Fluorescente Rápida * These authors contributed equally

JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La combinación de ARN hibridación in situ fluorescente (FISH) con inmunofluorescencia (inmuno-FISH) crea una técnica que se puede emplear en el nivel de células individuales para detectar la dinámica espacial de la localización del ARN con la penetración simultánea en la localización de las proteínas, las modificaciones epigenéticas y otros detalles que puede ser resaltado mediante inmunofluorescencia. Inactivación del cromosoma X es un paradigma para largo ARN no codificante (lncRNA) mediada por silenciamiento génico. Transcripción específico (Xist) la acumulación lncRNA-X inactivo (llamado una nube de Xist) sobre uno de los dos cromosomas X en las hembras de mamíferos es un paso crítico para iniciar X-inactivación del cromosoma. ARN Xist interactúa directamente o indirectamente con diversas enzimas de la cromatina modificar y presenta distintos paisajes epigenéticos al cromosoma X inactivo (Xi). Una conocida seña de identidad de la epigenética Xi es la histona H3 trimetil-lisina 27 (H3K27me3) modificación. A continuación, describimos una forma sencilla y rápida inmuno-FISHProtocolo para la detección de Xist ARN utilizando ARN FISH con múltiples sondas de oligonucleótidos junto con inmunofluorescencia de H3K27me3 a examinar la localización de Xist ARN y modificaciones epigenéticas asociadas. El uso de sondas de oligonucleótidos resultados en un tiempo de incubación más corto y la detección más sensible de Xist ARN en comparación con el transcrito in vitro sondas de ARN (ribosondas). Este protocolo proporciona una poderosa herramienta para la comprensión de la dinámica de lncRNAs y su modificación epigenética asociada, la estructura de la cromatina, organización nuclear y la regulación transcripcional.

Introduction

Mamíferos inactivación del cromosoma X (XCI) es una estrategia para compensar el desequilibrio en la dosificación del gen ligado al cromosoma X entre XX y XY, en el que uno de los dos cromosomas X en las mujeres es transcripcionalmente inactiva 1. Inactivación del cromosoma X es un gran modelo para el sistema a largo ARN no codificante (lncRNA) investigación. Inactivación del cromosoma X está regulado por múltiples lncRNAs, y ha sido ampliamente estudiado en los últimos decenios para descubrir los mecanismos de diafonía entre lncRNAs, transcripción, estructura de la cromatina y la organización nuclear 2, 3.

El centro de la inactivación X (XIC), ubicado en el cromosoma X es un locus genético complejo compuesto de un número de genes que producen ARN no codificantes 4. -X inactivo transcripción específico (Xist) lncRNA en los mamíferos euterios es uno de esos lncRNA que desempeña un papel crucial en la inactivación del cromosoma X 5,6. Transcripciones Xist rodean la ubicación de la futura Xi para iniciar inactivación del cromosoma X, y aparece como una nube cuando se visualizan utilizando ARN FISH; esta formación se denomina como el "Xist nube" 7. Desde Xist ARN interactúa con varias enzimas de modificación de la cromatina, se observa co-localización de las nubes Xist con diferentes modificaciones epigenéticas de la cromatina y la transcripción en silencio durante represivo X-inactivación del cromosoma 8. Por ejemplo, Xist ARN interactúa con polycomb complejo represivo 2 (PRC2) que es responsable de H3K27me3 e induce un estado represivo cromatina 9. La aparición de la nube Xist en el Xi y su co-localización con la modificación intensiva H3K27me3 representa un paisaje heterocromatina facultativa de la Xi 10,11.

Técnicas citogenéticas, como el ADN / ARN FISH han recorrido un largo camino desde el método tradicional utilizando sondas radiomarcado 12 a las técnicas más recientes y avanzados con mayor sensibilidad yimágenes fluorescentes utilizando múltiples sondas de oligonucleótidos 13,14. ADN / ARN FISH junto con inmunofluorescencia se ha utilizado de forma rutinaria como una herramienta citológico de entender la organización espacio-temporal nuclear, la localización del ARN, la estructura de la cromatina y modificaciones. La preparación de la sonda estándar de la mayoría de ARN FISH implica el uso de plásmido o cromosoma artificial (BAC) clones bacterianos y su posterior etiquetado ya sea con la traducción nick o cebado aleatorio 15. Sin embargo, casi el 70% de los genes en ratones y 40% de los genes en los seres humanos muestran una superposición de sentido y antisentido transcripciones 16, por lo que requieren un método FISH específica de hebra a fin de distinguir sentido y antisentido transcripciones. In vitro sondas de ARN transcritos (ribosonda ) se utilizan a menudo para el capítulo específico de ARN FISH 17,18; sin embargo, esto implica la preparación de un clon de plásmido o producto de PCR con T7, SP6, o el promotor T3 y sintetizar ribosondas. Además, ribosondas derivado de genomaic ADN o ADNc a menudo contienen regiones no específicas y elementos repetitivos, que resultan en alto ruido de fondo. Otra cuestión es que ribosondas, que son unos pocos cientos de nucleótidos de longitud y contienen múltiples fluoróforos, no pueden penetrar de manera eficiente en el núcleo. Para evitar esto, múltiples sondas de oligonucleótidos más cortos marcados con un solo fluoróforo en el extremo han sido desarrollados que tienen una buena sensibilidad, potencia de la señal uniforme, y la facilidad de purificación y el manejo de 14. Además, los oligonucleótidos de ADN son generalmente más estable que el ARN. Se aplicó una estrategia similar de utilizar oligonucleótidos en Xist ARN FISH 19 con inmunofluorescencia para comprender la dinámica epigenéticas de la Xi inducidos por Xist lncRNA durante el proceso de inactivación del cromosoma X. Este protocolo describe la creación de sondas de oligonucleótidos y la preparación apropiada de las células, así como la utilización de inmunofluorescencia y ARN FISH. Xist ARN FISH utilizando múltiples oligonucleOtides es enfoque rentable en el largo plazo si Xist ARN FISH se realiza de forma rutinaria en el laboratorio de uno. Esta técnica se puede utilizar para identificar lncRNAs en las células mientras que la cartografía simultáneamente su co-localización con modificaciones o factores epigenéticos. Una ventaja importante del protocolo es la capacidad de modificar fácilmente para adaptarse a los propios intereses de investigación.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparación de la sonda

  1. Obtener múltiples oligonucleótidos únicos en Xist (oligonucleótidos 20-30 nucleótidos de longitud, 63-65 ºC de temperatura de fusión, Tabla 1) con una modificación 5'-amino y suspender en agua.
  2. Piscina cantidades equimolares de los oligonucleótidos con 5'-amino modificación (en total 4,5 g) y la etiqueta con colorante fluorescente-amina reactiva siguiendo las instrucciones del fabricante.
    1. Disolver los oligonucleótidos agrupados en últimos 5 l de agua libre de nucleasa y añadir 3 l de 1 M de bicarbonato de sodio a la solución de oligonucleótidos.
    2. Añadir 2 l DMSO al vial de tinte y de vórtice-amina reactiva brevemente.
    3. Mezclar la solución de oligonucleótido con el colorante reactivo en DMSO y se incuba la mezcla a temperatura ambiente durante 1 h en la oscuridad.
  3. Purificar las sondas de oligonucleótidos marcados con fluorescencia por la columna G-25 seguido por precipitación con etanol.
    1. Añadir 40 l de agua libre de nucleasa a la mezcla de etiquetado producido en la Etapa 1.2.3 y aplicar a la columna G-25. Centrifugar a 750 xg durante 2 min.
    2. Añadir 50 l de agua libre de nucleasa, 10 l 3 M acetato de sodio (pH 5,2) y 250 l de etanol a la sonda purificada de la etapa 1.3.2. Conservar a -80 ° C durante 30 minutos y se centrifuga a 21.000 xg durante 15 min a 4 ° C.
    3. Lavar los oligonucleótidos precipitados una vez con 1 ml de etanol al 70%.
    4. Vuelva a suspender en 50 l de agua libre de nucleasa o TE (10 mM Tris-HCl, pH 7,5; EDTA 1 mM) para una concentración final de aproximadamente 10 mM.
  4. Diluir las sondas de oligonucleótidos marcados con fluorescencia a una concentración final de 250 nM con tampón de hibridación (10% formamida; 2x SSC [NaCl 300 mM; citrato de sodio 30 mM]; 2 mg / ml BSA; sulfato de dextrano al 10%).
    NOTA: Con este protocolo FISH rápida, oligonucleótido pbatas en Xist fueron diseñados y utilizados a una concentración mayor que el protocolo normal de FISH usando sondas de oligonucleótidos con el fin de acortar el tiempo de incubación para la hibridación.

2. Preparación de los portaobjetos

NOTA: Los portaobjetos se puede preparar para la inmuno-FISH utilizando madre de ratón embrionarias (ES) o el cuerpo embrioide (EB) diferenciación de las células 20, 21 ya sea por crecimiento de ellos directamente en un portaobjetos tratados con poli-lisina o utilizando cytospin con suspensión celular. Aquí, se muestra la preparación de diapositivas cytospin.

  1. Aspirar el medio de cultivo en una placa de 6 pocillos. Lavar con PBS (temperatura ambiente), y aspirar a fondo.
  2. Añadir 0,5 ml de tripsina al plato de 6 pocillos, se incuba durante 5-10 minutos a 37 ° C.
  3. Añadir 5 ml de medio y dispersar las células pipeteando suavemente hacia arriba y abajo varias veces.
  4. Transferir las células a un tubo de 15 ml, centrifugar durante 5 min a 200 xg a temperatura ambiente.
  5. Deseche el medio de unad suspender suavemente las células en 2 ml de PBS.
  6. Contar las células usando un hemocitómetro, y se diluye la suspensión celular en 4 x 10 5 células / ml de PBS.
  7. Montar una diapositiva, una tarjeta de filtro y una cámara con un clip y colocarlos en las ranuras correspondientes en el rotor de la cytospin. Añadir 250 l de cada muestra preparada en el paso 2.6 en cada cámara de las unidades ensambladas en el cytospin. Centrifugar a 1500 rpm durante 10 min a temperatura ambiente.
  8. Llenar 3 frascos de Coplin en hielo con 40 ml cada uno de tampón PBS, CSK enfriado con hielo (tubos 10 mM, pH 6,8; NaCl 100 mM; sacarosa 300 mM; 3 mM de MgCl 2), y de amortiguamiento CSKT (tampón CSK con 0,5% Triton X-100), respectivamente.
  9. Después de que se terminó la cytospin, transferir rápidamente el portaobjetos en PBS enfriado con hielo y se incuba durante 5 min.
  10. Transferir el portaobjetos en tampón de CSK enfriado con hielo y se incuba durante 1 min.
  11. Transferir el portaobjetos en tampón de CSKT enfriado con hielo y se incuba durante 5 min.
  12. Transferir el portaobjetos de nuevo en helada CSK buffer e incubar durante 1 min.
  13. Transferir el portaobjetos en 4% de paraformaldehído en PBS y se incuba durante 10 min a temperatura ambiente.

3. La inmunofluorescencia

  1. Colocar los portaobjetos en un tarro Coplin con PBST (1x PBS con 0,1% de Tween-20) durante varios segundos.
  2. Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido fuera de la diapositiva y colocarla en una caja de pipeta de punta vacío con agua. Superposición de la diapositiva con 40 l de solución de bloqueo (1x PBS, 1% de BSA, 0,1% de Tween-20), colocar suavemente un cubreobjetos, y se incuba durante 10 min a temperatura ambiente.
  3. Retire el cubreobjetos, eliminar la solución de bloqueo, y añadir 40 l de anticuerpo primario diluido H3K27me3 histona a una concentración de 1: 500 en solución de bloqueo. Coloque el cubreobjetos de nuevo en el porta y se incuba durante 30 min a temperatura ambiente.
    NOTA: Un inhibidor de RNasa en la solución de bloqueo podría ser útil para preservar ARN en este ARN FISProtocolo H cuando se utilizan anticuerpos policlonales.
  4. Lave deslice 2 veces en frascos Coplin llenos de PBST, durante 5 minutos cada uno, agitando suavemente durante el lavado.
  5. Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido y coloque el portaobjetos de nuevo en la caja de propina. Superposición con 40 l de anticuerpo secundario (1: 500) diluido en solución de bloqueo, colocar un cubreobjetos, y se incuba durante 15 min en la oscuridad. Para los pasos siguientes, mantenga la diapositiva en la oscuridad en todo momento.
  6. Lavar 2 veces en Coplin frascos con PBST como en el paso 3.4.

4. ARN FISH con sondas de oligonucleótidos

  1. Pre-calentar un cuadro de pipeta de punta vacío con agua en la parte inferior para evitar que las diapositivas de secado a 37 ° C para el ARN FISH en el paso 4.3.
  2. Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido fuera de la diapositiva desde el paso 3.6 y colocar la placa en la caja de pipeta de punta con water en la parte inferior. Añadir 500 l de tampón de lavado FISH (10% de formamida en 2x SSC) en la diapositiva y se incuba durante 5 min a temperatura ambiente.
  3. Retire la solución de lavado FISH, añadir 8 l de sondas de oligonucleótidos en la diapositiva, coloque una hoja de la cubierta, y la transferencia de la diapositiva a una caja de pipeta de punta pre calentado con agua en el fondo; incubar a 37 ° C durante 1-2 horas.
  4. Coloque 3 frascos pre-calentado Coplin en un baño de agua a 37 ° C con tampón de lavado FISH, FISH tampón de lavado con DAPI, y 2x SSC.
  5. Después de 1-2 horas de incubación de ARN FISH, poner la diapositiva en el tampón de lavado FISH precalentado.
  6. Incubar el portaobjetos durante unos minutos hasta que el cubreobjetos se cae de la diapositiva.
  7. Colocar el portaobjetos de nuevo en el tampón de lavado, y continuar la incubación durante 5 min.
  8. Transferir la diapositiva a otra jarra Coplin con tampón de lavado pre-calentado FISH con 0,5 ng / ml DAPI y se incuba durante 5 min.
  9. Transferir la diapositiva a otra jarra Coplin con pre-calentado 2x SSC y se incuba durante 5 millasn.
  10. Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido y coloque el portaobjetos de nuevo en una caja de punta seca. Añadir 4 l de antifade con DAPI sobre el portaobjetos y colocar un cubreobjetos.
  11. Sellar el cubreobjetos con esmalte de uñas y observar con un microscopio. La corredera se puede almacenar a 4 ° C en la oscuridad durante unos pocos meses.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Imágenes representativas de rápida inmuno-FISH se muestran en la Figura 1A. Se detectó co-localización de la nube y H3K27me3 señal de Xist ARN en el Xi en la diferenciación de las células femeninas. Al día 12 de la diferenciación, más del 90% de las células EB tenía una nube Xist (Figura 1B). Sondas de oligonucleótidos corto penetraron de manera eficiente en los núcleos, que conduce a una visualización de casi todas las señales H3K27me3 co-localizada con Xist ARN (Figura 1C; 97%, n = 150).

Figura 1
Figura 1: ARN Xist y H3K27me3 co-localizar en el Xi en la diferenciación de ratón EB (A) Inmuno-FISH para Xist ARN con H3K27me3 modificación en la diferenciación de las células EB femeninos en el día 12 en la diferenciación.. Sondas Xist fueron etiquetados con Alexa Fluor 488, y anti-H3K27me3 anticuerpo primario era elprotegidos por anti-IgG de ratón Alexa Fluor 555-anticuerpo secundario conjugado. Los núcleos se counterstained con DAPI. La región en caja se magnifica en los paneles inferiores. Las barras de escala:... 10 micras (B) Frecuencia de células cloud- y H3K27me3-positivos Xist en EB en 12 días a la diferenciación (C) Frecuencia de co-localización de Xist nube con la señal H3K27me3 en EB en 12 días a la diferenciación favor haga clic aquí para ver una versión más grande de esta figura.

Tabla 1: Secuencia de oligonucleótidos marcados con fluorescencia para Xist ARN FISH. Los 48 oligonucleótidos fueron sintetizados con una modificación 5'-amino para preparar sondas de oligonucleótidos marcados con fluorescencia para Xist ARN FISH.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

En este trabajo, hemos presentado un protocolo de inmuno-FISH rápida que tarda menos de 5 horas para completar la preparación de diapositivas, Xist ARN FISH, y la inmunofluorescencia para H3K27me3. En comparación con el enfoque general de inmuno-FISH para Xist ARN de detección, que por lo general tiene una noche de incubación de ARN FISH, este protocolo no sólo reduce significativamente el tiempo pasado sino que también mejora la sensibilidad inmune-FISH usando sondas de oligonucleótidos.

Desde Xist es altamente transcrito durante la inactivación del cromosoma X-y su transcripción se encuentra a acumularse intensamente en el Xi en cis, es fácil de detectar Xist RNA señal en la diferenciación de células diferenciadas y por ARN FISH utilizando un tiempo relativamente breve incubación. Este protocolo inmuno-FISH podría aplicarse para otras proteínas de interés y abundante ARN, aunque la optimización de inmunofluorescencia y ARN FISH puede ser requerida. Con el fin de aplicar el Protocolo a otros ARN, el numtendría que ser considerado, seguido de optimización de ensayo y error de la concentración de la sonda, tiempo de incubación y la temperatura para el ARN FISH BER de posibles sondas de oligonucleótidos. Un ejemplo de otras aplicaciones es nuestro éxito anterior en la detección de ARN telomérico utilizando sondas LNA individuales 22. Para el diseño de la sonda y la preparación para la detección de blancos bajos de ARN abundantes, consulte el artículo de Raj y Tyagi 23. Otra cuestión que debe considerarse es el paso de permeabilización. Se requiere una cuidadosa consideración respecto diferente condición permeabilización; por ejemplo, los efectos más suaves que lo que se describe en el protocolo pueden ocurrir con la permeabilización después de la fijación 15. Varios procedimientos de permeabilización también deben tenerse en cuenta al llevar a cabo la inmuno-FISH utilizando diferentes tipos de células. El orden de inmunofluorescencia y ARN FISH también puede afectar a la detección de proteínas diana, modificaciones y ARN mediante inmuno-FISH. Si ARN FISH es realizared antes de inmunofluorescencia, una hora de incubación durante el segmento de ARN FISH es suficiente para detectar Xist RNA señal. Sin embargo, desde la formamida contenida en el tampón de hibridación y tampón de lavado FISH afecta negativamente H3K27me3 inmunofluorescencia, siempre realizamos H3K27me3 inmunofluorescencia antes de Xist ARN FISH en este protocolo. Para otras aplicaciones, el orden de los procedimientos dependerá de las proteínas diana y modificaciones epigenéticas a ser observados por inmunofluorescencia. A medida que el anticuerpo primario se utilizó para H3K27me3 inmunofluorescencia tiene un alto título y especificidad para H3K27me3 24, que son capaces de utilizar un tiempo de incubación más corto para inmunofluorescencia. Sin embargo, el tiempo de reacción y la temperatura para la inmunotinción dependen del anticuerpo utilizado y por lo tanto se necesita optimización para cada anticuerpo.

El uso de sondas de oligonucleótidos, Xist ARN de detección por el ARN FISH se mejoró significativamente. En nuestros estudios anteriores, encontramos que un subconjunto de difcélulas dife- con tinción H3K27me3 en el Xi no están asociados con la señal de Xist ARN 25. Desde modificación H3K27me3 en el Xi está asociada con el reclutamiento PRC2 por Xist RNA 9-11, 26, especulamos que esto era debido a la penetración ineficiente de ribosondas en los núcleos en comparación con el anticuerpo para inmunofluorescencia. Mediante el uso de sondas de oligonucleótidos en este protocolo, se observó que la señal H3K27me3 en la diferenciación de las células femeninas casi siempre co-localizados con Xist ARN (Figura 1).

Este protocolo inmuno-FISH rápida nos permite obtener una instantánea de los cambios dinámicos en torno Xist lncRNA y ofrece una nueva herramienta para ayudar a obtener una mejor comprensión de la forma en lncRNA funciona. IncRNAs afectar varias funciones celulares como la impronta genómica, regulación génica, la traducción del ARN y ARN maduración 27. El desarrollo de una mayor comprensión de la función diversas desempeñado por lncRNA ayudaría a impulsar el campo hacia adelante y permitir futuros descubrimientos en la regulación de procesos celulares vitales en el cuerpo humano, así como contribuir al desarrollo de posibles objetivos para los tratamientos de la enfermedad. Dado que este protocolo puede ser fácilmente optimizado con respecto a otros marcadores y lncRNAs de interés, es una gran herramienta para ayudar a enfrentar los misterios de diversos lncRNAs en las células.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Xp1 ggtaagtatccaaaaccccgttgg
Xp2 cgatcagcagcaacagtacacg
Xp3 gcaattggttgcttttatccagtcc
XP4 cgcaacaccgcacactaatacg
XP5 gccatcttagacacattcaagagcat
XP6 cacacgtgaagtaccaagcgaaac
XP7 gccacgtatagagcactgtaagagactatg
XP8 caaagcacactatcagacgtgtcg
Xp9 ggagaatctagatgccataaaggcaag
XP10 tgatggacactgcattttagcactg
Xp11 ggacactgcattttagcaatacgattc
XP12 gtgatgggcactgcattttagc
Xp13 agatgggctatctcagtcttataggct
XP14 ggaagtcagtatggagggggtatg
Xp15 tgggactgtgactactacagcaatga
Xp16 aagactcaattcctagtcaggattatccac
XP17 gggctgtagctctatgacagtgcttt
Xp18 gtcttcaccagatgcagattactacagtg
Xp19 aatagtttgaggaaggggtttcaagtg
XP20 gctgttcaggtttccttctgtagtga
Xp21 gcaagagatacaatggtccgaaaagt
Xp22 agcacttcgtacaaccctctttctg
Xp23 gaagagagcaggtcattcgtcagag
XP24 gcaactgagacactgtagccatatgaag
Xp25 ttcctggaggaagaacggaaaga
XP26 tgattagaaggcttaggtcatcttcca
Xp27 ttttgttcagagtagcgaggacttga
Xp28 aatagagcagaatggcttcctcgaa
Xp29 acattgcttgatcacgctgaagac
XP30 gcaaggaagaaatagacacacaaagc
Xp31 ggaagaaatagatgtaacaaagaattagacaca
XP32 cacttcagagccacttgaatcctg
Xp33 agtcacaggtgtcctgtagaaacagttc
Xp34 cctttatgggcaatggcaacaat
Xp35 ggcacatctgcatattgcttgtcta
Xp36 gcaactaagaccatgaacccacaa
Xp37 aaacacactggccttaagtatatggactg
Xp38 cattcatttgcacacatggaacaat
Xp39 tgggagacaatatttagcctccaggt
Xp40 cctagcaagggcactgttttgtaataa
Xp41 taacatttagcacactgccttgcac
Xp42 cagtgatctacactaggtccacctcaca
Xp43 ttatgttgaaggaatcttggccttg
XP44 aagtgagagctgtagtctcaaggtgtga
Xp45 gtattcaacctctgaggcaaactgtg
Xp46 agattgtggaacttagatggctgtca
Xp47 tggaactgcattaaagtcccaacttag
Xp48 gaactcccagacctcttcaacctg
Name Company Catalog Number Comments
oligonucleotides with 5’-amino modification IDT
Alexa Fluor 488 Reactive Dye Life Technologies A32750
MicroSpin G-25 columns GE Healthcare 27-5325-01
Cytospin 2 Shandon 59900102
Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer) Roche 10715859103
Histone H3K27me3 antibody Active Motif 61017
Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed Life Technologies A21424
ProLong Gold antifade reagent Life Technologies P36931

DOWNLOAD MATERIALS LIST

References

  1. Payer, B., Lee, J. T. X chromosome dosage compensation: how mammals keep the balance. Annu Rev Genet. 42, 733-772 (2008).
  2. Lee, J. T. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 12, 815-826 (2011).
  3. Gendrel, A. V., Heard, E. Fifty years of X-inactivation research. Development. 138, 5049-5055 (2011).
  4. Froberg, J. E., Yang, L., Lee, J. T. Guided by RNAs: X-inactivation as a model for lncRNA function. J Mol Biol. 425, 3698-3706 (2013).
  5. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature. 379, 131-137 (1996).
  6. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev. 11, 156-166 (1997).
  7. Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol. 132, 259-275 (1996).
  8. Sado, T., Brockdorff, N. Advances in understanding chromosome silencing by the long non-coding RNA. Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).
  9. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science. 322, 750-756 (2008).
  10. Plath, K., et al. Role of histone H3 lysine 27 methylation in X inactivation. Science. 300, 131-135 (2003).
  11. Silva, J., et al. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell. 4, 481-495 (2003).
  12. Gall, J. G. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc Natl Acad Sci U S A. 60, 553-560 (1968).
  13. Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. Visualization of single RNA transcripts in situ. Science. 280, 585-590 (1998).
  14. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 5, 877-879 (2008).
  15. Chaumeil, J., Augui, S., Chow, J. C., Heard, E. Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation. Methods Mol Biol. 463, 297-308 (2008).
  16. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, 1564-1566 (2005).
  17. Ogawa, Y., Xite Lee, J. T. X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Cell. 11, 731-743 (2003).
  18. Panning, B. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol. 376, 419-428 (2004).
  19. Khalil, A. M., et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).
  20. Martin, G. R., Evans, M. J. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).
  21. Lee, J. T., Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell. 99, 47-57 (1999).
  22. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, 685-698 (2009).
  23. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472, 365-386 (2010).
  24. Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies. Cell Struct Funct. 33, 61-73 (2008).
  25. Ogawa, Y., Sun, B. K., Lee, J. T. Intersection of the RNA interference and X-inactivation pathways. Science. 320, 1336-1341 (2008).
  26. Kohlmaier, A., et al. A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol. 2, 171 (2004).
  27. Wang, K. C., Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904-914 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics