Souris NOG humanisées pour l'exposition intravaginale au VIH et le traitement de l'infection par le VIH

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous avons développé un protocole pour la génération et l'évaluation d'un modèle de souris NOG humanisé et infecté par le virus de l'immunodéficience humaine basé sur la greffe de cellules souches, l'exposition intravaginale au virus de l'immunodéficience humaine et l'ARN PCR numérique de gouttelettes Quantification.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les souris humanisées fournissent une plate-forme sophistiquée pour étudier la virologie du virus de l'immunodéficience humaine (VIH) et pour tester les médicaments antiviraux. Ce protocole décrit l'établissement d'un système immunitaire humain chez les souris adultes NOG. Ici, nous expliquons toutes les étapes pratiques de l'isolement des cellules CD34 de Sang de cordon ombilical dérivées de CD34 Et de leur transplantation intraveineuse subséquente chez les souris, à la manipulation du modèle par l'infection par le VIH, thérapie antirétrovirale combinée ( cART), et l'échantillonnage de sang. Environ 75 000 cellules hCD34 sont injectées par voie intraveineuse chez les souris et le niveau de chimérisme humain, également connu sous le nom d'humanisation, dans le sang périphérique est estimé longitudinalement pendant des mois par cytométrie de flux. Au total, 75 000 cellules hCD34MD génèrent des cellules CD45 MD humaines de 20 % à 50 % dans le sang périphérique. Les souris sont sensibles à l'infection intravaginale par le VIH et le sang peut être échantillonné une fois par semaine pour l'analyse, et deux fois par mois pendant de longues périodes. Ce protocole décrit un analyse pour la quantification de la charge virale plasmatique à l'aide de gouttelettes PCR numérique (ddPCR). Nous montrons comment les souris peuvent être traitées efficacement avec un régime standard de soins de cART dans l'alimentation. La livraison de cART sous la forme de chow souris régulière est un raffinement significatif du modèle expérimental. Ce modèle peut être utilisé pour l'analyse préclinique des composés de prophylaxie pré-exposition systémiques et topiques ainsi que pour le dépistage de nouveaux traitements et stratégies de guérison du VIH.

Introduction

Le virus de l'immunodéficience humaine (VIH) est une infection chronique avec plus de 37 millions de personnes infectées dans le monde1. La thérapie antivirale combinée (cART) est un traitement salvateur, mais un traitement est toujours justifié. Il est donc nécessaire d'avoir des modèles animaux qui reflètent le système immunitaire humain et ses réponses afin de faciliter la poursuite de la recherche sur le VIH. Plusieurs types de souris humanisées qui sont capables de soutenir l'engraftment cellulaire et tissulaire ont été développés en transplantant des cellules humaines dans des souris sévèrement immunodéficientes2. Ces souris humanisées sont sensibles à l'infection par le VIH et constituent une alternative importante aux modèles non humains de virus de l'immunodéficience simienne des primates, car elles sont moins chères et plus simples à utiliser que les primates non humains. Les souris humanisées ont facilité la recherche sur la transmission virale du VIH, la pathogénie, la prévention et le traitement3,4,5,6,7,8,9,10,11.

Nous présentons un système modèle humanisé flexible pour la recherche sur le VIH mis au point en transplantant des cellules souches humaines dérivées du sang de cordon ombilical chez des souris de la NoD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) fond. En plus d'être d'origine non fœtale, la bioingénierie pratique de ces souris est moins exigeante techniquement par rapport aux procédures microchirurgicales impliquées dans la transplantation de la construction sang-foie-thymus (BLT).

Nous montrons comment établir l'infection par le VIH par transmission intravaginale et comment surveiller la charge virale plasmatique avec une configuration pcR numérique sensible de gouttelette (ddPCR). Par la suite, nous décrivons l'établissement de la cART standard donnée dans le cadre du régime quotidien de souris. L'objectif de ces méthodes combinées est de réduire le stress pour les animaux et de faciliter les expériences à grande échelle où le temps passé à manipuler chaque animal est limité12.

Chez l'homme, un génotype CCR5no 32/wt ou CCR55 et32 cause une réduction de la sensibilité à l'infection par le VIH par les virus émetteurs/fondateurs13, et certaines précautions doivent être prises lorsque la bioingénierie humanise des souris avec des cellules souches aux fins d'études sur le VIH. Cela est particulièrement vrai dans notre région parce que les variantes naturelles du gène CCR5, en particulier les suppressions de 32 euros, sont plus répandues dans les populations indigènes scandinaves et baltes que dans le reste du monde14,15. Ainsi, notre protocole inclut un test facile et à haut débit pour le dépistage des cellules souches hématopoïétiques des donneurs pour les variantes CCR5 avant la transplantation.

Pour l'exposition intravaginale nous avons choisi l'émetteur/fondateur R5 virus RHPA4259, isolé d'une femme dans un stade précoce de l'infection qui a été infecté intravaginally16. Nous avons exposé les souris à une dose virale qui était suffisante pour produire une transmission réussie dans la majorité des souris, mais en dessous d'un taux de transmission de 100%. Le choix d'une telle dose permet une plage dynamique suffisante du taux de transmission, de sorte que les effets antiviraux d'un candidat médicament peuvent entraîner des animaux protégés dans des expériences de prévention du VIH et une diminution de la charge virale pour les études de traitement.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tous les échantillons de sang de cordon ont été obtenus en conformité stricte avec les protocoles approuvés localement, y compris le consentement éclairé du don anonyme par les parents. Toutes les expériences sur les animaux ont été approuvées et réalisées conformément à la réglementation nationale danoise en vertu de la licence 2017-15-0201-01312.

CAUTION : Manipulez les souris et le sang exposés au VIH avec une extrême prudence. Décontaminer toutes les surfaces et les liquides qui ont été en contact avec le VIH avec un désinfectant confirmé contre le VIH (Tableau des matériaux).

1. Isolement des cellules souches humaines CD34MD

  1. Recueillir des échantillons de sang de cordon dans les tubes de collecte de sang enduits ed EDTA après les césariennes prévues ou les naissances vaginales et selon les approbations éthiques locales.
  2. Isoler les PMBC du sang de cordon par séparation densité-gradient selon le protocole du fabricant.
  3. Isolez les cellules CD34De de la population de PBMC en pré-enrichissant d'abord avec des anticorps contre des marqueurs communs pour les cellules matures, ce qui induit le croisement des cellules des lignées indésirables avec les globules rouges. Elle est suivie par l'enrichissement cellulaire CD34 À l'aide de perles magnétiques, selon le protocole du fabricant.
    1. Déterminer le nombre de cellules vivantes par exclusion bleue trypan standard en rependant 10 l de suspension cellulaire dans 90 'L de trypan bleu. Ajoutez 10 L de cette solution à un hémacytomètre et comptez les cellules non bleues, selon le protocole du fabricant.
    2. Viably cryopreserve CD34 MD cellules dans 1 ml de 10% DMSO dans le sérum bovin fœtal (FBS) jusqu'au jour de la transplantation de la souris.
    3. Viably cryopreserve une petite fraction des cellules isolées (CD34MD) et flow-through (CD34-) séparément pour évaluer la pureté des cellules souches CD34MD (30 000 cellules de chaque échantillon). Vous pouvez également tester la pureté sur les cellules fraîchement enrichies (voir l'étape 2 ci-dessous).
    4. Congeler une fraction de l'écoulement non-pelleté (CD34-) pour déterminer le statut CCR5no 32. Les cellules peuvent être congelées directement sans solution de congélation conditionnée, mais la présence de globules rouges dans la pastille peut inhiber le PCR subséquent si le flux à travers est granulé.

2. Évaluer la pureté des cellules souches CD34MD par cytométrie du débit

  1. Décongeler les cellules isolées (CD34MD) et les cellules accédantes (CD34-). Laver les cellules en rependant les cellules de chaque flacon dans 9 ml de tampon FACS à température ambiante (RT), composé de 2 % de sérum bovin fœtal (SF) en salin tamponné par le phosphate (PBS).
  2. Centrifugeuse pendant 5 min à 300 x g à RT aux cellules de granule.
  3. Verser le supernatant, resuspendre les cellules dans le liquide restant et transférer dans les tubes FACS. Répétez l'étape de lavage avec 3 ml de tampon FACS. Après la deuxième centrifugation, verser le supernatant et resuspendre les cellules dans le liquide restant.
  4. Ajouter 5 ll de solution de blocage des récepteurs Fc (Table of Materials) et laisser reposer 10 min à RT. Ne pas laver la solution de blocage du récepteur Fc.
  5. Ajouter le mélange contenant des volumes prédéterminés d'anticorps contre l'humain CD3 (clone SK7) BUV395, CD34 (clone AC136), FITC, et CD45 (clone 2D1) APC (tableau 1). Laisser les cellules pendant 30 min à RT dans l'obscurité. Les fluorophores doivent être choisis en fonction de paramètres qui peuvent être évalués avec les cytomètres de débit disponibles sans nécessiter une matrice de compensation.
  6. Laver les cellules avec 3 ml de tampon FACS.
  7. Centrifugeuse pendant 5 min à 300 x g à RT pour granuler les cellules.
  8. Verser le supernatant et resuspendre les cellules dans le liquide restant.
    1. Répétez cette étape de lavage 2x pour s'assurer que tous les anticorps non liés ont été enlevés.
  9. Enregistrez les échantillons sur le cytomètre de débit (Table of Materials) et effectuez l'analyse des données avec un logiciel approprié. La stratégie de gating est présentée dans la figure 1A-F.

3. Dépistage génétique des variantes CCR532 dans le sang de cordon ombilical

  1. Incuber 1,25 L de flux non granulé avec 11,25 l de mélange PCR contenant 200 M de mélange dNTP, 0,01 U/L de polymérase d'ADN haute fidélité, et les amorces avant et inversées détaillées dans le tableau 2.
    1. Ajustez le volume avec de l'eau sans nucléane à environ 12,5 L pour chaque réaction PCR.
  2. Amplifiez les fragments génomiques avec le programme de cyclisme PCR détaillé dans le tableau 3.
  3. Séparer les produits PCR sur un gel agarose13à 2 %.
    1. Les produits PCR des allèles de type sauvage et des allèles 32 produisent des fragments de PCR de 196 paires de base et de 164 bandes de paires de base respectivement, ce qui les rend facilement reconnaissables par l'électrophorèse de gel13 (Figure 1G).

4. Greffe de cellules souches intraveineuses

REMARQUE : Le fait qu'une personne prépare les cellules du laboratoire et qu'une autre personne prépare les souris et l'espace de travail pour les transplantations est une approche efficace.

  1. Dans une installation animale, 4 à 6 h avant la transplantation prévue des cellules souches, irradier 6 à 7 semaines de NOD femelle. Cg-Prkdccid Il2rgtm1Sug/JicTac (NOG) souris (Table of Materials) avec 0,75 Gy avec une source Cs137. La meilleure dose de préconditionnement peut varier en fonction de l'âge de la souris, de la source de rayonnement et d'autres facteurs. Ce processus conditionne les animaux pour l'engraftment réussi avec les cellules souches humaines.
  2. Dans une installation pour animaux, préparez l'espace de travail du banc d'écoulement et tous les réactifs avant d'amener les souris ou les cellules dans l'espace de travail.
    1. Placez un tampon bleu stérile pour couvrir la surface de travail du banc d'écoulement. Préparer la gaze stérile et un récipient de pointes.
    2. Placez une lampe chauffante désinfectée avec 70 % d'éthanol dans le banc d'écoulement avec une cage de souris stérile vide sous la chaleur.
  3. En laboratoire, décongeler les cellules CD34 MD isolées et les diluer dans 9 ml de RPMI ordinaire de 37 oC.
  4. Centrifuger les cellules à 350 x g pendant 5 min à RT, jeter le supernatant par aspiration, et resuspendre la pastille dans 1 ml de RPMI ordinaire à 37 oC.
  5. Déterminez le nombre de cellules par exclusion bleue trypan, et ajustez le volume à 200 L par souris. Faites un supplément pour tenir compte de la perte possible due aux étapes de manipulation ultérieures.
    1. Préparez-vous à transplanter 75 000 cellules CD34MD par 200 L dans chaque souris.
    2. Les cellules peuvent être maintenues à 4 oC pendant le transport à l'établissement animalier avant la greffe. Évitez de garder les cellules sur la glace pour réduire l'agrégation ou l'agglutination.
  6. Dans l'établissement animalier, apportez la cage avec les souris dans le banc d'écoulement et transférez les souris à la cage sous la lampe chauffante pour dilater les vaisseaux sanguins. Laissez une extrémité de la cage loin de la source de chaleur afin que les souris puissent s'éloigner de la chaleur lorsqu'elles deviennent chaudes. Les souris qui se sont déplacées à l'extrémité de la cage, loin de la source de chaleur, sont suffisamment chaudes pour une injection réussie de veine de queue.
  7. Chargez une seringue lubrifiée de 1 ml au-dessus de la marque de 800 l avec des cellules CD34 suspendues. L'utilisation d'une seringue lubrifiée de 1 ml facilitera considérablement l'injection intraveineuse et augmentera la précision de cette technique.
  8. Fixer une aiguille de 30 G 13 mm et préparer l'aiguille et la seringue pour l'injection. Cet ordre de fonctionnement permet de charger la seringue plus rapidement tout en protégeant l'intégrité des cellules à transplanter étant donné les dommages possibles qui peuvent se produire pendant l'aspiration rapide des cellules à travers une aiguille de petite jauge. Remplissez le moyeu d'aiguille avec du liquide en appuyant sur le piston et retirez le liquide jusqu'à la marque de 200 ll de l'aiguille.
  9. Placez une souris chauffée (étape 4.6) dans un reforeur utilisé pour donner des injections intraveineuses. Injecter soigneusement 200 l de la suspension cellulaire dans la veine de la queue de la souris. Passez 2 s effectuer le plongeon et garder l'aiguille insérée pendant environ 2 s après la fin de l'injection. Cela garantit que les cellules ont migré adéquatement loin du site d'injection avant l'enlèvement de l'aiguille.
  10. Au besoin, essuyez la queue de la souris avec de la gaze stérile pour enlever tout sang visible. Remettez la souris dans sa cage domestique non chauffée. Répétez la procédure d'injection avec les souris restantes.

5. Collecte et traitement de sang pour l'analyse

REMARQUE : L'engraftment humain de cellules dans le sang périphérique peut être évalué par l'intermédiaire de la cytométrie de flux 3-5 mois après la transplantation humaine de cellules souches.

  1. Prélever des échantillons de sang sur les souris à l'aide de techniques locales approuvées par l'IACUC.
  2. Recueillir un maximum de 70 à 100 l de sang total dans des tubes de microcentrifuge DE PCR stériles contenant 10 L de 0,5 M EDTA (pH à 8,0) pour éviter la coagulation du sang.

6. Évaluation de l'engraftment humain par cytométrie de flux

  1. Transférer 40 à 50 l de sang dans les tubes FACS.
  2. Ajouter 5 ll de solution de blocage du récepteur Fc pour éviter la liaison non spécifique des anticorps et laisser pendant 10 min à RT.
  3. Ajouter le mélange d'anticorps anti-humains de souris contenant CD4 (clone SK3) BUV 496, CD8 (clone RPA-T8) BV421, CD3 (clone OKT3) FITC, CD19 (clone sj25c1) PE-Cy7, CD45 (clone 2D1) APC (tableau 4) et laisser tacher dans l'obscurité à RT pendant 30 min. Fluorophores doivent être choisis en fonction de paramètres qui peuvent être évalués avec les cytomètres de débit disponibles sans compensation nécessitant une matrice.
  4. Ajouter 2 ml d'un tampon de lysing de globule rouge approprié à chaque tube pour lyser les globules rouges. Utilisez un tampon de lyse spécialement formulé pour la coloration des anticorps avant la lyse des globules rouges (un exemple approprié est donné dans le Tableau des matériaux). Vortex brièvement pour assurer une distribution égale des cellules dans la solution de lysing et laisser pendant 10 min à RT. La distribution égale des cellules est importante.
  5. Ajouter 2 mL de tampon FACS pour arrêter la réaction de lyse.
  6. Centrifugeuse pendant 5 min à 300 x g à RT pour granuler les cellules.
  7. Verser le supernatant et le vortex doucement jusqu'à ce que les cellules soient remises en suspension.
  8. Ajouter 3 mL de tampon FACS et centrifugeuse pendant 5 min à 300 x g à RT.
  9. Verser le supernatant et resuspendre les cellules.
  10. Enregistrez les échantillons sur un cytomètre de débit approprié et analysez à l'aide d'un logiciel approprié (Tableau des matériaux). L'analyse et les résultats des représentants sont décrits dans la figure 2 et la figure 3.

7. Exposition intravaginale au VIH

REMARQUE : Le virus utilisé pour l'exposition intravaginale des souris peut être produit en utilisant des protocoles précédemment publiés17. Le virus est maintenu à -80 oC et transporté entre les endroits alors qu'il est stocké sur de la glace sèche selon des protocoles approuvés localement. Le virus est stocké sur la glace sèche jusqu'à ce que immédiatement avant l'exposition des souris. Le virus peut être dilué en RPMI ordinaire (éviter rpMI qui a des antibiotiques ou des additifs sériques) pour atteindre la concentration appropriée immédiatement avant l'exposition (21 400 UI ont été utilisés pour cette exposition IVAG). Une fois généré, conservez le stock dilué sur de la glace humide tout au long de la procédure afin d'éviter les cycles de gel et de dégel qui se produiraient si le virus dilué était remis sur la glace sèche une fois décongelé.

  1. Préparer tout l'équipement et l'espace de travail du banc d'écoulement tel que présenté à la figure 4 avant d'amener les souris ou le virus dans le banc d'écoulement (semblable à l'étape 4.2).
    1. Placez la mise au point de la lampe chauffante au centre de l'espace de travail où la souris sera située pendant la procédure d'exposition au VIH. La lampe chauffante n'assurera aucune diminution de la température corporelle des souris. D'autres équipements qui contrôlent la température peuvent également être utilisés (p. ex. un tampon de gel chauffé ou une couverture d'eau chaude en circulation, selon les règlements locaux de l'IACUC18).
    2. Apportez des pointes de pipette stériles de 20 l et une pipette appropriée dans le banc. Placez un contenant contenant de désinfectant liquide(Tableau des matériaux)sur le banc pour l'inactivation immédiate des matériaux et des liquides qui ont été en contact avec le virus.
  2. Placer une souris dans une chambre avec 3% de gaz isoflurane et des essuie-tout. Ce pourcentage de gaz anesthésiera les animaux dans un rayon de 2 à 4 minutes. Comme avec tous les autres matériaux utilisés avec des souris immunodéficientes, l'appareil d'anesthésie doit être correctement désinfecté avant l'utilisation.
  3. Une fois anesthésié, transférer la souris sur un tampon bleu stérile sous la lampe chauffante. Insérez le museau de la souris dans un masque fournissant du gaz isoflurane continu de 3 % pour maintenir l'anesthésie. Tenez la souris à la base de la queue, l'estomac tourné vers le haut, avec votre main soutenant la souris en arrière comme représenté dans la figure 4.
  4. À l'aide d'une pointe de pipette stérile, stimuler la région génitale en caressant doucement vers le haut vers l'anus pour induire la vidange du rectum, soulageant la pression sur le vagin.
  5. Soigneusement nu l'ouverture vaginale en enveloppant la queue de souris sur vos doigts de telle sorte que la vulve s'ouvre naturellement, peut-être avec un léger coup de pied à l'aide d'une pointe de pipette stérile.
  6. Changer la pointe de pipette et pipette 20 L de virus atraumatically dans le vagin de souris sans créer des bulles. N'insérez pas la pointe profondément dans le vagin. Au contraire, avec la vulve ouverte, placez la pointe de pipette au niveau de l'ouverture vaginale, évitez d'aller plus loin pour éliminer le potentiel d'abrasions pendant le processus d'inoculation, relâchez le virus, et laissez la gravité tirer le virus dans le vagin. Alternativement, utilisez une aiguille émoussée de 22 G 1,25 mm, droite, comme décrit dans Veselinovic et al.6.
  7. Maintenez la souris dans cette position avec le vagin orienté vers le haut pendant 5 min après exposition pour éviter la fuite induite par la gravité de la suspension du virus.
    1. Placez soigneusement la souris dans la cage d'accueil, en prenant soin de placer la souris sur son dos.

8. Traitement des échantillons de sang avant l'analyse de la charge virale

  1. Recueillir le sang tel que décrit dans la section 5 ci-dessus.
  2. Centrifugeles les échantillons de sang pendant 5 min à 500 x g à RT pour séparer le plasma et les cellules.
  3. Recueillir 40 lde de plasma pour la mesure de la charge virale dans un nouveau tube de microcentrifugeisé approuvé par PCR stérile et stocker à -80 oC pendant au moins 1 h jusqu'à ce que le traitement se relâcha. Il est important de congeler tous les échantillons avant l'extraction de l'ARN afin d'éviter le risque de biais de comparer les niveaux d'ARN dans les échantillons qui n'ont pas été congelés avant l'isolement de l'ARN aux échantillons congelés avant l'isolement de l'ARN.
  4. Ajustez le volume de sang au volume d'origine en ajoutant 40 l de supports de suspension (PBS avec 2,5 % d'albumine bovine de sérum, 50 U/mL de pénicilline G et de streptomycine, et 10 U/mL DNase, filtré stérile à 0,22 m).
  5. Transférer 15 l de volume sanguin ajusté dans un nouveau tube de microcentrifuge approuvé par PCR.
  6. Ajouter 1 mL de 1x solution de lyse RBC (Table of Materials), vortex, et incuber pendant 10 min à RT.
  7. Centrifugeuse pendant 1 min à 9 600 x g à RT pour les cellules à granulés.
  8. Aspirez supernatant et ne laissez que la minuscule pastille de globules blancs, parce que la contamination des globules rouges peut inhiber la PCR.
  9. Conserver les granulés à -80 oC pendant au moins 1 h jusqu'à ce qu'ils soient traités.
    REMARQUE : En option, tout sang restant de l'étape 8.4 peut être utilisé pour l'analyse de cytométrie du débit, tel que décrit ci-dessus à l'étape 6.

9. Extraction d'ADN à l'aide d'une méthode d'extraction de protéase K

  1. Extraire l'ADN des granulés de cellules périphériques (générés à l'étape 8.8) à l'aide d'une méthode d'extraction de protéase K comme décrit ci-dessous. Cette méthode a été démontrée pour extraire le rendement d'ADN le plus élevé d'un petit volume de sang tel que celui exigé pour les collections de sang en série utilisées dans cette étude19.
  2. Ajouter 25 lde de protéinase K (20 g/mL) à 1 ml de tampon Tris de 0,1 M.
  3. Vortex la solution protéinase K brièvement.
  4. Ajouter 50 l de la solution protéinase K à chaque granule cellulaire à digérer.
  5. Mélanger en pipetting de haut en bas et confirmer la suspension de la pastille cellulaire.
  6. Secouer sur un thermoshaker (Table of Materials) à 400 tr/min (selon l'instrument) à 56 oC pendant 1 h. Tubes à ruban adhésif vers le bas pour les maintenir en place, si nécessaire.
  7. Immédiatement et dans le même thermoshaker, inactiver la protéase K avec un changement de température à 95 oC pendant que la secousse se poursuit pendant 20 min supplémentaires.
  8. Vortex chaque échantillon.
  9. Placer chaque échantillon à -80 oC pendant un minimum de 30 min.
  10. Décongeler, puis centrifuger les échantillons à 17 000 x g pendant 1 min à RT pour granuler des fragments cellulaires indésirables.
  11. Placez le supernatant contenant de l'ADN dans un nouveau tube de microcentrifuge.
  12. Le modèle d'ADN est prêt pour PCR. Les modèles d'ADN peuvent être stockés à -80 oC.

10. Extraction d'ARN, synthèse de cDNA, et quantification de ddPCR de l'ARN viral

  1. Isoler l'ARN du plasma de souris décongelé avec un kit d'isolement de l'ARN du virus suivant le protocole du fabricant (Tableau des matériaux).
  2. Après l'ajout de l'échantillon à la colonne, ajouter une étape de traitement DNase sur la colonne pour assurer l'élimination de tout l'ADN dans l'échantillon plasmatique.
    1. Pour chaque échantillon, ajouter 95 'L de solution DNase sans RNase (mélangedez 2 DNase sans RNAse et 98 tampons de réaction ll) à la colonne et incubez pendant 15 min à RT.
  3. Conserver les échantillons d'ARN à -80 oC pendant au moins 1 h avant d'être traité. Il est important de congeler tous les échantillons après l'extraction de l'ARN, d'éviter le risque de biais lorsqu'on compare des échantillons qui n'ont pas été congelés à des échantillons qui ont été congelés.
  4. Synthétiser l'ADNc à l'aide d'une étape de transcriptase inversée à l'aide de réactifs tels que décrits précédemment20. Assurez-vous d'ajouter 0,5 L d'un inhibiteur de la NAdàr à la réaction de l'ADNc afin d'éviter la dégradation de l'ARN.
    1. Effectuer la synthèse de l'ADNc avec le programme détaillé dans le tableau 5.
  5. Conserver les échantillons d'ADNc à -80 oC pendant au moins 1 h. Il est important de congeler tous les échantillons après la synthèse de l'ADC évite le risque de biais en comparant des échantillons qui n'ont pas été congelés à des échantillons qui ont été congelés.
  6. Préparer des échantillons pour ddPCR commesuit 20:
    1. Mélanger 3 ll de l'échantillon d'ADNc avec 11 l du mélange de sonde ddPCR (pas de dUTP)20, 250 nM sonde mineure liant la rainure, et 900 nM de chacune des amorces avant et inversées comme détaillé dans le tableau 6.
    2. Ajustez le volume total de PCR à 22 L avec de l'eau sans nucléane.
  7. Émulsifier le PCR se mélange avec droplet Generation Oil pour probes sur un générateur de gouttelettes selon le protocole du fabricant et les descriptions précédentes20.
  8. Exécuter le programme PCR tel que détaillé dans le tableau 7.
    REMARQUE : Les séquences d'apprêt/sonde et les programmes PCR affichés ici ont été spécialement conçus et optimisés pour la détection sensible de la souche VIH RHPA4259. Les séquences d'apprêt et de sonde peuvent facilement être ajustées pour détecter toute autre souche de VIH de choix.
  9. Détectez la fluorescence des gouttelettes à partir des échantillons sur un lecteur de gouttelettes, et analysez les résultats avec un logiciel approprié selon le protocole du fabricant.

11. Traitement avec chow contenant de la cART

  1. Nourrir les souris avec des granulés contenant un régime standard de cART contenant 4 800 mg/kg de raltégravir (RAL), 720 mg/kg de fumarate de disoproxil en ténofovir (TDF) et 520 mg/kg d'emtricitabine (FTC)21 (tableau 8). Ces doses ont été déterminées en supposant qu'une souris pèse 25 g et mange 4 g de chow par jour. Cela correspond à une dose quotidienne de 768 mg/kg RAL, 2,88 mg/kg TDF, et 83 mg/kg FTC21.
  2. Utilisez un régime cART qui a été préparé par un fournisseur externe (Voir tableau des matériaux) de médicaments d'ordonnance. D'autres entreprises pourraient également produire ce régime. Utilisez un régime cART rouge de couleur pour facilement le distinguer de chow souris ordinaire.
    1. Produire un régime de chow de contrôle sans cART dans une couleur brune standard pour la distinction facile.
  3. Pour l'initiation de la cART, préparer des cages de souris stériles avec l'ajout de cart-contenant le régime de chow, puis transférer les souris de l'ancienne cage à la nouvelle cage.
    1. Surveillez le poids des souris et la consommation de chow contenant de la technologie par inspection visuelle pour s'assurer que les souris s'adaptent au changement.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La stratégie de gating pour l'analyse de la pureté des cellules souches est représentée dans la figure 1. La figure 1A-C montre la population purifiée de CD34MD et la figure 1D-F le flux CD34 utilisé pour illustrer que la quantité minimale de la population de CD34 Est perdue dans le processus d'isolement. La pureté des cellules souches isolées CD34MD se trouvait entre 85 % et 95 % avec moins de 1 % de contamination par les lymphocytes T. La figure 1G représente les bandes CCR5 d'un donneur adulte de contrôle humain avec le génotype CCR532/wt, suivie par des bandes de deux cCR5wt/wt et d'un donneur de cellules souches CCR5no32/wt. La fréquence du génotype CCR5no 32/wt dans un groupe de 19 donneurs était de 15,8 %(figure 1H). Ceci est en accord avec des études épidémiologiques plus larges14,15 rapportant le génotype dans jusqu'à 23,6% des personnes étudiées au Danemark.

Les niveaux humains de CD45MD chez les souris ont été évalués par cytométrie de flux 3 à 5 mois après la transplantation des cellules souches humaines CD34MD. La stratégie de gating est présentée dans la figure 2A-E. La figure 3A et la figure 3B illustrent la variabilité entre 10 et 16 souris individuelles recevant des cellules souches de deux donneurs différents. La transplantation de 75 000 cellules hCD34MD a donné 20 % à 50 % de CD45 humain dans le sang périphérique. Toutes les souris ont développé des cellules B et T humaines, y compris les lymphocytes T CD4 et CD8MD.

Pour les expositions intravaginales atraumatic, la configuration représentée à la figure 4 a été utilisée. Les souris ont été anesthésiées dans une chambre fermée et maintenues sous anesthésie pendant l'exposition. Les souris ont été tenues avec le vagin faisant face vers le haut pendant 5 min après exposition pour assurer l'engagement de solution de virus avec des surfaces muqueuses.

La figure 5A montre le taux de réussite de 64 % de la transmission du VIH observé à l'aide de ce modèle. Les souris ont été défiées avec 21.400 unités infectieuses (IU) de RHPA4259 intravaginally. Cette dose a entraîné l'infection par 64 % des souris infectées par le VIH à la suite d'une exposition vaginale. À titre de comparaison, les données de deux cohortes différentes de souris exposées par voie intraveineuse sont incluses. Comme prévu, 100 % des souris sont devenues séropositives avec des doses similaires de RHPA et une souche supplémentaire (YU2) utilisant cette voie.

La figure 5B montre les résultats représentatifs de trois souris infectées par le VIH et qui sont passées à un régime alimentaire contenant de la cART standard. Les souris ont été retournées au chow régulier de souris après 40 jours de cART. Dans cette configuration d'analyse, la limite pour la détection de la charge virale était de 725 copies/mL. Les charges virales étaient toutes inférieures à la limite de détection après 4 semaines de cART. Après l'arrêt de la multithérapie, le virus a rebondi, reflétant les données cliniques22. Les souris sous multithérapie toléraient le changement de régime alimentaire, comme l'indique la figure 5C.

Figure 1
Figure 1 : Stratégie de gating de cytométrie représentative de flux pour la validation de la pureté des cellules souches et du statut de variante du donneur CCR5. (AetC) La stratégie de gating utilisée pour la population cellulaire isolée de CD34. Les doublets et les débris sont exclus dans les panneaux A et B respectivement (FSC-A c. FSC-H et FSC-A c. SSC-A). (C) La fréquence des cellules souches CD34MD et de la contamination par les lymphocytes T CD3MD. (D-F) La stratégie de gating CD34- flow-through. Les pourcentages dans les portes sont calculés comme une fraction de la population parente. (G) Les résultats d'une analyse CCR532/wt PCR. Voie 1 : ADN d'un donneur humain de CCR5no 32/wt, voies 2 et 3 : deux donneurs de cellules souches humaines CCR5wt/wt, voie 4 : A CCR5no 32/wt donneur de cellules souches humaines. (H) La fréquence du génotype CCR532/wt dans notre groupe de 19 échantillons de cellules souches est de 15,8%. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Stratégie de gating de cytométrie de flux pour la validation de l'engraftment et de la différenciation des cellules humaines. La population totale de cellules mononucléaires de souris humanisées a été analysée par cytométrie de flux. (A) Le pourcentage de cellules CD45 MD a été déterminé comme une fraction du total des événements enregistrés. (B) Les doublets ont par la suite été exclus en raison de la gating FSC-A/FSC-H. (C) La population réelle de lymphocytes a été définie en fonction de la taille et de la granularité. (D) Les lymphocytes ont ensuite été caractérisés comme étant des cellules CD3MD (cellules T) ou Des CD19 (cellules B). (E) Les lymphocytes T CD3MD étaient soit des lymphocytes T CD4MD, soit des lymphocytes T CD8MD. Les pourcentages dans les portes ont été calculés comme une fraction de la population parente. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Niveaux représentatifs d'humanisation 4 à 5 mois après la transplantation de cellules souches avec des fractions de sous-type cellulaire pour 10 et 16 souris générées par deux donneurs humains différents. (A) La population de cellules mononucléaires (MNC) de 10 et (B) 16 souris humanisées ont été analysées par cytométrie du débit et fermées telles que présentées à la figure 2. La fraction des cellules CD45 MD est présentée en %hCD45 (du MNC total), et % B et %T cellules comme une fraction de hCD45. Les lymphocytes T ont ensuite été divisés en %CD4 et %CD8. Chaque point de données représente une souris. Les données sont présentées comme moyennes et SD. Veuillez cliquer ici pour voir une version plus large de ce chiffre.

Figure 4
Figure 4 : Configuration expérimentale du banc de laboratoire pour l'exposition intravaginale des souris. Configuration expérimentale pour l'exposition au VIH de souris humanisées par voie intravaginale. La procédure est effectuée dans un banc d'écoulement où tous les réactifs et surfaces ont été stérilisés avant l'utilisation. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5 : Taux de transmission de la souche du VIH par différentes voies d'exposition et efficacité et sécurité du chow contenant de la coART dans la suppression virale. (A) Les souris NOG humanisées ont été infectées avec succès par deux souches différentes du VIH par l'intermédiaire de la voie intravaginale ou intraveineuse. Les souris ont été exposées avec 21.400 UI de RHPA4259 intravaginally, 5.157 UI IV avec RHPA4259, ou 3.000 UI IV avec YU2. Les détails concernant l'exposition IV des souris humanisées ne sont pas inclus dans ce protocole. Les infections à VIH ont été traitées avec succès avec un régime de cART livré par chow de souris. (B) La charge virale a diminué à la détection inférieure pour les trois souris sur cART et le rebond a émergé après l'arrêt de la cART. La ligne pointillée indique une limite de quantification à 725 copies/mL. Les souris nourries avec le chow de cART ont eu le développement semblable de poids que les souris logées sur le chow de non-cART pendant la même période de temps, indiquant aucune préférence de goût ou effets secondaires du régime de cART. (C) Les poids sont présentés comme un changement de pli par rapport au début de la cART. Chaque point de données représente la moyenne de trois animaux - SD. S'il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Cible d'anticorps Clone Fluorophore
CD3 (en) clone SK7 BUV395 (en)
CD34 (en) clone AC136 Fitc
CD45 (en) clone 2D1 Apc

Tableau 1 : Anticorps utilisés pour déterminer la pureté des cellules souches. Panneau de cytométrie de flux multicolore suggéré pour l'évaluation de la pureté des cellules souches. Sont énumérés la cible d'anticorps, le clone, et le fluorophore.

Détection cCR5-32 Amorces
Apprêt vers l'avant 5'CTTCATTACACCTGCAGCT'3
Apprêt inversé 5'TGAAGATAAGCCTCACAGCC'3

Tableau 2 : Amorces PCR de détection de variantes CCR5-32. Amorces avant et inverse utilisées pour la détection de la suppression de 32 pb dans le gène CCR5.

non. de Cycles 1 45 1
Température (C) 98 98/63/72 72 10
Temps 30 s 10 s/30 s/15 s 5 min

Tableau 3 : Programme PCR de détection de variantes CCR5-32. Programme de cyclisme PCR utilisé pour l'amplification du gène CCR5.

Cible d'anticorps Clone Fluorophore
CD4 (en) SK3 (en) BUV 496 ANNONCES
CD8 (en) RPA-T8 BV421 BV421 (bv421)
CD3 (en) OKT3 (en) Fitc
CD19 (en) sj25c1 (sj25c1) PE-Cy7 (en)
CD45 (en) 2D1 Annonces Apc

Tableau 4 : Anticorps utilisés pour la détermination de l'humanisation de la souris. Panneau de cytométrie de flux multicolore suggéré pour l'humanisation. Sont énumérés la cible d'anticorps, le clone, et le fluorophore.

non. de Cycles 1 1
Température (C) 51 80 4
Temps 45 min 15 min

Tableau 5 : programme d'amplification de l'ADNc. Programme utilisé pour l'amplification de l'ADN de brin complémentaire à l'ARN viral.

Quantification du VIH Amorces
Apprêt vers l'avant 5'AGGGCAGCATAGAGCAAAAA3
Apprêt inversé 5'CAAAGGAATGGGTTCTTT'3
Sonde FAM 5'ATCCCCACTTCAACAGATGC'3

Tableau 6 : Amorces d'amorces du VIH ddPCR. Amorces et sondes utilisées pour l'amplification ddPCR de l'ADNc viral.

non. de Cycles 1 39 1
Température (C) 95 95/54.5 98 4
Temps 10 min 30 s/1 min 10 min

Tableau 7 : Programme ddPCR sur le VIH. Programme de cyclisme PCR utilisé pour l'amplification de l'ARN viral.

Raltegravir (RAL) 4800 mg/kg
Fumarate de ténofovir disoproxil (TDF) 720 mg/kg
Emtricitabine (FTC) 520 mg/kg

Tableau 8 : Alimentation de chow de cART de souris. Le régime de chow de souris a été formulé comme précédemment édité21. Le régime de chow a été fait sur une base de chow de souris standard, et après la production, la nourriture a été irradiée avec 25 kGy et double-bagged. Le chow a été stocké à -20 oC jusqu'à l'utilisation.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

La souche de souris sévèrement immunocompromise NOD. Cg-PrkdccidIl2rgtm1Sug/JicTac (NOG) est extrêmement bien adapté pour la transplantation de cellules et de tissus humains. Les voies immunitaires innées et adaptatives chez ces souris sont compromises. Les souris NOG et NSG abritent une mutation descid de Prkdc qui a comme conséquence la fonction défectueuse de cellules de T et de B. En outre, ces souris n'ont pas un récepteur fonctionnel interleukin-2 -chaîne (chaîne gamma commune, IL2rg) qui est indispensable dans les complexes de liaison de nombreuses cytokines clés telles que IL-2, IL-4, IL-7, IL-9, IL-15, et IL-21. Les souris immunodéficientes, comme le NOG, transplantées avec un système immunitaire humain sont un outil puissant pour l'étude de la transmission du VIH et de l'immunologie. Les contributions dans ces domaines faites à l'aide de souris humanisées ont été largement examinées2,23,24,25,26. L'utilisation de ces souris pour étudier les réponses immunitaires innées humaines gagnent également une attention accrue27,28.

L'objectif de ce manuscrit est de fournir un protocole complet de procédures de souris et de ddPCR pour passer d'une souris naïve à des données de transmission et de traitement du VIH. Notre système a utilisé ddPCR pour la quantification de l'ARN viral et de l'ADN. Dans une réaction ddPCR, les réactifs sont divisés en jusqu'à 20 000 gouttelettes, chacune contenant une seule réaction micro-PCR séparée. L'amplification d'une cible à l'intérieur d'une gouttelette conduit à un signal fluorescent positif pour cette gouttelette. Ainsi, la lecture est binaire et en appliquant des analyses statistiques Poisson, le nombre de réactions positives peut être directement traduit à un certain nombre de copies de modèle dans l'échantillon original. L'avantage de ddPCR réside dans sa capacité à quantifier directement une cible indépendamment d'une courbe standard. Ceci est particulièrement attrayant lors de l'analyse des échantillons d'ARN qui sont difficiles à utiliser comme courbes standard PCR en raison de leur nature labile29. En outre, en analysant plusieurs répliques d'un même échantillon et en fusionnant les points de données individuels pour la quantification de l'échantillon final, la nature binaire de ddPCR permet d'abaisser la limite de détection des copies de modèle par mL de l'échantillon29. Ceci est particulièrement important dans un paramètre de souris humanisé, où seul un échantillon limité est disponible et une sensibilité élevée est nécessaire.

L'administration de la cART aux souris humanisées peut être faite soit par gavage oral ou injections intrapéritoéales avec des solutions de cART30,31,32, et comme indiqué récemment, par la formulation dans le régime21. L'un de nos principaux objectifs était la mise en œuvre d'un régime de cART dans le régime alimentaire de la souris pour réduire le stress potentiel sur les animaux en raison des étapes de manipulation supplémentaires inhérentes à d'autres méthodes d'administration de médicaments. La dose de médicament qu'une souris va manger peut être estimée avec précision en fonction de l'apport alimentaire quotidien moyen des souris33. La livraison orale par l'alimentation sert de voie de livraison la plus facile avec à la fois un stress minimal pour l'animal et une charge de travail minimale pour le maître. Nous avons basé notre combinaison de médicaments antiviraux sur des études publiées précédemment chez des souris humanisées21,30. En outre, notre stratégie de cART est cliniquement pertinente étant donné que la combinaison de médicaments utilisée cliniquement est administrée par voie orale par des patients du monde entier.

Certaines limitations sont notées concernant l'utilisation de souris NOG. Fait important, les lymphocytes T humains chez ces souris sont cultivés dans un environnement thymique de souris, par opposition à un environnement humain. L'accent est récemment mis sur la génération de souches xénorecipient qui ont un environnement favorable pour le développement de réponses immunitaires humaines robustes. Ces nouvelles souches comprennent des souris immunodéficientes qui sont transgéniques pour les molécules humaines de MHC, telles que A2. Ces modèles permettent aux réponses à cellule T d'antigène HLA-restreints qui ont comme conséquence de meilleures fonctions de maturation et d'effecteur du système immunitaire adaptatif34. Une autre approche consiste à remplacer les gènes de souris par des cytokines humaines clés pour IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38, et IL-7/TSLP31. Ces modèles ont gagné une attention accrue pour leur capacité à générer une meilleure différenciation des types de cellules innées. Notre protocole est facilement adaptable pour l'humanisation et l'infection par le VIH chez les souris en utilisant une telle souche immunodéficiente de fond génétique améliorée.

En résumé, la facilité et l'utilité de l'approche décrite facilitent la recherche in vivo dans les domaines liés au VIH. Les souris humanisées peuvent être un outil très puissant pour guider la recherche vers la génération de meilleures hypothèses de recherche. En plus de la génération de souris humanisées plus « humaines » avec des transgènes humains, nous croyons que notre protocole normalisé contribuera à rationaliser les procédures expérimentales dans différents environnements de recherche.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ne déclarent aucun conflit d'intérêts.

Acknowledgments

Les auteurs tient à remercier le personnel de l'établissement pour animaux de biomédecine de l'Université d'Aarhus, en particulier Mme Jani Kûr pour les efforts d'entretien des colonies et pour le suivi du poids des souris. Les auteurs tiennent à remercier le professeur Florian Klein d'avoir développé une norme de soins et d'avoir été guidé. Le réactif suivant a été obtenu par l'entremise du Programme des agents de lutte contre le sida des NIH, Division du sida, NIAID, NIH : pRHPA.c/2635 (cat 11744) du Dr John Kappes et de la Dre Christina Ochsenbauer.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics