerpos, el clon y el fluoróforo.

No. de Ciclos 1 1
Temperatura (C) 51 80 4
hora 45 min 15 min

Tabla 5: programa de amplificación de ADNc. Programa utilizado para la amplificación del ADN de cadena complementario al ARN viral.

Cuantificación del VIH Imprimaciones
Imprimación delantera 5'AGGGCAGCATAGAGCAAAA'3
Imprimación inversa 5'CAAAGGAATGGGGGTTCTTT'3
Sonda FAM 5'ATCCCCACTTCAACAGATGC'3

Cuadro 6: Imprimaciones VIH ddPCR. Imprimaciones y sondas utilizadas para la amplificación ddPCR del ADNC viral.

No. de Ciclos 1 39 1
Temperatura (C) 95 95/54.5 98 4
hora 10 min 30 s/1 min 10 min

Cuadro 7: Programa VIH ddPCR. Programa de ciclismo PCR utilizado para la amplificación del ARN viral.

Raltegravir (RAL) 4800 mg/kg
Tenofovir disoproxilo fumarato (TDF) 720 mg/kg
Emtricitabina (FTC) 520 mg/kg

Tabla 8: Dieta para chow de ratón. La dieta de la dieta de la dieta de la dieta del ratón fue formulada como se publicó anteriormente21. La dieta de la comida se hizo sobre una base de comida de ratón estándar, y después de la producción, el alimento fue irradiado con 25 kGy y doble-bagged. La coma se almacenó a -20 oC hasta su uso.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El ratón gravemente inmunocomprometido tensa NOD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) es extremadamente adecuado para el trasplante de células y tejidos humanos. Las vías inmunitarias innatas y adaptativas en estos ratones están comprometidas. Los ratones NOG y NSG albergan una mutaciónscid de Prkdc que da como resultado una función celular T y B defectuosa. Además, estos ratones carecen de una cadena funcional de receptor de interleucina-2 (cadena gamma común, IL2rg) que es indispensable en los complejos de unión de muchas citoquinas clave como IL-2, IL-4, IL-7, IL-9, IL-15 e IL-21. Los ratones inmunodeficientes, como el NOG, trasplantados con un sistema inmunitario humano son una poderosa herramienta para el estudio de la transmisión del VIH y la inmunología. Las contribuciones en estos campos realizadas con ratones humanizados han sido ampliamente revisadas2,23,24,25,26. El uso de estos ratones para estudiar las respuestas inmunitarias innatas humanas también está ganando mayor atención27,28.

El objetivo de este manuscrito es proporcionar un protocolo completo de procedimientos de ratón y ddPCR para pasar de un ratón ingenuo a datos de transmisión y tratamiento del VIH. Nuestro sistema utilizó ddPCR para la cuantificación del ARN viral y el ADN. En una reacción ddPCR, los reactivos se dividen en hasta 20.000 gotas, cada una con una sola reacción de micro PCR independiente. La amplificación de un objetivo dentro de una gota conduce a una señal fluorescente positiva para esa gota. Por lo tanto, la lectura es binaria y, al aplicar análisis estadísticos de Poisson, el número de reacciones positivas se puede traducir directamente a un número de copias de plantilla en la muestra original. El beneficio de ddPCR radica en su capacidad para cuantificar directamente un objetivo independientemente de una curva estándar. Esto es particularmente atractivo cuando se analizan muestras de ARN que son difíciles de utilizar como curvas estándar PCR debido a su naturaleza lábil29. Además, al analizar varias réplicas de la misma muestra y combinar los puntos de datos individuales para la cuantificación final de la muestra, la naturaleza binaria de ddPCR permite reducir el límite de detección de copias de plantilla por ml de la muestra29. Esto es especialmente importante en un entorno de ratón humanizado, donde sólo se dispone de material de muestra limitado y se requiere alta sensibilidad.

La administración de cART a ratones humanizados se puede realizar mediante gavage oral o inyecciones intraperitoneales con soluciones de cART30,31,32, y como se ha demostrado recientemente, mediante la formulación en la dieta21. Uno de nuestros principales objetivos fue la implementación de un régimen cART en la dieta del ratón para reducir el estrés potencial en los animales debido a los pasos de manejo adicionales inherentes a otros métodos de administración de medicamentos. La dosis de medicamento que comerá un ratón se puede estimar con precisión en función de la ingesta media diaria de alimentos de los ratones33. La entrega oral a través de la dieta sirve como la ruta de entrega más fácil con un estrés mínimo para el animal y una carga de trabajo mínima para el manipulador. Basamos nuestra combinación de antivirales en estudios publicados anteriormente en ratones humanizados21,30. Además, nuestra estrategia cART es clínicamente relevante dado que la combinación de fármacos utilizada clínicamente es administrada por vía oral por pacientes de todo el mundo.

Se observan ciertas limitaciones con respecto al uso de ratones NOG. Es importante destacar que las células T humanas en estos ratones se cultivan en un ambiente timico de ratón, a diferencia de un entorno humano. El enfoque reciente se centra en la generación de cepas de xenoreceptores que tienen un entorno favorable para el desarrollo de respuestas inmunes humanas robustas. Estas nuevas cepas incluyen ratones inmunodeficientes que son transgénicos para moléculas MHC humanas, como A2. Estos modelos permiten respuestas de células T de antígeno restringido por HLA que dan como resultado una mejor maduración y funciones de efector del sistema inmune adaptativo34. Otro enfoque consiste en sustituir los genes de ratón por citoquinas humanas clave para IL-3/GM-CSF35, IL-636, IL-1537,TPO, M-CSF38e IL-7/TSLP31. Estos modelos han ganado mayor atención por su capacidad para generar una mejor diferenciación de los tipos de células innatas. Nuestro protocolo es fácilmente adaptable para la humanización y la infección por VIH de ratones utilizando cualquier cepa inmunodeficiente genética mejorada.

En resumen, la facilidad y utilidad del enfoque descrito facilita la investigación en campos relacionados con el VIH in vivo. Los ratones humanizados pueden ser una herramienta muy poderosa para guiar la investigación hacia la generación de mejores hipótesis de investigación. Junto con la generación de ratones humanizados más "humanos" con transgenes humanos, creemos que nuestro protocolo estandarizado contribuirá a la racionalización de los procedimientos experimentales en diferentes entornos de investigación.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no declaran conflictos de intereses.

Acknowledgments

Los autores desean dar las gracias al personal de Biomedicine Animal Facility de la Universidad de Aarhus, en particular a la Sra. Jani Kor por los esfuerzos de mantenimiento de las colonias y por el seguimiento de los pesos de los ratones. Los autores quieren agradecer al profesor Florian Klein por desarrollar el cART estándar de atención y por su orientación. El siguiente reactivo se obtuvo a través del Programa de Reactivos de SIDA de NIH, División de SIDA, NIAID, NIH: pRHPA.c/2635 (cat-11744) del Dr. John Kappes y la Dra. Christina Ochsenbauer.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics