عملية الوحش الأخضر لتوليد سلالات الخميرة حمل حذوفات متعددة الجينات

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

طريقة الوحش الأخضر تمكن الجمعية من الحذف السريع متعددة ملحوظ مع بروتين الجين الترميز مراسل الخضراء الفلورية. ويستند هذا الأسلوب على القيادة سلالات الخميرة من خلال دورات متكررة من تشكيلة الجنسي للالحذف ومضان على أساس تخصيب الخلايا تحمل أكثر الحذف.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

غالبا ما يتم الكشف عن الظواهر لحذف الجينات فقط عندما يتم اختبار الطفرة الوراثية في خلفية معينة أو البيئية 1،2 الشرط. هناك أمثلة حيث العديد من الجينات تحتاج إلى حذف وظائف الجينات لكشف المخفي 3،4. على الرغم من إمكانية الاكتشافات الهامة، لم تستكشف بعد بشكل كبير التفاعلات الوراثية التي تنطوي على ثلاثة أو أكثر من الجينات. والبحث حصرية متعددة متحولة التفاعلات غير عملي نظرا للعدد الهائل من التوليفات الممكنة من الحذف. ومع ذلك، فإن الدراسات من مجموعات مختارة من الجينات، مثل مجموعات من paralogs مع فرصة أكبر مسبق من أشكال تقاسم وظيفة مشتركة، تكون غنية بالمعلومات.

في الخميرة خميرة الخباز، ويتم إنجاز خروج المغلوب من خلال استبدال الجينات الجين مع علامة اختيار إعادة التركيب مثلي عبر. لأن عدد علامات محدودة، وقد وضعت طرق لإزالة وإعادة استخدام سام ه علامة 5،6،7،8،9،10. ومع ذلك، والطفرات الهندسة بالتسلسل متعددة باستخدام هذه الأساليب وقتا طويلا لأن الوقت اللازم جداول خطيا مع عدد من الحذف يمكن إنشاء.

نحن هنا وصف الأسلوب الوحش الأخضر للهندسة بشكل روتيني الحذف متعددة في الخميرة 11. في هذه الطريقة، يتم استخدام البروتين الأخضر نيون (GFP) مراسل دمجها في الحذف لسلالات التسمية من الناحية الكمية وفقا لعدد من الحذف الواردة في كل سلالة (الشكل 1). جولات متكررة من مجموعة متنوعة من GFP وضع علامات الحذف عن طريق التزاوج الخميرة والانقسام الاختزالي إلى جانب تدفق cytometric تخصيب سلالات تحمل أكثر من هذه الحذف يؤدي إلى تراكم الضغوط في الحذف (الشكل 2). أداء عدة عمليات في نفس الوقت، مع كل عملية دمج واحدة أو أكثر الحذف لكل جولة، ويقلل من الوقت اللازم للبناء سلالة.

المحتوى "> الخطوة الأولى هي إعداد فرداني واحد يسمى طفرات 'ProMonsters،' كل منها يحمل مراسل GFP في موضع حذف واحد من" مجموعة أدوات "مواضع، إما GMToolkit-A الوحش الأخضر أو GMToolkit α-في . can1Δ مكان (الشكل 3) باستخدام سلالات من الخميرة جمع حذف 12، يمكن GFP بعلامات الحذف ولدت مريح عن طريق استبدال مشتركة KanMX4 الكاسيت الموجودة في هذه السلالات مع GFP عالمية - جزء يحتوي على كل URA3 GMToolkit: إما أ - أو α-التزاوج من نوع خاص علامة اختيار فرداني 1 و بالضبط واحدة من علامات اللذين عند كل GMToolkits موجودة، تسمح بشكل جماعي لاختيار diploids.

والخطوة الثانية هي لتنفيذ ركوب الدراجات من خلال الجنسي التي يمكن دمجها ضمن مواضع الحذف خلية واحدة من تشكيلة عشوائية و / أو recomb الانتصافيination التي ترافق كل دورة من التزاوج وتبوغ.

Protocol

1. جيل من ProMonsters

  1. إعداد استبدال GFP العالمية الكاسيت عن طريق تضخيم وتيتو 2-GFP علامة وعلامة URA3 من pYOGM012 بلازميد (الأمبيسلين المقاومة) باستخدام الاشعال مع تسلسل:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG وGTACCGGGTAATAACTGATATAAT GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC (المناطق الغامق توفير التماثل إلى المناطق المحيطة من الكاسيت KanMX4 السماح استبدال المستهدفة). وينبغي إجراء رد فعل البلمرة PCR خارجا مع Phusion، HF العازلة، وثنائي ميثيل سلفوكسيد 3٪ (نيو انغلاند Biolabs) بدءا من قالب تركيز الحمض النووي من 0.5 نانوغرام / ميكرولتر. برنامج PCR هو 98 درجة مئوية لمدة 30 ثانية و 35 ° C دورات 98 ل 10 ثانية و 49 درجة مئوية لمدة 30 ثانية، و 72 درجة مئوية لمدة 1.5 دقيقة. يجب أن يكون حجم رد الفعل> 50 ميكرولتر لتوفير ما يكفي من الحمض النووي لكل تجربة التحول. نحن تنقيةقد المنتج باستخدام PCR تنقية QIAquick مجموعة (QIAGEN) مع 50 ميكرولتر من رد فعل ~ PCR معالجتها لكل عمود، ولكن تخطي الخطوة تنقية زيادة الغلة من transformants.
    بدلا من ذلك، الإفراج عن جزء يحتوي على تيتو 2-GFP وURA3 علامات، فضلا عن مثلي المناطق لاستهداف KanMX4، من خلال هضم البلازميد pYOGM057 (الأمبيسلين المقاومة) باستخدام انزيم تقييد EcoRI (نيو انغلاند Biolabs). وينبغي تركيز الحمض النووي في رد الفعل هذا يكون ~ 30 نانوغرام / ميكرولتر. يجب أن يكون حجم رد الفعل> 34 ميكرولتر.
    لإدماج كاسيت GFP إلى منطقة أخرى من KanMX4، وضبط منطقة تماثل للالاشعال PCR أعلاه إلى متواليات مثلي المناسبة.
  2. تحويل سلالة A-فرداني من مجموعة الخميرة خروج المغلوب KanMX4 12 مع حذف كاسيت GFP عالمية. بعد بروتوكول ميكرولتر من قبل بريتون وGietz 0.34 13 منعينة DNA ينبغي (PCR تنقية المنتج أو تقييد غير المنقى هضم) يمكن أن تستخدم لكل تجربة التحول. لوحة الخامس من الخليط التحول واحدة على لوحة CAA-أورا (0.67٪ قاعدة النيتروجين الخميرة والجلوكوز 2٪، 0.6٪ حمض casamino، hemisulfate الأدينين 0.0025٪، 0.005٪ التربتوفان، وأجار 2٪).
  3. خط خارج transformants على طبق من CAA-أورا جديدة للحصول على مستعمرات معزولة.
  4. نقل الخلايا من مستعمرة إلى لوحة تحتوي على 200 ميكروغرام YPDA / مل G418 لتأكيد عدم وجود نمو. لتأكيد نجاح التكامل GFP، اتبع الخطوات التالية (1.5) - (1.9) لأداء PCR مستعمرة.
  5. إضافة خلايا مأخوذة من مستعمرة الى 2 ميكرولتر من العازلة تحلل (0.1 فوسفات الصوديوم M، درجة الحموضة 7.4، 1 وحدة من zymolyase ZymoResearch) في أنبوب PCR 0.2 مل أو بئر لوحة 96-أيضا. مزيج من pipetting الحل والخروج من تلميح ماصة.
  6. تراكب مع قطرة واحدة (حوالي 20 ميكرولتر) من الزيوت المعدنية باستخدام Pipetman P200 (جيلسون).
  7. احتضان عند 37 درجة خليطC لمدة 20 دقيقة، ثم في 95 درجة مئوية لمدة 10 دقيقة.
  8. تمييع المحللة مع 50 ميكرولتر المياه. مزيج من pipetting الحل داخل وخارج عشر مرات.
  9. تحليل 1 ميكرولتر من استخدام المحللة 10-PCR ميكرولتر ردود الفعل مع التمهيدي ل(A) إلى الأمام أن anneals إلى المنطقة المحيطة المنبع يقترن التمهيدي للCCTGAGAAAGCAACCTGACC تسلسل (285 بي بي من بداية كاسيت)، (B) عكس أن anneals التمهيدي للمنطقة المصب يقترن التمهيدي للGCATTGGGTCAACAGTATAG تسلسل (375 BP من نهاية)، (C) اثنان الاشعال أن يصلب لKanMX4 مع تسلسل CGTACTCCTGATGATGCATG وGACGAAATACGCGATCGCTG (181 BP)، و (D) اثنان الاشعال أن يصلب إلى تسلسل من النوع البري من الجين المستهدفة (الشكل 4). (D) مهم جدا لأنه من المعروف عن 8٪ من سلالات في مجموعات الحذف لاحتواء اختلال الصيغة الصبغية 14. وينبغي أن يكون الصحيح transformant تكون إيجابية مع (A) ومع (B)، وسلبية (C) و (D)
  10. لإدخالGMToolkit في transformant، إضافة ما يقرب من 250،000 من سلالة خلايا تحول الخلايا و 250،000 من RY0146 إما (التي تحتوي على GMToolkit-A) أو RY0148 (التي تحتوي على GMToolkit-α) في أنبوب إيبندورف 1.6 مل. دوامة. الطرز الوراثية من RY0146 وRY0148 هي MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-A [CMVpr-rtTA KanMX4 STE2pr-SP-his5] وMATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2]، على التوالي. العلاقات العامة يدل على المروج. وينبغي تقدير عدد الخلايا من الكثافة الضوئية للثقافة السابقة.
  11. أجهزة الطرد المركزي في 800 x ج لمدة 2 دقيقة.
  12. إزالة طاف.
  13. للسماح لتبادل الهواء، وجعل ثقب في الغطاء باستخدام الدبوس تعامل مع الايثانول 70٪.
  14. إضافة 50 ميكرولتر من YPDA المتوسطة (1٪ خلاصة الخميرة، ببتون 2٪، الجلوكوز 2٪، وhemisulfat الأدينين 0.003٪ه). دوامة.
  15. أجهزة الطرد المركزي في 800 x ج لمدة 5 دقائق.
  16. وضع أنبوب في مربع رطبة. يمكن إنشاء هذا مع تلميح مربع فارغ، موقفا تلميح صغيرة، ومنشفة ورقية رطبة.
  17. احتضان بين عشية وضحاها مربع في 30 ° C.
  18. حدد diploids تزاوج معها أولا streaking على خلايا الجهاز المركزي للمحاسبات على طبق من ذهب، أورا. احتضان لوحة في C ° 30 ليوم واحد.
  19. أخذ الخلايا من خط السائبة، ومنطقة بها لجعل المستعمرات المعزولة على لوحات YPDA (1٪ خلاصة الخميرة، ببتون 2٪، الجلوكوز 2٪، 0.003٪ hemisulfate الأدينين، وأجار 2٪) تحتوي على 200 ميكروغرام / مل G418 لاختيار diploids تحتوي على واحد أو GMToolkit 100 ميكروغرام / مل nourseothricin (NAT) 15 لاختيار diploids تحتوي على GMToolkit-α.
  20. احتضان لوحة في C ° 30 لمدة 3 أيام.
  21. بدءا من مستعمرة معزولة، ونقل معظم الخلايا إلى 500 ميكرولتر من دون المتوسطة GNA أجار (1 خلاصة الخميرة٪، 3٪ Difco المرق المغذي، والجلوكوز 5٪؛ الجلوكوز الأوتوكلاف وبقية رانه المكونات بشكل منفصل كما خففت حلول × 2 لتجنب انتاج الكراميل) في أنبوب مل ثقافة 5-مع الغطاء.
  22. تدوير أنبوب أفقيا لمدة خمس ساعات في 30 ° C. محور دوران يجب أن يكون موازيا لمحور الطولي للأنبوب.
  23. تأكد من أن تستخدم في المستعمرات (1.21) + هي أورا بواسطة streaking بها على لوحة CAA-أورا.
  24. أجهزة الطرد المركزي في أنبوب في 800 x ج لمدة 2 دقيقة. تجاهل طاف.
  25. إضافة 500 ميكرولتر من تبوغ الحد الأدنى المتوسطة (1٪ خلات البوتاسيوم، الزنك خلات 0.005٪؛ فلتر تعقيم). دوامة.
  26. أجهزة الطرد المركزي في أنبوب في 800 x ج لمدة 2 دقيقة. تجاهل طاف.
  27. كرر (1.25) - (1.26) مرتين.
  28. إضافة 1 مل من المتوسط ​​تبوغ الحد الأدنى تستكمل مع 7.5 ميكروغرام / مل يسين، ميكروغرام 7.5 / مل يسين، 5 ميكروغرام / مل الحامض الاميني، 5 ميكروغرام / مل ميثيونين، و 1.25 ميكروغرام / مل اليوراسيل (لتعزيز قيم تبوغ من سلالات العوز الغذائي) . دوامة.
  29. تدوير أنبوب في درجة حرارة الغرفة ليوم واحد.
  30. تدوير أنبوب في C ° 30 ل 2 أيام.
  31. أجهزة الطرد المركزي 125 ميكرولتر من هذا الخليط في أنبوب إيبندورف 1.6 مل في 800 x ج لمدة 2 دقيقة. تجاهل طاف.
  32. إضافة 50 ميكرولتر من حل zymolyase (100 ملي فوسفات الصوديوم العازلة، ودرجة الحموضة 7.4، 1 M السوربيتول، و2 وحدة من zymolyase ZymoResearch). مزيج من pipetting الحل والخروج من تلميح ماصة.
  33. احتضان في C ° 30 لمدة 1 ساعة.
  34. إضافة 50 ميكرولتر من 0.02٪ NP-40. مزيج من pipetting الحل والخروج من تلميح ماصة.
  35. ترك الأنبوب في درجة حرارة الغرفة لمدة خمس دقائق.
  36. إضافة 500 ميكرولتر من الماء.
  37. وضع أنبوب على الجليد.
  38. يصوتن هذا الخليط مرتين في إعداد خرج من 1 (أضعف الإعداد) لمدة 15 ثانية باستخدام 3.2 مم microtip مع 450 Sonifier (برانسون). بين جولتي صوتنة، وضع أنبوب على الجليد للعودة درجة الحرارة إلى C. ~ ° 0
  39. أجهزة الطرد المركزي أنابيب في 800 x ج لمدة 5 دقائق. تجاهل طاف.
  40. أضف 200 ميكرولتر من صاحب-SC-أورا(أ) أو SC-أورا-ليو (α) المتوسطة، وهذا يتوقف على ما إذا كان الصليب هو لدمج GMToolkit-A أو GMToolkit α. لإعداد وسائل الإعلام، وجعل SC-أورا-ليو صاحب-المتوسطة (0.67٪ قاعدة النيتروجين الخميرة والجلوكوز 2٪، 0.01٪ أرجينين، حمض الأسبارتيك 0.01٪، 0.01٪ حمض الجلوتاميك، آيسولوسين 0.01٪، 0.01٪ ليسين، 0.01٪ ميثيونين ، 0.01٪ فينيل ألانين، سيرين 0.08٪، 0.04٪ ثريونين، التيروزين 0.002٪، 0.03٪ حمض أميني أساسي، الأدينين 0.0025٪، 0.005٪ التربتوفان، الأدينين 0.003٪، 0.005٪ والتربتوفان) وتكملة مع الحامض الاميني ليسين أو معقمة قبل استخدامها لل النهائي تركيز 0.01٪.
  41. جعل ثقب في الغطاء باستخدام الدبوس تعامل مع الايثانول 70٪.
  42. تدوير أنبوب أفقيا في C ° 30 ل 2 أيام. محور دوران يجب أن يكون موازيا لمحور الطولي للأنبوب.
  43. يجب إضافة حمض الأسبارتيك وثريونين بعد؛ متتالية من الخلايا على طبق أجار-SC-أورا أو صاحب SC-أورا ليو-(نفس المكونات على النحو الوارد أعلاه بالإضافة إلى أجار 2٪utoclaving؛ إضافة الحامض الاميني ليسين أو قبل صب) لجعل المستعمرات المعزولة للسلالات ProMonster.

2. ركوب الدراجات الجنسي

  1. تدوير ثقافة عبئا GFP حذف أنشئت في 100 ميكرولتر من صاحب SC-(أ) أو SC-ليو (α) اعتمادا على نوع التزاوج في 30 ° C باستخدام أنبوب إيبندورف بين عشية وضحاها 1.6 مل. لتبادل الهواء، وجعل حفرة باستخدام الدبوس تعامل مع الايثانول 70٪. تدوير أنبوب أفقيا. محور دوران يجب أن يكون موازيا لمحور الطولي للأنبوب. فمن الممكن لعبور سلالات متعددة عبر التزاوج بأعداد كبيرة. عند استخدام عينة تم الفرز مباشرة لهذا الغرض، والثقافة الخلايا في 200 ميكرولتر في C ° 30 ل 2 أيام. لإعداد المتوسطة، إضافة اليوراسيل (تركيز النهائي: 0.0025٪) والحامض الاميني (0.01٪) أو ليسين (0.01٪) لSC-أورا-ليو صاحب-المتوسطة.
  2. مزيج 250،000 A-فرداني الخلايا α و 250،000-فرداني خلايا سلالات حذف GFP في EPPE 1.6 ملndorf الأنبوب. دوامة.
  3. تتزاوج هذه الخلايا عن طريق الخطوات التالية (1.11) - (1.17).
  4. نقل 10 ميكرولتر من خليط التزاوج إلى 500 ميكرولتر المتوسطة GNA تحتوي على 200 ميكروغرام / مل وG418 ميكروغرام 100 / مل نات في أنبوب مل ثقافة 5-مع غطاء خففت. وتبدأ OD 600 هو 0.1 تقريبا.
  5. تدوير الثقافة في C ° 30 لمدة 24 ساعة. وهذا يسمح لاختيار diploids لأن diploids فقط تحتوي على كل KanMX4 في GMToolkit واحد وNatMX4 في GMToolkit-α يمكن أن تنمو في وجود G418 ونات (الشكل 3).
  6. نقل 20 ميكرولتر من الثقافة ليوم واحد إلى 500 ميكرولتر من GNA الطازجة التي تحتوي على G418 ونات. وتبدأ OD 600 هو تقريبا 0.2.
  7. تدوير أنبوب في C ° 30 ساعة لمدة 5 لجلب الخلايا إلى مرحلة دخول (OD 600 من ~ 1).
  8. اتبع الخطوات (1.24) - (1.38) إلى بذرت في diploids وعزل الجراثيم.
  9. تقسيم الخلايا تعليق sporulated إلى قسمين ميكرولتر-300أجزاء ووضع كل في أنبوب إيبندورف منفصلة 1.5 مل.
  10. أجهزة الطرد المركزي أنابيب في 800 x ج لمدة 5 دقائق. تجاهل طاف.
  11. لبيليه من أنبوب واحد، إضافة 100 ميكرولتر من SC-المتوسطة لتحديد صاحب النباتات الاحاديه. لبيليه من الأنبوب أخرى، إضافة 100 ميكرولتر من SC-ليو المتوسطة لتحديد α-النباتات الاحاديه.
  12. تدوير أنابيب في 30 درجة مئوية خلال الليل. ينبغي أن تكون 600 OD النهائي أقل من 0.5. إذا OD 600 تميل إلى أن تكون عالية جدا، حاول زراعة في درجة حرارة الغرفة.
  13. للحث على GFP، إضافة 100 ميكرولتر من جديد SC-صاحب (أ) أو SC-ليو (α) المتوسط ​​تحتوي على 20 ميكروغرام / مل الدوكسيسيكلين. تركيز النهائي من الدوكسيسيكلين هو 10 ميكروغرام / مل. دوامة.
  14. تدوير أنابيب في C ° 30 ل 2 أيام.

3. تدفق الخلوي

  1. تبادلت إضافة 900 ميكرولتر من العازلة TE قبل تصفيتها (الرقم الهيدروجيني 7.5) تحتوي على 10 ميكروغرام / مل الدوكسيسيكلين لأنبوب البولي بروبلين 5-مل (BD الصقر # 352063) مع غطاء مع الخلايامصفاة غطاء من أنبوب البوليسترين 5-مل (BD الصقر # 352235). أنابيب البولي بروبلين هي مناسبة لقياس التدفق الخلوي. هو المطلوب الغطاء مصفاة لإزالة الجزيئات الكبيرة.
  2. وضع بلطف 75 ميكرولتر من العازلة TE مع الدوكسيسيكلين على الغطاء الخلية مصفاة.
  3. إضافة 25 ميكرولتر من الخلايا المستحثة في حل على الغطاء.
  4. أثناء الضغط على طرف Pipetman ضد شبكة، واطلاق النار على كل من الحل المشترك من خلال مصفاة.
  5. اضغط لأسفل الغطاء مصفاة ودوامة الأنبوب.
  6. إعداد أنابيب جمع (1.6 مل أنابيب إيبندورف) شغلها مع 200 ميكرولتر من SC-SC أو صاحب ليو.
  7. بدء فارز الخلية وضبط إعدادات وفقا لدليل الشركة المصنعة.
  8. دوامة أنبوب جمع كلا من (لطلاء الجدار مع متوسطة) والتي تحتوي على الخلايا أنبوب قبل تحميلها على فارز الخلية.
  9. الحصول على بيانات التدفق الخلوي من العينة. ويمكن لسلالة لا تحتوي على عنصر تحكم GFP تكون سلبية.
  10. رسم بوابات للفرز. (A)لتجنب المجاميع الخلية، والتي يمكن أن تظهر ارتفاع كثافة GFP، ونبذ القيم المتطرفة مع عرض النبض كبيرة بشكل غير متناسب لمبعثر إلى الأمام (FSC) باستخدام قطعة عرض النبض وارتفاع النبض لفارز MoFlo أو ارتفاع FSC الصغيرة بصورة غير متناسبة باستخدام قطعة ارتفاع FSC وFSC منطقة لفارز FACSAria (الشكل 5، العلوية اليسرى لوحة). (B) حيث من المتوقع FSC كبيرة (منطقة) بالنسبة للمجاميع الخلية، تأخذ فقط الخلايا في 20 في٪ أقل FSC، مع تجنب المناطق التي شهدت أدنى مبعثر FSC والجانب (SSC) حيث القيم كثيرا ما وجدت الحطام الخلية (الشكل 5، العلوية اليمنى لوحة). (C) SSC (منطقة) وإشارة GFP (منطقة) وغالبا ما تكون ارتباطا إيجابيا. لأن مجرد اتخاذ ألمع الخلايا نظرا لبوابات أعلاه من شأنه أن يثري أيضا لخلايا بقيمة عالية SSC، رسم بوابة على طول محيط السكان الذين يستخدمون قطعة كثافة GFP وSSC لاتخاذ نفس النسبة تقريبا من ألمع الخلايا من كل نقطة المحور SSC (الشكل 5، بوتام يسار الرسم البياني). يجب أن السكان في اختيار (C) يكون 0،1-1٪ من السكان في اختيار (B).
  11. فرز 200 خلية في أنبوب جمع بالنظر إلى المعايير الواردة في (3.10). لعملية بأعداد كبيرة أو لمشاريع أخرى تتطلب السكان أكثر تعقيدا، فرز أكثر من الخلايا حسب الحاجة.
  12. دوامة أنبوب جمع لتغطية الخلايا مصنفة مع المتوسط.
  13. لوحة مجموعة فرعية من الخلايا (على سبيل المثال، 50 خلية) على طبق من ذهب لYPDA التنميط الجيني.
  14. احتضان لوحة في C ° 30 ل 2 أيام.
  15. جعل المحللة للمستعمرات 12 ~ اتباع الخطوات (1.5) - (1.8).
  16. نقل الخلايا المتبقية على الطرف المستخدمة في (1.5) إلى بقعة على لوحة تحتوي على YPDA G418 ونات عن طريق لمس برفق لوحة مع طرف. يجب أن لا تنمو النباتات الاحاديه المحددة في هذه اللوحة. قد Diploids على نسخ أكثر GFP، ولذلك يجوز إشراقا. هذا الاختبار يمكن أن تظهر كفاءة اختيار فرداني.
  17. لالتنميط الجيني وتحليل 1 ميكرولتر من المحللة باستخدام PCR ميكرولتر 10-Reaction مع التمهيدي إلى الأمام أن anneals إلى المنطقة المحيطة المنبع من كل جين حذف يقترن التمهيدي للCCTGAGAAAGCAACCTGACC التسلسل.
    ردود فعل متعددة PCR إذا كان ذلك ممكنا (يمكن تحديد الظروف باستخدام لست] واحدة من المسوخ). ويمكن أن يتم PCR في 96 - أو 384 حسنة الشكل. شكل هذا الأخير هو مناسبة لحجم رد فعل اقل من 5 ميكرولتر. Arraying ماجستير PCR يمزج مختلفة في الاشعال وبالإضافة إلى ذلك يمكن أن يتم من الخلية لست] إلى هذه الخلائط من استخدام ماصة متعدد القنوات أو حتى إنسان التعامل مع السائل. التغييرات تلميح اختيارية عند إضافة المحللة نفسها ليمزج PCR مختلفة.
  18. تحليل المنتجات PCR. النظام جل الترا XL V-2 الكهربائي (Labnet) متوافق مع تحميل العينة باستخدام ماصات متعدد القنوات.
  19. بناء على معلومات من (3.16) و(3.18)، وتحديد النباتات الاحاديه المرجح أن المطلوب الأنماط الجينية.
  20. إنشاء هذه السلالات على لوحة جديدة (YPDA، CAA-أورا، أو SC-Ura-His/Leu). أيضا، في تجميدها25٪ الجلسرين في -80 ° C. وأوصت بإجراء اختبارات إضافية مثل التأكيد على عدم وجود من النوع البري تسلسل الجينات لحذف ونابض الميدان الكهربائي للهلام.
  21. تكرار الدراجات الجنسي من (2.1) مع سلالات مفيدة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

عندما يتقاطع سلالة A-فرداني تقل أربعة الحذف GFP بعلامات (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) مع سلالة α-فرداني تقل أربعة الحذف (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ)، مع اثنين من الحذف (ycl033cΔ yer042wΔ) المشتركة من قبل اثنين من سلالات، وممثل تم الحصول على نتيجة. كان مثقف الخليط التزاوج في المتوسط ​​تحتوي على YPDA G418 ونات لتحديد diploids. تم تربيتها في diploids المتوسطة مما أدى إلى تبوغ. وفرقت الجراثيم عن طريق العلاج zymolyase وصوتنة، ونبتت في وسائل الإعلام اختيار فرداني. وقد حثت ثم الخلايا للتعبير عن GFP. باستخدام بوابات تدفق عداد الكريات مع، تم اختيار مجموعة من السكان من الخلايا التي من غير المرجح أن تحتوي على الحطام أو خلية المجاميع (الشكل 5). ضمن هذه الفئة من السكان، تم فرز ألمع 1٪ من الخلايا. كانت الخلايا فرزها والتي لم يتم فرزها الخلايا جينوكتبته بعد أن شكلت المستعمرات على طبق من ذهب. عندما تم اختيارها عشوائيا المستعمرات يشوبه من على لوحة تحتوي على YPDA G418 ونات، وخلايا من 2 من أصل 16 المستعمرات نمت لعينة لم يتم فرزها، والخلايا في الفترة من 18 من أصل 26 المستعمرات نمت لعينة فرزها، مما يشير إلى أن بعض diploids اكتسبت القدرة للتعبير عن علامة الاختيار فرداني ونشر خلال مراحل الاختيار فرداني والحث GFP في هذه التجربة. تم إثراء Diploids في العينة مصنفة بسبب يفترض إلى عدد أكبر من النسخ التي GFP الواردة. وكان متوسط ​​عدد الحذف في الخلايا مصنفة عندما تم تحليل PCR مع النباتات الاحاديه، 5.1 ± 0.4 (ن = 8؛ SEM معروضة). كان أربعة من هذه الخلايا ستة الحذف، والحد الأقصى عدد ممكن من الحذف لهذا الصليب. كان النباتات الاحاديه من العينة التي لم يتم فرزها 3.4 ± 0.2 الحذف في المتوسط ​​(ن = 14).

في تجربة منفصلة، ​​وهي سلالة A-فرداني تقل سبعة GFP بعلامات الحذف (انتمr042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) وعبرت مع سلالة α-فرداني تحمل ثمانية الحذف (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ)، مع أربعة الحذف المشتركة (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) الواردة في سلالتين. sporulated ما يقرب من 20٪ من الخلايا عندما تم تحديد diploids ومثقف في وقت لاحق في المتوسط ​​تبوغ، استنادا إلى الملاحظة المجهرية (ن> 100). بعد أن فرقت جراثيم ونبتت، وقد حثت والنباتات الاحاديه مما أدى إلى GFP صريحة وفرزها على أساس مضان على النحو الوارد أعلاه. نمت واحد فقط من 61 خلايا اختيارها عشوائيا على لوحة تحتوي على YPDA G418 ونات، مما يشير إلى أن الخلايا فرداني في الغالب فرزها. كان الخلايا مصنفة عند تحليل PCR مع (الشكل 6)، وعدد الحذف متوسط ​​قدره 8.8 ±0.3 (ن = 12؛ SEM معروضة)، بما في ذلك خمس خلايا تحتوي على عشرة الحذف. وكان عدد من الحذف المتوقع للخلية التي لم يتم فرزها الناجمة عن الفصل العشوائي 7.5.

الشكل 1
الشكل 1. الوحوش الخضراء تحت المجهر. micrographs الإسفار تظهر سلالة غير متحولة (يسار)، سلالة ProMonster (وسط)، وسلالة الوحش 16-GFP (يمين). واستخدمت التعرض متطابقة، والسطوع، وإعدادات التباين للصور.

الشكل 2
الشكل 2. وتزاوج مخطط عملية الوحش الأخضر. أحادية الطور النباتات الاحاديه (الضوء الأخضر). إعادة التركيب الانتصافي خلال تبوغ من diploids تزاوج يولد مزيجا من الخلايا GFP 0-(من البيض)، 1-GFP الخلايا (الضوء الأخضر)، و2-GFP الخلايا (الخضراء الداكنة). تدفقيتم استخدام الخلوي لتحديد الخلايا خضرة المخصب للخلايا 2-GFP. الأدوات الجزيئية متكاملة تمكين اختيار النباتات الاحاديه-(صاحب +)، α-النباتات الاحاديه (ليو +)، وdiploids (G418-NAT-والمقاومة). وتتكرر هذه الدورة لإثراء للسلالات تحمل عددا متزايدا من التعديلات.

الشكل 3
الشكل 3. أشرطة حذف GFP وGMToolkits. أشرطة حذف GFP تحتوي على الجينات مراسل GFP وعلامة تحول الخميرة (URA3). ال 2 تيتو المروج هو محرض بإضافة الدوكسيسيكلين على المدى المتوسط ​​من خلال عمل عامل النسخ rtTA. إذا كان مستوى GFP تصل القدرة القصوى لخلايا لجعل البروتين أو على تحمل أي تأثير سام منها، ويمكن طلبه التعبير أسفل عن طريق خفض تركيز الدوكسيسيكلين (لاحظ مع ذلك أن فعلنا لا تشبع مراقبة أو آثار سمية حتى مع 16 نسخ من GFP). يمكن أن تستهدف هذه الجينات إلى أي كاسيت أو منطقة معينة عن طريق ربط تسلسل مثلي باستخدام PCR. وبدلا من ذلك، يمكن حذف GFP العالمية راديو كاسيت مع تسلسل مثلي متطابقة استهدفت مريح إلى 'منصات هبوط' KanMX4 في سلالات من الخميرة جمع خروج المغلوب. YFG يدل على الجينات المفضلة لديك. مربع مع خطوط عمودية يدل الباركود DNA. تتكامل GMToolkits في موضع CAN1. وأعرب علامة STE2-his5 وعلامة STE3-LEU2 في التزاوج بطريقة نوع معين في النباتات الاحاديه للسماح فقط لتنمو النباتات الاحاديه في غياب الحامض الاميني والنباتات الاحاديه فقط α-تنمو في غياب يسين، على التوالي. اختيار لمقاومة G418 ونات يختار في وقت واحد لمكان KanMX4 في واحدة GMToolkit وموضع NatMX4 في الآخر وبالتالي يختار لdiploids.

_content "FO: المحافظة على together.within صفحة =" دائما "> الشكل 4
الشكل 4. يؤكد التكامل الصحيح للكاسيت GFP. يمكن استخدام راديو كاسيت GFP عالمية لتحويل أي حذف KanMX4 بعلامات المتاحة في الخميرة جمع الحذف لحذف GFP بعلامات. مع أليل GFP الحذف ولدت بشكل صحيح رد فعل PCR، مع أن anneals التمهيدي إلى الأمام إلى المنطقة المحيطة المنبع يقترن التمهيدي عكس ذلك anneals إلى بداية الكاسيت (PCR A من الخطوة 1.9) ينبغي أن الفرقة. PCR مع التمهيدي عكس ذلك anneals للمنطقة المصب المرافقة يقترن التمهيدي إلى الأمام أن anneals إلى نهاية الكاسيت (PCR B) ينبغي جعل المنتج. يجب PCR مع اثنين من الاشعال أن يصلب داخل الكاسيت KanMX4 (PCR C) أو مع اثنين من الاشعال أن يصلب لتسلسل من النوع البري من الجين المستهدفة (PCR D) لا تنتج الفرقة. السهم الأحمر يدل على التمهيدي PCR. براككيت معارض منطقة تضخيم PCR مع رد فعل. مربع يدل على كاسيت GFP (الخضراء)، وراديو كاسيت KanMX4 (الأصفر)، أو الجينات المفضلة (YFG، والرمادي). خط أسود يشير إلى وجود تسلسل المرافقة في كروموسوم الخميرة.

الشكل 5
الشكل 5. التدفق الخلوي. في هذا النسل، تجربة فرداني من كرة عرضية من سلالتين، واحدة مع النمط الجيني ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ والآخر مع النمط الوراثي ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ وقد حثت في التعبير عن GFP. كان كل الجينات حذف شريط GFP. من قبل خلايا النابضة على أساس المنطقة مبعثر إلى الأمام وإلى الأمام ارتفاع مبعثر (P1) والركام الخلية (التي تميل إلى أن تكون غير متناسبة تم استبعاد مساحة واسعة مبعثر إلى الأمام. بواسطة الخلايا النابضة على أساس مبعثر إلى الأمام والجانب مبعثر (P2)، متم قبول LLS في 20 في٪ أقل مبعثر إلى الأمام مع استبعاد الحطام المبعثر مع أقل الأمام والجانب مبعثر. من قبل خلايا النابضة على أساس مبعثر الجانب وGFP إشارة (P3)، اتخذت الخلايا أكثر الفلورسنت بين تلك الموجودة في مجموعة الجانب مبعثر معين. للسماح مقارنة بين مزيج الانتصافي والعينة الضابطة السلبية التي لا تعبر عن GFP، بوابة مماثلة لتلك المستخدمة لاختيار السكان P3 هو مبين في الرسم البياني للخلايا محددة وبالمثل من المراقبة السلبية.

الشكل 6
الشكل 6. التنميط الجيني في السلالات التي تم فرزها. PCR تم تنفيذ باستخدام التمهيدي عكس ذلك anneals للمنطقة المصب المرافقة يقترن التمهيدي إلى الأمام أن anneals إلى نهاية الكاسيت. وجود الفرقة يدل على وجود الكاسيت GFP. وأظهرت التجربة منفصلة أن جميع سلالات يخدع 12تين حذف Δ yer042w وحذف Δ ykr011c.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

كما قمنا بتطوير النهج الوحش الأخضر، ونشعر بالقلق مع إمكانية إعادة التركيب بين مختلف الأشرطة استبدال GFP، مما يؤدي إلى إعادة ترتيب الجينوم. تخفيف من هذا الاحتمال هو اختيارنا للخلايا التي خضعت بنجاح جولات متعددة من التزاوج والانقسام الاختزالي. ومن المتوقع أن الخلايا التي تحمل العوامل الوراثية ترتيبها لتكون أقل ملاءمة بعد التزاوج إلى الخلايا دون إعادة ترتيب متطابقة. في الواقع، لم نكن نلاحظ أي عدم الاستقرار الناتجة عن إعادة التركيب الجينوم بين أشرطة GFP 11. ومع ذلك، لا يمكننا استبعاد هذا الاحتمال تماما، لذلك فمن المستحسن أن المستخدمين اختبار سلالات ولدت لإعادة ترتيب. ويمكن استخدام نابض الميدان الكهربائي للهلام الإجمالي للكشف عن شذوذ. ويمكن استخدام PCR مع الاشعال الصلب لتسلسل داخل حذف لتأكيد عدم وجود تسلسل من النوع البري.

استنادا إلى مستويات مضان من سلالات المعمول بها، GFكان P شدة علاقة خطية شبه مع عدد من الحذف، مما يوحي بأن التشبع ليست مشكلة ضمن نطاق اختبار واحد إلى 16 الحذف 11. ومع ذلك، حتى في وقت لاحق مع جولات مع العديد من سلالات الحذف غير متداخلة، تمكنا من زيادة عدد فقط من متوسط ​​الحذف في عدد السكان بنحو اثنين في كل جولة، في حين خلية نظريا تحمل الاتحاد جميع الحذف في الوالدين 2 يمكن الجمع في وقت واحد سلالات إذا تحققت صرامة مثالية لاختيار GFP. واحد الحد هو الاختلاف الخلية الى خلية من خلايا كثافة GFP بين إسوية الجينات. في المثال الثاني في النتائج الممثل، فمن المتوقع 0.8٪ فقط من الخلايا في السكان من الحصول على جميع ال 11 التي كانت الحذف ممكن في هذا الصليب (تم تقاسمها أربعة من الحذف 11 من كل النباتات الاحاديه الوالدين). ومع ذلك، فإن أكثر وفرة عشر سلالات الحذف يكون توزيع كثافة GFP أن التداخل الذي من سترا 11-الحذفالإضافية. ولذلك، يجب تحديد على جزء أصغر من السكان لتحديد تفضيلي 11-الحذف سلالات من أعلى الذيل من توزيع كثافة من GFP 11-الحذف السلالات. قد يكون حل واحد لرفع عتبة ببساطة لفرز الخلايا أندر مع كثافة أعلى GFP. قد يكون حل آخر لقياس مستوى واحد الداخلية، وهو مراسل بروتين فلوري من لون مختلف وهذا هو موجود في نسخة واحدة، وأعرب عن طريق المروج نفس 2 تيتو. ومن المتوقع أن هذه الاستراتيجية ليلغي الضوضاء خارجي للحد من التباين الخلية الى خلية من هكذا قياسات كثافة-تطبيع GFP 16،17.

يمكن أن تتفاقم صعوبة الحصول على طفرات نادرة متعددة من معدل النمو البطيء المحتملة لهذه السلالات. يتم إثراء متعدد المسوخ باستخدام التدفق الخلوي، ولكن يمكن أن outcompeted خلال الفترة المتبقية من هذه العملية عن طريق الأشقاء مجرب. للحد من عدد من الأجيالسلالات الخميرة الخضوع، نوصي كميات صغيرة الثقافة التي توفر التضخيم فقط ذاتيا من خلايا الصيغة الصبغية المطلوب أن يتم اختيار في كل خطوة.

لأنه يمكن الحصول عليها الحذف متعددة لكل دورة، ويمكن استخدام الأسلوب الوحش الأخضر لتجميع متعدد المسوخ بسرعة أكبر من الطرق متتابعة 11. إذا مجموعات فرعية معينة من الحذف علاقات قاتلة الاصطناعية، قد يكون مصادفة 'الميت ينتهي "مع نهج متسلسل. ويمكن التحايل على هذا التحديد من قبل نهج الوحش الأخضر، الذي عينات من الفضاء من المسارات الممكنة نحو تراكم مجموعة كاملة من الحذف. ينبغي أن إصدار المزيد موازية بأعداد كبيرة لعملية الوحش الأخضر تكون مفيدة في إيجاد مسار للوصول إلى أكبر عدد من الحذف مقبولة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgments

وأيد هذا العمل من قبل الولايات المتحدة للبحث المتقدم الدفاع كالة مشاريع العقد N66001-12-C-4039 إلى YS، على منحة من مؤسسة ألفرد سلون P. لRSL، والمعاهد الامريكية الوطنية للصحة منح R01 R21 HG003224 وCA130266 لFPRFPR كان كما دعمت من قبل الزمالة من المعهد الكندي للأبحاث المتقدمة والتميز من قبل برنامج كراسي البحث كندا.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics