Verwenden von CRISPR/Cas9 zum Knock Out von GM-CSF in CAR-T-Zellen

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier stellen wir ein Protokoll zur genetischen Bearbeitung von CAR-T-Zellen über ein CRISPR/Cas9-System vor.

Cite this Article

Copy Citation | Download Citations

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimäre Antigenrezeptor T (CAR-T) Zelltherapie ist eine innovative und potenziell revolutionäre neue Behandlungsoption für Krebs. Allerdings gibt es erhebliche Einschränkungen für seine weit verbreitete Verwendung bei der Behandlung von Krebs. Zu diesen Einschränkungen gehören die Entwicklung einzigartiger Toxizitäten wie Zytokin-Release-Syndrom (CRS) und Neurotoxizität (NT) und begrenzte Expansion, Effektorfunktionen und Anti-Tumor-Aktivität bei soliden Tumoren. Eine Strategie zur Verbesserung der CAR-T-Wirksamkeit und/oder zur Kontrolle der Toxizität von CAR-T-Zellen besteht darin, das Genom der CAR-T-Zellen während der Herstellung von CAR-T-Zellen selbst zu bearbeiten. Hier beschreiben wir die Verwendung von CRISPR/Cas9 Gen-Editing in CAR-T-Zellen mittels Transduktion mit einem lentiviralen Konstrukt, das eine Führungs-RNA zum Granulozyten-Makrophagen-Kolonie-stimulierenden Faktor (GM-CSF) und Cas9 enthält. Als Beispiel nennen wir CRISPR/Cas9 vermittelten Knockout von GM-CSF. Wir haben gezeigt, dass diese GM-CSFk/o CAR-T-Zellen effektiv weniger GM-CSF produzieren, während sie die kritische T-Zellfunktion beibehalten und zu einer verbesserten Anti-Tumor-Aktivität in vivo im Vergleich zu wilden CAR-T-Zellen führen.

Introduction

Chimäre Antigenrezeptor T (CAR-T) Zelltherapie zeigt großes Versprechen in der Behandlung von Krebs. 1 , 2 Zwei CAR-T-Zelltherapien, die auf CD19 (CART19) abzielen, wurden kürzlich in den Vereinigten Staaten und in Europa für die Anwendung bei B-Zell-Malignitäten zugelassen, nachdem sie auffällige Ergebnisse in multizentrischen klinischen Studien nachgewiesen hatten. 3 , 4 , 5 Hindernisse für eine breitere Nutzung von CAR-T-Zellen sind begrenzte Aktivität bei soliden Tumoren und damit verbundenen Toxizitäten wie Zytokin-Freisetzungssyndrom (CRS) und Neurotoxizität (NT). 3 , 5 , 6 , 7 , 8 , 9 Um den therapeutischen Index der CAR-T-Zelltherapie zu verbessern, werden Genom-Engineering-Tools wie Zinkfingernukleasen, TALENs und CRISPR eingesetzt, um CAR-T-Zellen weiter zu modifizieren, um weniger toxische oder effektivere CAR-T-Zellen zu erzeugen. 10 , 11

In diesem Artikel beschreiben wir eine Methode zum Generieren von CRISPR/Cas9-bearbeiteten CAR-T-Zellen. Das spezifische Ziel dieser Methode ist es, CAR-T-Zellen während der HERSTELLUNG von CAR-T-Zellen über CRISPR/Cas9 genetisch zu modifizieren, um weniger toxische oder effektivere CAR-T-Zellen zu erzeugen. Die Gründe für die Entwicklung dieser Methodik basieren auf den Erkenntnissen aus klinischen Erfahrungen mit der CAR-T-Zelltherapie, die auf die dringende Notwendigkeit neuer Strategien hinweisen, um das therapeutische Fenster der CAR-T-Zelltherapie zu erhöhen und die Anwendung auf andere Tumoren und wird durch die jüngsten Fortschritte in der synthetischen Biologie unterstützt, die mehrere Modifikationen von CAR-T-Zellen ermöglichen, die begonnen haben, in die Klinik zu gelangen. Während mehrere Genom-Engineering-Tools entwickelt und in verschiedenen Umgebungen eingesetzt werden, wie Z.B. Zinkfingernukleasen, TALENs und CRISPR, beschreibt unsere Methodik die CRISPR/Cas9-Modifikation von CAR-T-Zellen. 10 , 11 CRISPR/Cas9 ist ein RNA-basierter bakterieller Abwehrmechanismus, der entwickelt wurde, um fremde DNA zu eliminieren. CRISPR stützt sich auf Endonukleasen, um eine Zielsequenz zu spalten, die durch eine Guide-RNA (gRNA) identifiziert wurde. Die CRISPR-Bearbeitung von CAR-T-Zellen bietet mehrere Vorteile gegenüber anderen Genom-Engineering-Tools. Dazu gehören die Genauigkeit der gRNA-Sequenz, die Einfachheit bei der Entwicklung einer gRNA, die auf das Gen von Interesse abzielt, eine hohe Gen-Editing-Effizienz und die Fähigkeit, mehrere Gene anzusprechen, da mehrere gRNAs gleichzeitig verwendet werden können.

Insbesondere in den hier beschriebenen Methoden verwendeten wir eine Lentivirus-Codierung von CRISPR-Guide-RNA und Cas9, um ein Gen während der CAR-Transduktion von T-Zellen zu stören. Bei der Auswahl einer geeigneten Technik zur Bearbeitung von CAR-T-Zellen schlagen wir vor, dass die hier beschriebene Technik ein effizienter Mechanismus zur Erzeugung von CAR-T-Zellen der Forschungsstufe ist, aber da die langfristige Wirkung einer dauerhaften Integration von Cas9 in das Genom unbekannt ist, schlagen diese Methode vor, um den Nachweis der Konzeptforschung Car-T-Zellen zu entwickeln, aber nicht für die Herstellung guter Herstellungspraxis Grade CAR-T-Zellen.

Insbesondere beschreiben wir hier die Erzeugung von Granulozyten-Makrophagen-Makrophagenkolonie stimulierenden Faktor (GM-CSF) Knockout CAR-T-Zellen, die auf menschliche CD19 abzielen. Diese CAR-T-Zellen wurden durch Transduktion mit lentiviralen Partikeln erzeugt, die eine Fürleitungs-RNA spezifisch für GM-CSF (Genname CSF2) und Cas9 kodieren. Wir haben zuvor festgestellt, dass die GM-CSF-Neutralisation CRS und NT in einem Xenograft-Modell verbessert. 12 GM-CSFk/o CAR-T-Zellen ermöglichen die Hemmung von GM-CSF während des Herstellungsprozesses, wodurch die Produktion von GM-CSF effektiv reduziert wird und gleichzeitig die Antitumoraktivität und das Überleben von CAR-T-Zellen in vivo im Vergleich zu Wildtyp-CAR-T-Zellen verbessert werden. 12 Hier bieten wir daher eine Methodik zur Generierung von CRISPR/Cas9-bearbeiteten CAR-T-Zellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Dieses Protokoll folgt den Richtlinien des Institutional Review Board (IRB) und des Institutional Biosafety Committee (IBC) der Mayo Clinic.

1. CART19 Zellproduktion

  1. T-Zell-Isolierung, Stimulation und Ex-Vivo-Kultur
    1. Führen Sie alle Zellkulturarbeiten in einer Zellkulturhaube mit entsprechender persönlicher Schutzausrüstung durch. Ernte peripherer mononukleischer Blutzellen (PBMCs) aus nicht identifizierten normalen Spenderblutkegeln, die während der Apherese gesammelt wurden, da diese bekanntermaßen eine lebensfähige Quelle von PBMCs sind.13
    2. Um PBMCs zu isolieren, fügen Sie 15 ml eines Dichtegradientenmediums zu einem 50 ml Dichtegradiententrennrohr hinzu. Verdünnen Sie das Spenderblut mit einem gleichen Volumen an phosphatgepufferter Saline (PBS), die 2% fetales Rinderserum (FBS) enthält, um Zellabfangen zu vermeiden.
      1. Fügen Sie das verdünnte Spenderblut aus dem Kegel in das Trennrohr, achten Sie darauf, nicht die Schnittstelle zwischen dem Blut und der Dichte Gradient medium stören. Zentrifuge bei 1.200 x g für 10 min bei RT.
      2. Den Überstand in ein neues 50 ml konisches Dekanat dekantieren, mit PBS + 2% FBS waschen, indem man bis zu 40 ml, Zentrifuge bei 300 x g für 8 min bei RT, Aspirat-Überstand, in 40 ml Puffer wieder aufsetzen und Zellen zählen.
    3. Isolieren Sie T-Zellen von PBMCs über ein magnetisches Perlenset mit negativer Auswahl mit einem vollautomatischen Zellabscheider gemäß dem Herstellerprotokoll.
    4. Um die isolierten T-Zellen zu kultiieren, bereiten Sie T-Zellmedium (TCM) vor, das aus 10% humanem AB-Serum (v/v), 1% Penicillin-Streptomycin-Glutamin (v/v) und serumfreiem hämatopoetischem Zellmedium besteht. Sterilisieren Sie das Medium durch Filterung durch einen 0,45 m sterilen Vakuumfilter und dann mit einem 0,22 m sterilen Vakuumfilter.
    5. Am Tag 0 (dem Tag der T-Zellstimulation) CD3/CD28-Perlen vor der Stimulation von T-Zellen waschen. Zum Waschen das erforderliche Volumen der Perlen (verwenden Sie genügend CD3/CD28 Perlen für ein Verhältnis von 3:1 Perlen: T-Zellen; beachten Sie, dass die Konzentration der Perlen variabel sein kann) in einem sterilen 1,5 ml Mikrozentrifugenrohr und resuspendieren in 1 ml TCM.
    6. Mit einem Magneten in Kontakt setzen.
    7. Nach 1 min, saugen Sie die TCM und resuspend in 1 ml frische TCM, um die Perlen zu waschen.
    8. Wiederholen Sie diesen Vorgang für insgesamt drei Wähbe.
    9. Nach der dritten Wäsche, setzen Sie die Perlen in 1 ml TCM.
    10. Zählen Sie die T-Zellen.
    11. Übertragen Sie Perlen in die T-Zellen im Verhältnis 3:1-Perlen:Zellen.
    12. Verdünnung der Zellen bis zu einer Endkonzentration von 1 x 106 Zellen/ml.
    13. Bei 37 °C inkubieren, 5% CO2 für 24 h.
  2. T-Zell-Transfektion und Transduktion
    1. Durchführung von lentiviralen Arbeiten mit BSL-2+-Vorkehrungen, einschließlich Zellkulturhauben, persönlicher Schutzausrüstung und Desinfektion von gebrauchten Materialien mit Bleichmittel vor der Entsorgung.
    2. Erwerben Sie ein CART19-Konstrukt in einem lentiviralen Vektor.
      HINWEIS: Das cart19-Konstrukt, das hier verwendet wird, wurde entworfen und dann mit einem handelsüblichen Hersteller von Proteinsynthese synthetisiert. Das CAR-Konstrukt wurde anschließend unter der Kontrolle eines EF-1-Promotors in ein Lentivirus der dritten Generation geklont. Das Fragment der einzelnen Kette variabler Bereichswird wird vom FMC63-Klon abgeleitet und erkennt menschliche CD19. Das CAR19-Konstrukt verfügt über eine 4-1BB-Kostendomäne der zweiten Generation und CD3-Stimulation (FMC63-41BBz). 12
    3. Führen Sie die lentivirale Produktion wie zuvor beschrieben durch. 12
      1. Kurz gesagt, um Lentivirus zu produzieren, nutzen 293T Zellen, die 70-90% Konfluenz erreicht haben.
      2. Inkubation für 30 min bei Raumtemperatur von Transfektionsreagenzien, einschließlich 15 g des lentiviralen Plasmids von Interesse, 18 g eines Gag/Pol/Tat/rev-Verpackungsvektors, 7 g eines VSV-G-Hüllkurvenvektors, 111 Transfektionsreagenz und 9,0 ml des Transfektionsmediums vor Zugabe zu den 293T-Zellen. Dann kulturieren Sie die transfizierten Zellenbei 37 °C, 5% CO2 .
      3. Ernte, Zentrifuge (900 x g für 10 min), Filter (0,45 m Nylonfilter) und Konzentrat über Standarbeit bei 24 und 48 h durch Ultrazentrifugation bei 13.028 x g für 18 h oder 112.700 x g für 2 h.
      4. Bei -80 °C für die zukünftige Verwendung einfrieren.
    4. An Tag 1 die T-Zellen vorsichtig wieder aufsetzen, um die Rosetten von T-Zellen aufzubrechen, die an Tag 0 mit 1 x 106/ml stimuliert worden waren.
    5. Unter geeigneten BSL-2+-Vorkehrungen für alle lentiviralen Arbeiten fügen Sie den stimulierten T-Zellen frische oder gefrorene geerntete Viren bei einer Vielzahl von Infektionen (MOI) von 3,0 hinzu.
  3. CAR-T Zellerweiterung
    1. Während der Expansionsphase die transduzierten T-Zellen bei 37 °C, 5%CO2weiter inkubieren. Zählen Sie CAR-T-Zellen an den Tagen 3 und 5 und fügen Sie der Kultur frische, vorgewärmte TCM hinzu, um eine CAR-T-Zellkonzentration von 1 x 106/ml aufrechtzuerhalten.
    2. Entfernen Sie Perlen aus den transduced T-Zellen 6 Tage nach der Stimulation (Tag 6) mit einem Magneten. Ernte, Resuspend und Legen T-Zellen in 50 ml konischen Rohren in einem Magneten für 1 min. Dann sammeln Sie den Überstand (enthält die CAR-T-Zellen), und entsorgen Sie die Perlen.
    3. Stellen Sie die gesammelten CAR-T-Zellen in einer Konzentration von 1 x 106 Zellen/ml wieder in Kultur, um die Expansion wieder aufzunehmen.
    4. Bewerten Sie am 6. Tag die Oberflächenexpression der CAR durch Durchflusszytometrie.
      HINWEIS: Es können mehrere Methoden verwendet werden, um die Oberflächenexpression von CAR zu erkennen, wie z. B. die Färbung mit einem Ziegenanti-Maus-IgG (H+L) kreuzadsorbierten Sekundärantikörper oder durch Färbung mit einem CD19-spezifischen Peptid, konjugiert mit einem Fluorchrom. Hier nehmen Sie ein Aliquot (ca. 100.000 T-Zellen) aus der Kultur und waschen Sie mit Strömungspuffer, der mit Dulbeccos phosphatgepufferter Salzsäure, 2% fetalem Rinderserum und 1% Natriumazid zubereitet wird. Die Zellen mit dem Anti-CAR-Antikörper beflecken und zweimal waschen. Färben Sie die Zellen mit lebendem/totem Fleck und CD3 monoklonalen Antikörpern (OKT3). Waschen Sie die Zellen, und setzen Sie sie im Strömungspuffer wieder auf. Erwerben Sie auf einem Zytometer, um die Transduktionseffizienz zu bestimmen.
  4. CAR-T-Zell-Kryokonservierung
    1. Um CAR-T-Zellen 8 Tage nach der Stimulation (Tag 8 der T-Zellexpansion) zu ernten und zu kryoservieren, ernten Sie die Zellen aus der Kultur.
    2. Spin down für 5 min bei 300 x g.
    3. Resuspend ieren im Gefriermedium bei 10 Millionen Zellen pro ml pro Durchstechflasche im Gefriermedium, bestehend aus 10% Dimethylsulfoxid und 90% fetalem Rinderserum.
    4. In einem Gefrierbehälter einfrieren, um eine Abkühlrate von -1 °C/min in einem Gefrierschrank von -80 °C zu erreichen, und dann nach 48 h in flüssigen Stickstoff geben.
    5. Vor ihrer Verwendung für In-vitro- oder In-vivo-Experimente, tauen CAR-T-Zellen in warmen TCM.
    6. Waschen Sie die Zellen, um das Dimethylsulfoxid zu verdünnen und zu entfernen und auf eine Konzentration von 2 x 106 Zellen/ml in warmem TCM wieder aufzusetzen. Über Nacht bei 37 °C, 5% CO2ruhen.

2. GM-CSF k/o CART19 Produktion

  1. Um GM-CSF zu stören, verwenden Sie eine Guide-RNA (gRNA), die auf Exon 3 des humanen GM-CSF (CSF2) abzielt, das über Screening-gRNAs ausgewählt wurde, die zuvor eine hohe Effizienz für das CSF2-Gen haben sollen, das für das menschliche Cytokin GM-CSF kodiert. 14
    HINWEIS: Es wurde ein kommerziell synthetisiertes Forschungskonstruum Cas9 der dritten Generation verwendet, das diese gRNA (unter einem U6-Promotor) enthält. Das Konstrukt enthält ein Puromycin-Resistenzgen. Die Sequenz der gRNA ist GACCTGCCTACAGACCCGCC. 12
  2. Um Lentivirus zu produzieren, verwenden Sie 293T-Zellen, die 70-90% Konfluenz erreicht haben.
  3. Erlauben Sie 15 g des lentiviralen Plasmids von Interesse, 18 g eines Knebel-/Pol/Tat/rev-Verpackungsvektors, 7 g eines VSV-G-Hüllkurvenvektors, 111 l des vorkomplexenden Reagenzes, 129 l des Transfektionsreagenzes und 9,0 ml des Transfektionsmediums, um 30 min in Raum te Mperatur.
  4. Fügen Sie den 293T-Zellen Transfektionsreagenzien hinzu. Dann Kultur bei 37 °C, 5% CO2.
  5. Ernte, Zentrifuge (900 x g für 10 min), Filter (0,45 m Nylonfilter) und Konzentratüberstand bei 24 und 48 h durch Ultrazentrifugation bei 13.028 x g für 18 h oder 112.700 x g für 2 h und Einfrieren bei -80 °C für den späteren Einsatz.
  6. An Tag 1 die T-Zellen vorsichtig wieder aussetzen, um Rosetten aufzubrechen.
  7. In einem Von BSL-2+ zugelassenen Labor fügen Sie den stimulierten T-Zellen gefroreneoder oder frisch geerntete Viren hinzu, um CAR-T-Zellen zu erzeugen. Transduce T-Zellen mit dem CAR19 Lentivirus und GM-CSF, die auf das CRISPR-Lentivirus abzielen. Car19 lentivirus bei einem MOI von 3 hinzufügen. Da die Titration des CRISPR-Lentivirus nicht möglich war, verwenden Sie Viruspartikel, die aus einem 15-ug-Plasmidpräparat erzeugt wurden, um 10 x 106 T-Zellen zu transducieren.
  8. Sehen Sie sich die verbleibenden Schritte der T-Zellstimulation, -Dehnung und -Kryokonservierung an, wie in Schritt 1 erläutert.
  9. Für lentiCRISPR-bearbeitete T-Zellen mit Puromycinresistenz, behandeln Sie Zellen mit Puromycin-Dihydrochlorid in einer Konzentration von 1 g Puromycin pro 1 ml an Tag 3 und Tag 5 .

3. GM-CSF Störungeffizienz und funktionelle Bewertung von GM-CSF k/o CART19

  1. GM-CSF Disruption Efficiency: Tracking von Indels durch Zersetzung (TIDE) Sequenzierung und Analyse
    1. Um das Interesse am GEN-CSF-Gen zu sequenzieren, verwenden Sie die folgenden Primer. Verwenden Sie eine Vorwärtsprimersequenz für GM-CSF (CSF2) von TGACTACAGAGAGGCACAGA und eine Reverse Primer-Sequenz von TCACCTCTGACCTCATTAACC.
    2. Extrahieren Sie DNA aus bis zu 5 Millionen CAR-T-Zellen mit einem genomischen Extraktionskit. Für die PCR-Reaktion verwenden Sie 25 L eines Taq-Mastermix pro Reaktion mit einer Endkonzentration jedes Primers in der PCR-Reaktion von M, 0,1-0,5 g Vorlagen-DNA und einem Gesamtvolumen der PCR-Reaktion, die bis zu 50 l mit nukleasefreiem Wasser erreicht wird.
    3. Siehe die in Tabelle 1beschriebenen PCR-Zyklusbedingungen .
    4. Führen Sie PCR-Proben auf einem 1-2% Agarose-Gel bei 100 V für 30 min und extrahieren Sie mit einem Gel-Extraktions-Kit.
    5. Sequenz PCR-Amplicons. Berechnen Sie die Häufigkeit der Allelmodifikation, indem Sie Rohdaten in eine entsprechende TIDE-Software hochladen. 15
  2. GM-CSF Produktion und funktionelle Bewertung von GM-CSFk/o CART19
    1. Zur Bestimmung der Zytokinproduktion von CAR-T-Zellen, inkubieren Wildtyp CART19 Zellen und GM-CSFk/o CART19 mit dem CD19 exemitenkt akute lymphatolastische Leukämie-Zelllinie NALM6 im Verhältnis 1:5 für 4 h bei 37 °C, 5%CO2 in Gegenwart von Monensin Anti-Human CD49d, Anti-Human CD28 und Anti-Human CD107a.
    2. Ernten Sie Zellen aus der Kultur für Diedurchflusszytometrie. Waschen Sie die Zellen mit einem Durchflusszytometriepuffer. Färben Sie die Zellen mit einem lebenden/toten Färbeset. Inkubieren Sie im Dunkeln bei Raumtemperatur für 15 min. Fixieren Sie die Zellen mit einem Fixierungsmedium und inkubieren Sie im Dunkeln bei Raumtemperatur für 15 min.
    3. Nach dem Waschen die Zellen intrazellulär mit Permeabilisationsmedium in Kombination mit antihumanem, monoklonalen IFN-Antikörper, antihumanem GM-CSF, antihumanem MIP-1, Anti-Human IL-2 und Anti-Human-CD3 färben und im Dunkeln bei Raumtemperatur für 30 min. Waschen und setzen Sie die Proben wieder aus. Erfassen Sie Proben auf einem Durchflusszytometer und analysiert auf den Prozentsatz der intrazellulären GM-CSF-Expression.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abbildung 1 zeigt die Reduktion von GM-CSF in GM-CSFk/o CART19-Zellen. Um zu überprüfen, ob das Genom der T-Zellen in Knockout GM-CSF verändert wurde, wurde tide Sequenzierung in den GM-CSFk/o CART19-Zellen verwendet (Abbildung 1A). Car-T-Zelloberflächenfärbung bestätigt, dass die T-Zellen den CAR-Oberflächenrezeptor erfolgreich in vitro exprimieren, indem sie auf lebende CD3+-Zellen gezerstäuben (Abbildung 1B). Die intrazelluläre Färbung von GM-CSF durch Durchflusszytometrie zeigt eine verminderte Expression von GM-CSF in GM-CSFk/o CART19-Zellen durch Gating auf lebenden CD3+-Zellen, um den funktionellen Erfolg des Knockouts zu überprüfen (Abbildung 1C). GM-CSFk/o CAR-T-Zellen weisen eine Abnahme der GV-CSF im Vergleich zu Wildtyp-Anti-CD19 CAR-T-Zellen (CART19) durch intrazelluläre Färbung auf (Abbildung 1B). Darüber hinaus haben wir bereits gezeigt, dass GM-CSFk/o CAR-T-Zellen die Produktion von GM-CSF reduzieren und gleichzeitig die Anti-Tumor-Aktivität und das Überleben im Vergleich zu Wildtyp-CAR-T-Zellen in vivo verbessern. 12 

schritt Temperatur (°C) zeit Zyklen
Anfängliche Denaturierung 94 3 Min. 1
Denaturierung 94 45 Sek. 35
Glühen 60 30 Sek.
anbau 72 2 Min.
Nachdehnung 72 10 Min. 1
4

Tabelle 1: PCR-Zyklusbedingungen für die TIDE-Sequenzierung von GM-CSFk/o CART19-Zellen.

Figure 1
Abbildung 1 : GM-CSFk/o CART19-Zellen zeigen eine Reduktion von GM-CSF. A) Eine repräsentative TIDE-Sequenz überprüft die Genomveränderung von GM-CSF CRISPR/Cas9 GM-CSFk/o CART19-Zellen mit einer Störeffizienz von 71 %. B) Repräsentative Strömungsdiagramme zeigen eine erfolgreiche CAR-T-Zellproduktion mit ähnlicher CAR-Expression auf Wildtyp CART19 und GM-CSFk/o CART19. C) Als durch intrazelluläre Färbung untersucht, zeigen GM-CSFk/o CART19 Zellen reduzierte GM-CSF im Vergleich zu Wildtyp CART19, wenn sie mit der CD19-positiven ALL-Zelllinie NALM6 stimuliert werden. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In diesem Bericht beschreiben wir eine Methodik zur Nutzung der CRISPR/Cas9-Technologie, um sekundäre Modifikationen in CAR-T-Zellen zu induzieren. Insbesondere wird dies mit hilfe einer lentiviralen Transduktion mit einem viralen Vektor demonstriert, der gRNA enthält, die auf das Gen von Interesse und Cas9 zur Erzeugung von GM-CSFk/o CART19-Zellen abzielt. Wir hatten zuvor gezeigt, dass die GM-CSF-Neutralisation CRS und NT in einem Xenograft-Modell verbessert. 12 Wie bereits beschrieben, ermöglichen GM-CSFk/o CAR-T-Zellen die Hemmung von GM-CSF während des Herstellungsprozesses, reduzieren die Produktion von GM-CSF effektiv unter Beibehaltung anderer kritischer T-Zellfunktionen und führen zu einer Anti-Tumor-Aktivität in vivo im Vergleich zu Wildtyp-CAR-T-Zellen. 12

Da die dauerhafte Integration von Cas9 in das Genom mit unerwünschten Wirkungen verbunden sein könnte, wenn sie in ein klinisch lebensfähiges Produkt übersetzt wird, schlagen wir diese spezifische Methode vor, um die Forschungsstufe CRISPR/Cas9 modifiziertcart19 für den Proof of Concept zu generieren. Experimente.

Während CAR-T-Zellen versprechen in der Krebstherapie,1,2 ihre Wirksamkeit kann weiterhin verbessert und ihre damit verbundenen Toxizitäten besser kontrolliert werden. Die CRISPR/Cas9-Technologie bietet eine Strategie, um das Genom von CAR-T-Zellen direkt ins Visier zu nehmen, um Lösungen für aktuelle klinische Mängel zu entwickeln. In diesem Artikel beschreiben wir die Erzeugung von GM-CSFk/o CART19 Zellen.

GM-CSFk/o CAR-T-Zellen wurden durch Transduktion mit einem lentiviralen Vektor für das CAR-T-Zellplasmid und einem Lentivirus-Konstrukt erzeugt, das eine Führungs-RNA zu GM-CSF und Cas9 enthält. Zur Erzeugung des GM-CSFk/owurde ein Lentivirus-Konstrukt der dritten Generation (lentiCRISPRv2) mit Cas9 und eine gemeldete Hocheffizienz-Führungs-RNA (gRNA) verwendet, die auf Exon 3 des humanen GM-CSF (CSF2)14 unter der Kontrolle eines U6-Promoters abzielte. Besondere Vorsicht ist bei den Transduktionsschritten des Verfahrens geboten, da diese für die Entwicklung der modifizierten CAR-T-Zellen am wichtigsten sind. Knockout-Effizienz kann durch Tracking von Indels durch Zersetzungssequenzen (TIDE) überprüft und bewertet werden. Die funktionelle Aktivität von CAR-T-Zellen wird durch die antigenspezifische Stimulation des CAR-Konstrukts mit CD19+-Zielzellen untersucht, gefolgt von der Messung verschiedener T-Zellfunktionen, einschließlich der Produktion von GM-CSF. 12 Beachten Sie, dass eine Färbung für car-Expression mit einem Ziegenanti-Maus-Antikörper vor anderen Antikörperfärbungen mit zwei Wärteilen vor der Oberflächenfärbung aufgrund des einkettigen variablen Bereichsfragments des CART19-Ursprungs von Maus auftreten sollte. Dies ist ein Schwerpunkt bei der Fehlersuche, wenn ein guter CAR-Ausdruck zunächst nicht beobachtet wird.

Diese modifizierten CAR-T-Zellen können in In-vitro-Studien und in vivo Xenograft-Modellen zum Nachweis von Konzeptexperimenten eingesetzt werden. Ein Vorteil dieser Technik ist, dass CAR-T Zellproduktion und genetische Manipulation in einem Schritt mit guter Effizienz im Vergleich zu anderen Techniken auftreten können. 10 , 11 Während die doppelte lentivirale Transduktion eine bequeme und effektive Methode zur Erzeugung von GM-CSF-K/o-CART19-Zellen der Forschungsstufe ist, wird die DNA in das Genom integriert und eine verlängerte Cas9-Expression kann das Genom destabilisieren und die Risiko von Off-Target-Effekten. Eine Einschränkung dieser Technik ist, dass good-manufacturing-Praxis Grade Knockouts eine Änderung der Technik in ein Ribonukleoprotein CRISPR/Cas9-System erfordern würde, da diese Methode nicht zu einer dauerhaften Einbeziehung von Cas9 in das Genom und reduziert das Potenzial für Off-Target-Effekte. Die hier im Protokoll beschriebene Methodik kann möglicherweise auf eine Vielzahl von Genen angewendet werden, um CAR-T-Zellen über CRISPR/Cas9 genetisch zu modifizieren, um weniger toxische oder effektivere CAR-T-Zellen zu erzeugen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK ist ein Erfinder auf dem Gebiet der CAR T-Zell-Therapie, die an Novartis lizenziert sind (im Rahmen einer Vereinbarung zwischen Mayo Clinic, University of Pennsylvania und Novartis). Diese Studien wurden zum Teil durch ein Stipendium von Humanigen (SSK) finanziert. RMS, MJC, RS und SSK sind Erfinder von Patenten im Zusammenhang mit dieser Arbeit. Das Labor (SSK) wird von Tolero, Humanigen, Kite, Lentigen, Morphosys und Actinium gefördert.

Acknowledgments

Diese Arbeit wurde durch Stipendien von K12CA090628 (SSK), dem National Comprehensive Cancer Network (SSK), dem Mayo Clinic Center for Individualized Medicine (SSK), der Predolin Foundation (SSK), dem Mayo Clinic Office of Translation to Practice (SSK) und das Mayo Clinic Medical Scientist Training Program Robert L. Howell Physician-Scientist Scholarship (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics