استخدام كريسبر / Cas9 لضرب جنرال موتورز-CSF في خلايا CAR-T

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا، نقدم بروتوكولا ً للتحرير الوراثي لخلايا CAR-T عبر نظام CRISPR/Cas9.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

مستقبلات مستضد Chimeric T (CAR-T) العلاج الخلوي هو أحدث ويحتمل أن تكون ثورية خيار العلاج الجديد للسرطان. ومع ذلك، هناك قيود كبيرة على استخدامه على نطاق واسع في علاج السرطان. وتشمل هذه القيود تطوير سمية فريدة من نوعها مثل متلازمة إطلاق السيتوكين (CRS) والسمية العصبية (NT) والتوسع المحدود، وظائف التأثير، والنشاط المضاد للورم في الأورام الصلبة. وتتمثل إحدى الاستراتيجيات الرامية إلى تعزيز فعالية CAR-T و/أو السيطرة على سمية خلايا CAR-T في تحرير جينوم خلايا CAR-T نفسها أثناء تصنيع خلايا CAR-T. هنا، ونحن نصف استخدام كريسبر / Cas9 تحرير الجينات في خلايا CAR-T عن طريق transduction مع بنية لينتيفيروسي تحتوي على دليل RNA إلى حبيبات الضامة مستعمرة تحفيز عامل (GM-CSF) وCas9. على سبيل المثال، نحن نصف كريسبر / Cas9 بوساطة بالضربة القاضية من GM-CSF. لقد أظهرنا أن هذه الخلايا GM-CSFك / س CAR-T تنتج بشكل فعال أقل GM-CSF مع الحفاظ على وظيفة الخلية T الحرجة وتؤدي إلى تعزيز النشاط المضاد للورم في الجسم الحي مقارنة مع خلايا CAR-T من النوع البري.

Introduction

مستقبلات مستضد Chimeric T (CAR-T) العلاج الخلوي معارض وعد كبير في علاج السرطان. 1 , 2 اثنين من العلاجات الخلية CAR-T التي تستهدف CD19 (CART19) تمت الموافقة عليها مؤخرا في الولايات المتحدة في أوروبا لاستخدامها في الأورام الخبيثة الخلية B بعد إظهار نتائج ملفتة للنظر في التجارب السريرية متعددة المراكز. 3 , 4 , 5 الحواجز التي تحول دون الاستخدام الأكثر انتشاراً لخلايا CAR-T هي نشاط محدود في الأورام الصلبة والسمية المرتبطة بها بما في ذلك متلازمة إطلاق السيتوكين (CRS) والسمية العصبية (NT). 3 , 5 , 6 , 7 , 8 , 9 لتعزيز المؤشر العلاجي للعلاج بالخلايا CAR-T، يتم استخدام أدوات هندسة الجينوم مثل nucleases إصبع الزنك، TALENs، وCRISPR لمزيد من تعديل خلايا CAR-T في محاولة لتوليد خلايا CAR-T أقل سمية أو أكثر فعالية. 10 سنوات , 11

في هذه المقالة، نقوم بوصف طريقة لتوليد خلايا CAR-T تحرير CRISPR/Cas9. والهدف المحدد من هذه الطريقة هو تعديل وراثيا خلايا CAR-T أثناء تصنيع الخلايا CAR-T عن طريق CRISPR /Cas9 لتوليد خلايا CAR-T أقل سمية أو أكثر فعالية. ويستند الأساس المنطقي لتطوير هذه المنهجية على الدروس المستفادة من التجربة السريرية للعلاج بالخلايا CAR-T، مما يشير إلى الحاجة الملحة لاستراتيجيات جديدة لزيادة النافذة العلاجية للعلاج بالخلايا CAR-T وتوسيع نطاق التطبيق إلى الأورام الأخرى ويدعمها التقدم الأخير في البيولوجيا الاصطناعية مما يسمح تعديلات متعددة من خلايا CAR-T التي بدأت في دخول العيادة. في حين يتم تطوير العديد من أدوات هندسة الجينوم وتطبيقها في بيئات مختلفة، مثل nucleases إصبع الزنك، TALENs، وCRISPR، منهجيتنا تصف تعديل CRISPR /Cas9 من خلايا CAR-T. 10 سنوات , 11 CRISPR/Cas9 هو آلية الدفاع البكتيرية المستندة إلى الحمض النووي الريبي التي تم تصميمها للقضاء على الحمض النووي الأجنبي. يعتمد CRISPR على endonucleases لشق تسلسل مستهدف تم تحديده من خلال دليل RNA (gRNA). يوفر تحرير كريسبر لخلايا CAR-T العديد من المزايا على الأدوات الهندسية الأخرى للجينوم. وتشمل هذه الدقة في تسلسل gRNA، والبساطة لتصميم gRNA استهداف جين الاهتمام، وكفاءة تحرير الجينات العالية، والقدرة على استهداف جينات متعددة حيث يمكن استخدام gRNAs متعددة في نفس الوقت.

على وجه التحديد في الأساليب الموصوفة هنا، استخدمنا عدس ترميز كريسبر دليل RNA وCas9 لتعطيل الجينات أثناء نقل CAR من الخلايا T. في اختيار تقنية مناسبة لتحرير خلايا CAR-T، نقترح التقنية الموصوفة هنا هي آلية فعالة لتوليد خلايا CAR-T الصف البحوث، ولكن لأن تأثير على المدى الطويل من التكامل الدائم من Cas9 في الجينوم غير معروف، ونحن اقتراح هذه المنهجية لتطوير دليل على مفهوم البحوث الصف CAR-T الخلايا ولكن ليس لإنتاج جيد تصنيع الممارسة الصف CAR-T الخلايا.

على وجه الخصوص، هنا نقوم بوصف جيل من الخلايا الحبيبية الضامة مستعمرة تحفيز عامل (GM-CSF) بالضربة القاضية CAR-T الخلايا التي تستهدف CD19 البشرية. تم إنشاء هذه الخلايا CAR-T عن طريق التحويل مع الجسيمات اللينة ترميز الحمض النووي الريبي دليل محدد إلى GM-CSF (اسم الجينات CSF2) وCas9. وجدنا سابقا أن تحييد GM-CSF يخفف CRS وNT في نموذج xenograft. 12 GM-CSFك / س CAR-T الخلايا تسمح لتثبيط GM-CSF خلال عملية التصنيع، والحد بشكل فعال من إنتاج GM-CSF مع تعزيز CAR-T خلية النشاط المضاد للورم والبقاء على قيد الحياة في الجسم الحي مقارنة مع خلايا CAR-T من النوع البري. 12 وهكذا، هنا نحن نقدم منهجية لتوليد كريسبر / Cas9 تحرير خلايا CAR-T.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

يتبع هذا البروتوكول المبادئ التوجيهية لمجلس المراجعة المؤسسية في Mayo Clinic (مايو كلينك) واللجنة المؤسسية للسلامة الأحيائية (IBC).

1. CART19 إنتاج الخلايا

  1. عزل الخلايا T، والتحفيز، وثقافة الجسم الحي السابق
    1. تنفيذ جميع أعمال ثقافة الخلية في غطاء محرك السيارة ثقافة الخلية باستخدام معدات الحماية الشخصية المناسبة. حصاد خلايا الدم المحيطية أحادية النووية (PBMCs) من المخاريط الدم المتبرعة الطبيعية التي تم جمعها أثناء النعوت حيث من المعروف أنها مصدر قابل للحياة من مركبات ثنائي الفينيل متعدد البروم.
    2. لعزل مركبات ثنائي الفينيل متعدد البروم، أضف 15 مل من وسط تدرج الكثافة إلى أنبوب فصل متدرج بكثافة 50 مل. تمييع دم المتبرع بكمية متساوية من المحلول على السالين المُسَوَّر بالفوسفات (PBS) الذي يحتوي على مصل البقر الجنيني (FBS) بنسبة 2% لتجنب احتجاز الخلايا.
      1. إضافة الدم المانح المخفف من المخروط في أنبوب الفصل، والحرص على عدم إزعاج واجهة بين الدم وكثافة التدرج المتوسطة. الطرد المركزي في 1200 × ز لمدة 10 دقائق في RT.
      2. Decant supernatant في مخروطي جديد 50 مل، وغسل مع PBS + 2٪ FBS عن طريق جلب ما يصل إلى 40 مل، الطرد المركزي في 300 × ز لمدة 8 دقائق في RT، يستنشق supernatant، إعادة تعليق في 40 مل من العازلة، وخلايا العد.
    3. عزل الخلايا T من PBMCs عن طريق مجموعة حبة المغناطيسي اختيار سلبي باستخدام فاصل الخلية مؤتمتة بالكامل وفقا لبروتوكول الشركة المصنعة.
    4. لثقافة الخلايا T المعزولة، وإعداد T خلية المتوسطة (TCM) التي تتكون من 10٪ مصل AB الإنسان (v/v)، 1٪ البنسلين-ستريبوميسين-الجلوتامين (V / V)، والمصل خالية من مصل خلية المكونة للدم المتوسطة. تعقيم المتوسط عن طريق تصفية من خلال فلتر فراغ معقمة 0.45 م ومن ثم مع فلتر فراغ معقمة 0.22 م.
    5. في اليوم 0 (يوم تحفيز الخلايا T)، وغسل الخرز CD3/CD28 قبل تحفيز الخلايا T. لغسل، وضع الحجم المطلوب من الخرز (استخدام ما يكفي من الخرز CD3/CD28 لنسبة 3:1 حبات: T الخلايا؛ لاحظ تركيز الخرز يمكن أن يكون متغير) في أنبوب الطرد المركزي الدقيقة 1.5 مل معقمة وإعادة تعليق في 1 مل من TCM.
    6. مكان في اتصال مع المغناطيس.
    7. بعد 1 دقيقة، يستنشق TCM ويعلق في 1 مل من TCM الطازجة لغسل الخرز.
    8. كرر هذا الإجراء لما مجموعه ثلاث عمليات النفاية.
    9. بعد الغسيل الثالث، إعادة تعليق الخرز في 1 مل من TCM.
    10. عد الخلايا T.
    11. نقل الخرز إلى الخلايا T بنسبة 3:1 الخرز: الخلايا.
    12. تمييع الخلايا إلى تركيز نهائي من 1 × 106 خلايا / مل.
    13. حضانة في 37 درجة مئوية، 5٪ CO2 لمدة 24 ساعة.
  2. T خلية التغوط والتحويل
    1. القيام بأعمال اللاتفيروسي باستخدام الاحتياطات BSL-2+، بما في ذلك أغطية زراعة الخلايا، ومعدات الحماية الشخصية، وتطهير المواد المستخدمة مع التبييض قبل التخلص منها.
    2. الحصول على بناء CART19 في ناقلات لينتيفيروسي.
      ملاحظة: تم تصميم بناء CART19 المستخدمة هنا ثم توليفها دي نوفو باستخدام بائع توليف البروتين المتاحة تجاريا. وقد استنسخت بناء CAR في وقت لاحق إلى الجيل الثالث من فيروس لينتي تحت سيطرة المروج EF-1α. يتم اشتقاق جزء المنطقة المتغيرة سلسلة واحدة من استنساخ FMC63 ويعترف CD19 الإنسان. تمتلك شركة CAR19 الجيل الثاني من مجال المحفزات المشتركة 4-1BB والتحفيز CD3י (FMC63-41BBz). 12
    3. أداء إنتاج اللاتينفيروسي كما هو موضح سابقا. 12
      1. باختصار، لإنتاج لينتيفيروس، استخدم الخلايا 293T التي وصلت إلى 70-90٪ من الملاءمة.
      2. السماح بالحضانة لمدة 30 دقيقة في درجة حرارة الغرفة من الكوارف عبر التغوط بما في ذلك 15 ميكروغرام من بلازميد لينتيفيروسي من الفائدة، 18 ميكروغرام من الكمامة / pol / tat / rev ناقلات التعبئة والتغليف، 7 ميكروغرام من ناقلات المغلف VSV-G، 111 ميكرولتر من الكاشف قبل المعقدة، 129 ميكرولتر من كاشف الانف، و 9.0 مل من وسيط الانف قبل إضافة إلى خلايا 293T. ثم ثقافة الخلايا المتحولة في 37 درجة مئوية، 5٪ CO2.
      3. الحصاد، الطرد المركزي (900 × ز لمدة 10 دقائق)، فلتر (0.45 ميكرومتر مرشح النايلون)، والتركيز supernatant في 24 و 48 ساعة عن طريق ultracentrifugation إما 13،028 × ز لمدة 18 ساعة أو 112،700 × ز لمدة 2 ساعة.
      4. تجميد عند -80 درجة مئوية للاستخدام في المستقبل.
    4. في اليوم الأول، إعادة تعليق الخلايا T بلطف لتفريق ورديات الخلايا T التي تم تحفيزها في 1 × 106/مل في اليوم 0.
    5. في إطار الاحتياطات المناسبة BSL-2+ لجميع الأعمال اللينفيروسية، إضافة فيروس حصاد هاد جديد أو مجمد إلى الخلايا T حفز في تعدد العدوى (MOI) من 3.0.
  3. CAR-T توسيع الخلية
    1. خلال مرحلة التوسع، ومواصلة احتضان الخلايا T المستحثة في 37 درجة مئوية، 5٪ CO2. عد خلايا CAR-T في اليومين 3 و 5، وإضافة جديدة، قبل تسخين TCM إلى الثقافة للحفاظ على تركيز خلية CAR-T من 1 × 106/مل.
    2. إزالة الخرز من الخلايا T المستحثة 6 أيام بعد التحفيز (اليوم 6) باستخدام المغناطيس. حصاد، وإعادة تعليق، ووضع الخلايا T في أنابيب مخروطية 50 مل في المغناطيس لمدة 1 دقيقة. ثم جمع supernatant (يحتوي على خلايا CAR-T)، وتجاهل الخرز.
    3. وضع الخلايا CAR-T التي تم جمعها مرة أخرى في الثقافة بتركيز 1 × 106 خلايا / مل لاستئناف التوسع.
    4. في اليوم 6، تقييم التعبير السطحي للسيارة عن طريق قياس التدفق.
      ملاحظة: يمكن استخدام عدة طرق للكشف عن التعبير السطحي للسيارة، مثل تلطيخ مع الماعز المضادة للماوس IgG (H + L) عبر المازيتاالأجسام المضادة الثانوية أو عن طريق تلطيخ مع الببتيد CD19 محددة، مترافقة مع فلوروكروم. هنا، خذ aliquot (حوالي 100،000 خلايا T) من الثقافة وغسل مع العازلة تدفق أعدت مع المالحة دولبيكو الفوسفات المخزنة، 2٪ مصل البقر الجنيني، و 1٪ أزيد الصوديوم. وصمة عار الخلايا مع الأجسام المضادة للجمهورية وغسل مرتين. وصمة عار الخلايا مع وصمة عار الحية / الميتة وCD3 الأجسام المضادة أحادية النسيلة (OKT3). اغسل الخلايا ثم قم بإعادة الإيقاف المؤقت للتدفق. الحصول على مقياس السيتومتر لتحديد كفاءة التحويل.
  4. الحفاظ على الخلايا CAR-T بالتبريد
    1. لحصاد والبرد خلايا CAR-T بعد 8 أيام من التحفيز (اليوم 8 من توسيع الخلية T)، حصاد الخلايا من الثقافة.
    2. تدور إلى أسفل لمدة 5 دقائق في 300 × ز.
    3. إعادة تعليق في تجميد المتوسطة في 10 مليون خلية لكل مل لكل قارورة في تجميد المتوسطة تتكون من 10٪ ثنائي ميثيل سلفوكسيد و 90٪ مصل البقر الجنيني.
    4. تجميد في حاوية التجميد لتحقيق معدل التبريد من -1 درجة مئوية / دقيقة في الفريزر -80 درجة مئوية ومن ثم نقل إلى النيتروجين السائل بعد 48 ساعة.
    5. قبل استخدامها في المختبر أو في التجارب الحية، ذوبان خلايا CAR-T في TCM الدافئة.
    6. غسل الخلايا لتخفيف وإزالة كبريتيد ثنائي الميثيل وإعادة تعليق إلى تركيز 2 × 106 خلايا / مل في TCM الدافئة. الراحة بين عشية وضحاها في37 درجة مئوية، 5٪ CO 2.

2- إنتاج GM-CSF k/o CART19

  1. لتعطيل GM-CSF، استخدم دليل RNA (gRNA) يستهدف exon 3 من الإنسان GM-CSF (CSF2) التي تم اختيارها عن طريق فحص gRNAs التي ذكرت سابقا أن لديها كفاءة عالية لجين CSF2 الذي يرمز للسيتوكين البشري GM-CSF. 14 سنة
    ملاحظة: تم استخدام درجة بحث مركبة تجارياً Cas9 الجيل الثالث من البناء اللين الذي يحتوي على هذا gRNA (تحت مروج U6). يحتوي البناء على جين مقاومة البورومسين. التسلسل من ال [غرنا] [ككتكلتكتككّكّكّ]. 12
  2. لإنتاج فيروس لينتي، استخدم الخلايا 293T التي وصلت إلى 70-90٪ الملاءمة.
  3. السماح بـ 15 ميكروغرام من بلازميد اللانيفي للفائدة، و18 ميكروغرام من ناقل التعبئة والتغليف الهفوة/pol/tat/rev، و7 ميكروغرام من ناقل مغلف VSV-G، و111 ميكرولتر من الكاشف قبل التفكيك، و129 ميكرولتر من كاشف الانتراب، و9.0 مل من وسيلة التغوط للحضانة لمدة 30 دقيقة في الغرفة te mperature.
  4. إضافة الكواشف transfection إلى خلايا 293T. ثم الثقافة في 37 درجةمئوية، 5٪ CO 2.
  5. الحصاد، الطرد المركزي (900 × ز لمدة 10 دقائق)، فلتر (0.45 ميكرومتر مرشح النايلون) والتركيز supernatant في 24 و 48 ساعة عن طريق ultracentrifugation إما 13،028 × ز لمدة 18 ساعة أو 112،700 × ز لمدة 2 ساعة وتجميد في -80 درجة مئوية للاستخدام في المستقبل.
  6. في اليوم الأول، إعادة تعليق الخلايا T بلطف لتفريق الورود.
  7. في مختبر معتمد BSL-2+ ، إضافة فيروس المجمدة أو حصادها حديثا إلى الخلايا T حفز لتوليد خلايا CAR-T. خلايا T Transduce مع كل من CAR19 lentivirus وGM-CSF استهداف فيروس لينتي كريسبر. إضافة CAR19 lentivirus في وزارة الداخلية من 3. وبما أن معايرة فيروس لينتي كريسبر لم يكن ممكناً، استخدم جزيئات الفيروس المتولدة عن إعداد بلازميد 15 ميكروغرام لتبديل 10 x 106 خلايا T.
  8. راجع الخطوات المتبقية من تحفيز الخلايا T، والتوسع، والحفظ بالتبريد كما نوقش في الخطوة 1.
  9. للخلايا T تحريرlentiCRISPR تحمل مقاومة البورومسين، علاج الخلايا مع ثنائي هيدروكلوريد البورومسين بتركيز 1 ميكروغرام من البورومسين لكل 1 مل في اليوم 3 واليوم 5 .

3 - كفاءة تعطيل اللجنة العالمية للبلدان العالمية ولجنة دعم الأوراق المالية والتقييم الوظيفي لـ GM-CSF k/o CART19

  1. كفاءة تعطيل GM-CSF: تتبع الإندلات عن طريق التحلل (TIDE) التسلسل والتحليل
    1. لتسلسل exon من الاهتمام في الجينات GM-CSF، استخدم التمهيديات التالية. استخدام تسلسل التمهيدي إلى الأمام لGM-CSF (CSF2) من TGACTACAGAGAGGCACAGA، وتسلسل التمهيدي العكسي من TCACCTCTGACCTCATTAACC.
    2. استخراج الحمض النووي من ما يصل إلى 5 ملايين خلايا CAR-T مع مجموعة استخراج الجينوم. لتفاعل PCR، استخدم 25 ميكرولتر من إتقان التقوى لكل رد فعل مع تركيز نهائي لكل التمهيدي في تفاعل PCR من μM، 0.1-0.5 ميكروغرام من الحمض النووي القالب، والحجم الإجمالي لرد فعل PCR جلبت ما يصل إلى 50 ميكرولتر مع المياه الخالية من nuclease.
    3. انظر شروط ركوب الدراجات PCR الموضحة في الجدول 1.
    4. تشغيل عينات PCR على هلام أجاروز 1-2٪ في 100 V لمدة 30 دقيقة واستخراج باستخدام مجموعة استخراج هلام.
    5. تسلسل PCR أمبوليكون. حساب تردد تعديل allele عن طريق تحميل البيانات الخام في برنامج TIDE المناسبة. 15
  2. إنتاج صندوق الأمم المتحدة للإدارة الفنية ولجنة التنمية المستدامة والتقييم الوظيفي لـ GM-CSFk/o CART19
    1. لتحديد إنتاج السيتوكين من خلايا CAR-T، واحتضان خلايا CART19 من النوع البري وGM-CSFk/o CART19 مع CD19 التي تعبر عن خط الخلايا اللوكيميا اللمفاوية الحادNAL6 بنسبة 1:5 ل4 ح عند 37 درجة مئوية، 5٪ CO2 في وجود monensin حل، CD49d المضادة للإنسان، CD28 المضادة للإنسان، وCD107a المضادة للإنسان.
    2. حصاد الخلايا من الثقافة لتدفق قياس الخلايا. اغسل الخلايا باستخدام مخزن قياس الخلايا. وصمة عار الخلايا مع مجموعة تلطيخ الحية / الميتة. الحضانة في الظلام في درجة حرارة الغرفة لمدة 15 دقيقة.
    3. بعد الغسيل، وصمة عار الخلايا داخل الخلايا مع نفاذية المتوسطة في تركيبة مع الأجسام المضادة للبشرية IFNγ أحادية النسيلة، ومكافحة الإنسان GM-CSF، ومكافحة الإنسان MIP-1β، ومكافحة الإنسان IL-2، وCD3 المضادة للإنسان واحتضان في الظلام في درجة حرارة الغرفة لمدة 30 الحد الأدنى غسل وإعادة تعليق العينات. الحصول على عينات على مقياس السيتومتر تدفق وتحليلها بالنسبة المئوية للتعبير داخل الخلايا GM-CSF.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ويبين الشكل 1 انخفاض معدل الـ GM-CSF في خلايا GM-CSFk/o CART19. للتحقق من أن الجينوم من الخلايا T تم تغييره إلى ضربة قاضية GM-CSF، تم استخدام تسلسل TIDE في الخلايا GM-CSFk/o CART19 (الشكل1A). CAR-T بقعة الخلية تلطيخ يتحقق من أن الخلايا T تعبر بنجاح عن مستقبلات سطح CAR في المختبر عن طريق التجصاق على خلايا CD3 + الحية (الشكل1B). تلطيخ داخل الخلايا من GM-CSF عن طريق قياس التدفق الخلوي يدل على انخفاض التعبير عن GM-CSF في خلايا GM-CSFk/o CART19 عن طريق التجصيص على خلايا CD3 + الحية، والتحقق من النجاح الوظيفي للخروج المغلوب (الشكل1C). جنرال موتورز-CSFك / س CAR-T الخلايا تظهر انخفاضا في GM-CSF مقارنة مع البرية المضادة CD19 خلايا CAR-T (CART19) عن طريق تلطيخ داخل الخلايا (الشكل1B). وبالإضافة إلى ذلك، لقد أظهرنا سابقا أن الخلايا GM-CSFك / س CAR-T تقلل من إنتاج GM-CSF مع تعزيز النشاط المضاد للورم والبقاء على قيد الحياة بالمقارنة مع خلايا CAR-T من النوع البري في الجسم الحي. 12 

خطوه درجة الحرارة (درجة مئوية) الوقت دورات
التناطور الأولي 94 3 دقائق 1
التناطور 94 45 ثانية 35
الصلب 60 30 ثانية
ملحق 72 2 دقيقة
ما بعد الاستطالة 72 10 دقائق 1
4

الجدول 1: شروط ركوب الدراجات PCR لتسلسل المد والجزر من الخلايا GM-CSFك / س CART19.

Figure 1
الشكل 1 GM-CSFk/o: تُظهر خلايا CART19 انخفاضًا في الـ GM-CSF. أ)يتحقق تسلسل المد التمثيلي من تغيير الجينوم لخلايا GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 بكفاءة تعطيل تبلغ حوالي 71%. ب)قطع تدفق تمثيلي تصور إنتاج خلايا CAR-T ناجحة مع تعبير CAR مماثلة على نوع البرية CART19 وGM-CSFk/o CART19. C)كما قال من قبل تلطيخ داخل الخلايا، GM-CSFك / س CART19 الخلايا تظهر انخفاض GM-CSF مقارنة مع نوع البرية CART19 عندما حفز مع CD19 إيجابية جميع خط الخلية NALM6. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

في هذا التقرير، نقوم بوصف منهجية لاستخدام تكنولوجيا CRISPR/Cas9 للحث على إدخال تعديلات ثانوية في خلايا CAR-T. وعلى وجه التحديد، يتضح ذلك باستخدام الانكلب الفيروسي مع ناقل فيروسي يحتوي على gRNA يستهدف جين الاهتمام وCas9 لتوليد خلايا GM-CSFk/o CART19. كنا قد أظهرت سابقا أن تحييد GM-CSF يخفف CRS وNT في نموذج xenograft. 12 كما هو موضح سابقا، جنرال موتورز-CSFk /o CAR-T الخلايا تسمح لتثبيط GM-CSF أثناء عملية التصنيع، والحد بشكل فعال من إنتاج GM-CSF مع الحفاظ على وظائف الخلايا T الحرجة الأخرى، وتؤدي إلى تعزيز النشاط المضاد للورم في الجسم الحي مقارنة مع خلايا CAR-T من النوع البري. 12

وبما أن التكامل الدائم للCas9 في الجينوم يمكن أن يرتبط بالآثار غير المرغوب فيها عند ترجمتها إلى منتج قابل للتطبيق سريرياً، فإننا نقترح هذه المنهجية المحددة كوسيلة لتوليد درجة البحث CRISPR/Cas9 المعدلة CART19 لإثبات المفهوم التجارب.

في حين أن خلايا CAR-T تحمل الوعد في علاج السرطان,1,2 فعاليتها يمكن أن تستمر في تعزيز والسمية المرتبطة بها أفضل السيطرة عليها. توفر تقنية CRISPR/Cas9 استراتيجية لاستهداف جينوم خلايا CAR-T مباشرة لهندسة الحلول لأوجه القصور السريرية الحالية. في هذه المقالة، نقوم بوصف توليد خلايا GM-CSFk/o CART19.

تم إنشاء خلايا GM-CSFk/o CAR-T عن طريق التحويل مع ناقل فيروسي لبلازميد الخلية CAR-T وبنية فيروس لينتي تحتوي على دليل RNA إلى GM-CSF وCas9. ولتوليد الـ GM-CSFk/o، استُخدم الجيل الثالث من بناء فيروس اللين (lentiCRISPRv2) الذي يحتوي على Cas9 ودليل عالي الكفاءة (gRNA) يستهدف الإصدار 3 من الـ GM-CSF البشرية (CSF2)14 تحت سيطرة مروج U6. وينبغي إيلاء عناية خاصة أثناء خطوات نقل الإجراء لأن هذه هي الأكثر أهمية لتطوير خلايا CAR-T المعدلة. يمكن التحقق من كفاءة خروج المغلوب وتقييمها من خلال تتبع الإندلمنات عن طريق تسلسل التحلل (TIDE). يتم التحقيق في النشاط الوظيفي لخلايا CAR-T من خلال التحفيز المحدد للمستضد لبناء CAR مع الخلايا المستهدفة CD19+، تليها قياس وظائف الخلايا T المختلفة، بما في ذلك إنتاج GM-CSF. 12 من ملاحظة، وتلطيخ للتعبير CAR مع الأجسام المضادة للماوس الماعز يجب أن تحدث قبل الجسم المضاد الأخرى تلطيخ مع اثنين من غسل تحدث قبل تلطيخ السطح بسبب جزء منطقة متغير سلسلة واحدة من CART19 يجري من أصل الماوس. هذا هو نقطة التركيز في اطلاق النار مشكلة إذا لم يلاحظ التعبير CAR جيدة في البداية.

ويمكن استخدام هذه الخلايا CAR-T المعدلة في الدراسات المختبرية وفي نماذج xenograft الجسم الحي لإثبات التجارب مفهوم. ميزة من هذه التقنية هو أن إنتاج الخلايا CAR-T والتلاعب الوراثي يمكن أن يحدث على حد سواء في خطوة واحدة مع كفاءة جيدة بالمقارنة مع تقنيات أخرى. 10 سنوات , 11 في حين أن الانطواء المزدوج للفيروسات اللينة هو وسيلة مريحة وفعالة لتوليد البحوث الصف GM-CSFك / س CART19 الخلايا، يتم دمج الحمض النووي في الجينوم والتعبير Cas9 لفترات طويلة قد زعزعة استقرار الجينوم وزيادة خطر الآثار خارج الهدف. وقيد هذه التقنية هو أن ممارسة التصنيع الجيد الصف بالضربة القاضية تتطلب تعديل هذه التقنية إلى نظام كريسبر/Cas9 الريبونوكليوبروتين لأن هذه المنهجية لا تؤدي إلى إدماج Cas9 بشكل دائم في الجينوم و يقلل من احتمال الآثار خارج الهدف. ويمكن تطبيق المنهجية الموصوفة في البروتوكول هنا على مجموعة متنوعة من الجينات لتعديل خلايا CAR-T وراثياً عن طريق CRISPR/Cas9 للمساعدة في توليد خلايا CAR-T أقل سمية أو أكثر فعالية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK هو مخترع على براءات الاختراع في مجال العلاج CAR T-الخلية التي تم ترخيصها لNovartis (بموجب اتفاق بين Mayo Clinic ، جامعة بنسلفانيا ، ونوفارتي). تم تمويل هذه الدراسات جزئيا من منحة من Humanigen (SSK). RMS، MJC، RS، وSSK هي المخترعين على براءات الاختراع المتعلقة بهذا العمل. يتلقى المختبر (SSK) التمويل من Tolero، Humanigen، طائرة ورقية، Lentigen، Morphosys، والأكتينيوم.

Acknowledgments

تم دعم هذا العمل من خلال منح من K12CA090628 (SSK)، والشبكة الوطنية الشاملة للسرطان (SSK)، ومركز Mayo Clinic للطب الفردي (SSK)، ومؤسسة بريدولين (SSK)، ومكتب مايو كلينيك للترجمة إلى الممارسة (SSK)، و برنامج تدريب العلماء الطبيين في Mayo Clinic (مايو كلينك) روبرت ل. هاويل من المنح الدراسية للأطباء والعلماء (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics