여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

그린 몬스터 방법은 리포터 유전자 인코딩 녹색 형광 단백질로 표시된 여러 삭제의 급속한 조립이 가능합니다. 이 방법은 반복 삭제의 성적 구색의 사이클 등 삭제를 들고 세포의 형광 기반의 강화를 통해 효모 변종 운전에 기반을두고 있습니다.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

유전자 삭제에 대한 Phenotypes은 종종 변이가 특정 유전 배경이나 환경 조건 1,2에서 테스트하는 경우에만 공개됩니다. 많은 유전자 숨겨진 유전자의 기능에게 3,4 가면을 벗어 라하기 삭제해야 예제가 있습니다. 중요한 발견의 가능성에도 불구하고, 세 개 이상 유전자를 포함한 유전자 상호 작용은 크게 미개척 있습니다. 다중 돌연변이의 상호 작용 철저한 검색의 삭제 가능한 조합의 깎아 지른듯한 숫자로 인해 비실용적 것입니다. 그러나, 이러한 일반적인 기능을 공유 큰 사전 기회로 paralogs 세트 등 유전자,의 선택한 세트의 연구 정보를 것입니다.

효모 Saccharomyces cerevisiae에서 유전자 녹아웃는 상동 재조합을 통해 선택 마커로 유전자를 대체하여 수행됩니다. 마커의 수가 제한되어 있기 때문에, 방법은 샘을 제거하고 재사용을 위해 개발 된 전자 표시 5,6,7,8,9,10. 시간이 생성 될 삭제의 수와 비늘 선형 필요하기 때문에 그러나, 이러한 방법을 사용하여 순차적으로 엔지니어링 여러 변이은 시간이 오래 걸릴 수 있습니다.

여기 정기적으로 효모 11 여러 삭제를 꾸민위한 그린 몬스터 방법을 설명합니다. 이 방법에서는, 삭제에 통합 녹색 형광 단백질 (GFP) 기자는 각 변형에 포함 된 삭제의 수 (그림 1)에 따라 양적 라벨 긴장하는 데 사용됩니다. 효모 결합 및 세포의 감수 분열을 통해 GFP-표시의 삭제 구색의 반복 라운드는 긴장의 삭제의 축적 (그림 2)로 연결이 삭제 더 많은을 가진 변종의 흐름 cytometric 강화와 결합. , 라운드 당 하나 이상의 삭제를 통합하는 각 과정, 병렬로 여러 프로세스를 수행하면 변형 건설에 필요한 시간을 줄일 수 있습니다.

내용이 "> 첫 번째 단계는 haploid 단일 돌연변이는 칭했다 준비하는 것입니다 'ProMonsters'를 GFP를 삭제 궤적에서 기자와 '툴킷'중 하나를 수행 각각의 loci을 하나 그린 몬스터 GMToolkit -이나 GMToolkit-α .. can1Δ 궤적 (그림 3) 효모 삭제 컬렉션 12 일부터 변종을 사용하여이 GFP-마크 삭제 편리하게 보편적 GFP을 통해 이러한 변종에 존재하는 일반적인 KanMX4 카세트 교체에 의해 생성 될 수있다 - URA3 조각을 각 GMToolkit에는 다음이 포함됩니다 중 - 또는 α-결합 형 특정 haploid 선택 마커 1과 정확히 두 GMToolkits이 존재 경우, 이하 diploids의 선택을 허용, 그런 두 마커 중 하나입니다.

두 번째 단계는 삭제 loci는 무작위 구색 및 / 또는 meiotic recomb하여 단일 세포 내에서 결합 할 수있는을 통해 성적 자전거를 수행하는 것입니다결합 및 sporulation의 각주기를 함께 ination.

Protocol

1. ProMonsters의 생성

  1. tetO 2 GFP 마커와 순서와 프리 머를 사용하여 플라스미드 pYOGM012 (암피실린 저항)에서 URA3 마커를 증폭하여 보편적 인 GFP 교체 카세트 준비 :
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG 및 GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (굵게 표시된 지역 타겟이 분명한 교체를 허용 KanMX4 카세트의 측면을 노릴 지역에 호몰 로지를 제공합니다). PCR 반응은 Phusion의 효소 HF 버퍼, 그리고 0.5 NG / μl의 템플릿 DNA 농도로 시작 3퍼센트 디메틸 sulfoxide (뉴 잉글랜드 BioLabs)를 수행해야합니다. PCR 프로그램은 98 10 초 30 초 및 98 ° C의 35주기위한 ° C, 49 ° 30 초에 C, 그리고 1.5 분 72 ° C입니다. 반응 볼륨 각 변환 실험에 충분한 DNA를 제공하기 위해> 50 μl해야합니다. 우리는 정화열 당 처리 PCR 반응 ~ 50 μl로 QIAquick PCR 정화 키트 (Qiagen)를 사용하지만, 정화 단계를 건너 뛰는 제품은 transformants의 수익율을 증가시킬 수있다.
    또는 제한 효소 EcoRI (뉴 잉글랜드 BioLabs)를 사용하여 플라스미드 pYOGM057 (암피실린 저항)를 소화하여 타겟팅이 tetO 2 GFPKanMX4에 대한 동종 URA3 마커뿐만 아니라 지역을 포함하는 조각을 놓습니다. 이 반응에서 DNA의 농도는 ~ 30 NG / μl해야합니다. 반응 볼륨> 34 μl해야합니다.
    KanMX4 이외의 지역에 GFP 카세트 통합은 적절한 동종 시퀀스에 위의 PCR의 프리 머의 호몰 로지 영역을 조정합니다.
  2. 보편적 인 GFP 삭제 카세트와 KanMX4 효모 한방 수집 12-haploid 부담을 변환 할 수 있습니다. 의 우즈와 Gietz 13 0.34 μl의 프로토콜에 따라DNA 샘플은 (정화 PCR 제품 또는 비 정화 제한 다이제스트) 각 변환 실험을 위해 사용되어야합니다. 판 CAA-우라 판로 변환 혼합물의 다섯 번째 (0.67 % 효모 질소 기지, 2 % 포도당, 0.6 % casamino 산, 0.0025 % 아데닌 hemisulfate, 0.005 %의 트립토판, 2 %의 한천).
  3. 절연 식민지를 얻기 위해 신선한 CAA-우라 판에 transformants에서 승리.
  4. 성장의 부족을 확인하기 위해 200 μg / ML G418을 포함하는 YPDA 판에 식민지에서 세포를 전송합니다. (1.9) 식민지 PCR을 수행 할 수 있습니다 - 성공적인 GFP 통합을 확인하려면 다음 단계 (1.5)가 따르십시오.
  5. 0.2-ML PCR 튜브 또는 96 - 웰 플레이트 잘에 용해 버퍼 2 μl (0.1 M의 인산 나트륨, 산도 7.4, ZymoResearch에서 1 단위 zymolyase)에 식민지에서 가져온 세포를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다.
  6. P200 Pipetman (Gilson)를 사용하여 미네랄 오일 한 방울 (약 20 μl)와 중첩.
  7. 37 혼합물을 품다 °95의 다음 20 분 및 ° 10 분에 C에 대한 C.
  8. 50 μl 물 lysate를 희석. 열 번과 아웃 솔루션을 pipetting하여 섞는다.
  9. 상류 측면을 노릴 지역 anneals의 순서 CCTGAGAAAGCAACCTGACC (카세트의 처음부터 285 BP)의 입문서와 페어링하는 (A) 앞으로 입문서로 10 μl PCR 반응을 사용하여 lysate 1 μl, (B) 역을 분석 프라이머 그 순서 GCATTGGGTCAACAGTATAG (끝에서 375 BP)의 입문서와 짝을 하류 지역에 anneals (C)은 두 시퀀스를 CGTACTCCTGATGATGCATG과 (181 BP) GACGAAATACGCGATCGCTG과 KanMX4에 단련 프리 머, 그리고 (D)은 두 프리 머 그 대상 유전자 (그림 4)의 야생 형 시퀀스로 어닐링. 삭제 컬렉션에있는 긴장의 약 8 %가 aneuploidy 14을 포함하는 것으로 알려져 있기 때문에 (D) 중요합니다. 올바른 transformant가 함께 긍정적이어야합니다 (A)와 (B) 및 제외 어있는 (C)와 (D).
  10. 를 소개하려면transformant에 GMToolkit은 1.6 ML Eppendorf 튜브에 변형 변형에서 약 250,000 세포 있으며 RY0146 (GMToolkit -을 포함) 또는 RY0148 (GMToolkit-α를 포함하는)의 250,000 셀을 추가 할 수 있습니다. 와동. RY0146 및 RY0148의 genotypes은 MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit - [CMVpr - rtTA KanMX4 STE2pr-SP-his5]와 MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr - rtTA NatMX4 STE3pr - LEU2], 각각. 홍보 발기인를 나타냅니다. 휴대폰 번호는 앞의 문화의 광학 밀도의 추정해야합니다.
  11. 2 분 800 XG에 원심 분리기.
  12. 표면에 뜨는을 제거합니다.
  13. 공기 교환을 할 수 있도록 70 %의 에탄올로 치료 고정 핀을 사용하여 뚜껑에 구멍을합니다.
  14. YPDA 미디어 (1 % 효모 추출물, 2 % 펩톤, 2 %의 포도당, 그리고 0.003 % 아데닌 hemisulfat의 50 μl를 추가합니다E). 와동.
  15. 5 분 800 XG에 원심 분리기.
  16. 젖은 상자에서 튜브를 놓습니다. 이 작업은 빈 팁 상자, 작은 팁 스탠드, 그리고 젖은 종이 타월로 생성 할 수 있습니다.
  17. 30에서 밤새 상자를 품다 ° C.
  18. 먼저 CAA-우라 판에있는 셀을 좋겠어하여 정합 diploids을 선택합니다. 하루 30 ° C에서 판을 품다.
  19. diploids을 선택에 대해 200 μg / ML G418을 포함 YPDA 판에서 분리 된 식민지 (1 % 효모 추출물, 2 % 펩톤, 2 %의 포도당, 0.003 % 아데닌 hemisulfate, 2 %의 한천)을 만들기 위해 대량 지​​역, 연속에서 그들을 세포를 촬영 포함 GMToolkit - 또는 100 μg / ML nourseothricin (NAT) GMToolkit-α를 포함하는 diploids 선택을위한 15.
  20. 3 일 동안 30 ° C에서 판을 품다.
  21. 격리 된 식민지에서 시작은, 한천없이 GNA 매체 500 μl로 세포의 대부분을 이전 (1 % 효모 추출물, 3% Difco 영양소 국물, 그리고 5 % 포도당, 압력솥 포도당과 t의 나머지그는 구성 요소는 별도로으로 뚜껑이있는 5 ML 문화 관 caramelization을 방지하기 위해 2 × 솔루션)은 느슨하게.
  22. 30에 다섯 시간 동안 수평 관을 회전 ° C. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다.
  23. 에서 사용되는 식민지를 확인 (1.21) 우라는 + CAA-우라 판에 그들을 좋겠어으로.
  24. 2 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오.
  25. 최소한의 sporulation 매체 (, 필터 소독 1 % 칼륨 아세테이트, 0.005 %의 아연 아세테이트) 500 μl를 추가합니다. 와동.
  26. 2 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오.
  27. 반복 (1.25) - (1.26) 두 번.
  28. 7.5 μg / ML 리신, 7.5 μg / ML 류신, 5 μg / ML 히스티딘, 5 μg / ML 메티오닌, 그리고 1.25 μg / ML uracil (auxotrophic 긴장의 sporulation 속도를 향상하기 위해)를 보충 최소한의 sporulation 매체 1 ML을 추가 . 와동.
  29. 하루 실온에서 튜브를 회전합니다.
  30. 2 일 30 ° C에서 튜브를 회전합니다.
  31. 2 분 800 XG에서 1.6 ML Eppendorf 튜브에이 혼합물의 125 μl를 원심 분리기. 표면에 뜨는 폐기하십시오.
  32. zymolyase 솔루션 (100 MM 나트륨 인산염 버퍼, 산도 7.4, 1 M sorbitol 및 ZymoResearch에서 2 단위 zymolyase) 50 μl를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다.
  33. 1 시간에 30 ° C에서 알을 품다.
  34. 0.02 % NP-40의 50 μl를 추가합니다. 피펫 팁의 확대 및 솔루션을 pipetting하여 섞는다.
  35. 5 분 동안 실온에서 관 둡니다.
  36. 물 500 μl를 추가합니다.
  37. 얼음에 튜브를 놓습니다.
  38. Sonifier 450 (브랜슨)와 3.2 mm microtip를 사용하여 15 초 1의 출력 설정 (약한 설정)에서 두 번이 혼합물을 Sonicate. sonication의 두 발 사이에, ~ 0 ° C.에 온도를 반환 얼음에 튜브를 넣어
  39. 5 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오.
  40. SC-우라 - 그의 200 μl를 추가합니다() 또는 교차 GMToolkit - 또는 GMToolkit-α를 통합인지 여부에 따라 SC-우라 - 레우 (α) 매체. 미디어를 준비하려면 SC-우라 - 그의 - 레우 매체 (0.67 % 효모 질소 기지, 2 % 포도당, 0.01 % 아르기닌, 0.01 % 아스파르트 산, 0.01 % 글루탐산, 0.01 % 이소류신, 0.01 % 리신, 메티오닌 0.01 % 할 , 0.01 %의 페닐알라닌, 0.08 %의 세린, 0.04 %의 트레오닌, 0.002 %의 티로신, 0.03 %의 발린, 0.0025 %의 아데닌, 0.005 %의 트립토판, 0.003 %의 아데닌, 그리고 0.005 % 트립토판) 및 멸균 히스티딘 또는 류신로 보충을 사용하기 전에 0.01 %의 최종 농도.
  41. 70 % 에탄올로 치료 고정 핀을 사용하여 뚜껑에 구멍을 확인합니다.
  42. 2 일 30 ° C에서 수평 관을 회전합니다. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다.
  43. SC-우라 - 그의 또는 SC-우라 - 레우 한천 플레이트 (위의 동일한 재료를 플러스 2 % 한천에있는 세포에서 승리는, 트레오닌과 아스파르트 산 후 추가해야합니다utoclaving, ProMonster의 변종에 대한 절연 식민지를 만들기 위해) 주입 전에 히스티딘 또는 류신를 추가합니다.

2. 성적 사이클링

  1. 100 SC-그의의 μl (A) 또는 30에서 결합 유형에 따라 SC-레우 (α)의 설립 GFP 삭제 스트레인의 문화를 회전 ° C 하룻밤 1.6 ML Eppendorf 튜브을 사용합니다. 공기 교환의 경우 70 % 에탄올로 치료 고정 핀을 사용하여 구멍을합니다. 수평 관을 회전합니다. 회전의 축은 튜브의 길이 방향 축에 평행 있어야합니다. 호텔은 실내 masse 결합을 통해 여러 변종을 넘는 할 수 있습니다. 정렬 샘플은 직접 2 일 30 ° C에서 200 μl이 목적, 문화, 전지에 사용하는 경우. SC-우라 - 그의 - 레우 매체와 히스티딘 (0.01 %) 나 루신 (0.01 %) : 매체를 준비하려면, uracil을 (0.0025 % 최종 농도)를 추가합니다.
  2. 1.6-ML Eppe에 250,000 - haploid 세포와 GFP를 삭제 긴장의 250,000 α-haploid 세포를 혼합ndorf 관. 와동.
  3. (1.17) - 다음 단계 (1.11)에 의해 이러한 세포를 버려.
  4. 느슨하게 뚜껑으로 5 ML 문화 튜브에 200 μg / ML G418과 100 μg / ML NAT를 포함 500 μl GNA 매체에 결합 혼합물의 10 μl를 전송합니다. 시작 OD 600 약 0.1이다.
  5. 24 시간 30 ° C에서 문화를 회전합니다. 만 diploids가 모두 KanMX4을 포함하기 때문에이 diploids의 선택을 허용 GMToolkit - GMToolkit-α 및 NatMX4는 G418 및 NAT의 존재 (그림 3)에서 증가 할 수 있습니다.
  6. G418 및 NAT를 포함하는 신선한 GNA 500 μl에 하루 문화의 20 μl를 전송합니다. 시작 OD 600 약 0.2이다.
  7. 로그 단계 (~ 1 OD 600)에 셀을 가져 오 시간에 30 ° C에서 튜브를 회전합니다.
  8. diploids을 sporulate과 포자를 분리하고 (1.38) - 단계 (1.24)를 따르십시오.
  9. 이 300 μl에 sporulated 세포 현탁액을 분할부품은 별도의 1.5 ML Eppendorf 튜브에 각각 넣어.
  10. 5 분 800 XG에 튜브를 원심 분리기. 표면에 뜨는 폐기하십시오.
  11. 한 튜브의 펠렛으로, A-haploids을 선택 SC-그 중간의 100 μl를 추가합니다. 다른 튜브의 펠렛으로, α-haploids를 선택 SC-레우 매체 100 μl를 추가합니다.
  12. 30 ° C 하룻밤에 튜브를 회전합니다. 최종 OD 600 0.5 미만이어야합니다. OD 600 너무 높은 경향이있는 경우 실온에서 배양을 시도해보십시오.
  13. GFP를 유도하기 위해 신선한 SC-그의 () 또는 20 μg / ML의 doxycycline가 포함 된 SC-레우 (α) 매체입니다. 100 μl를 추가합니다 doxycycline의 최종 농도는 10 μg / ML입니다. 와동.
  14. 2 일 30 ° C에서 튜브를 회전합니다.

3. 유동 세포 계측법

  1. 캡 5 ML 폴리 프로필렌 튜브 (BD 팔콘 # 352063)에 10 μg / ML doxycycline을 포함하는 사전 필터링 TE 버퍼 900 μl (산도 7.5)를 추가로 교체 세포5 ML 폴리스티렌 튜브의 스트레이너 캡 (BD 팔콘 # 352235). 폴리 프로필렌 튜브는 유동 세포 계측법에 적합합니다. 스트레이너 캡은 대형 입자를 제거하기 위해 원하는 수 있습니다.
  2. 부드럽게 셀 스트레이너 캡에 doxycycline과 TE 버퍼의 75 μl를 놓습니다.
  3. 캡의 솔루션으로 유도 세포의 25 μl를 추가합니다.
  4. 메쉬에 대한 Pipetman의 끝을 누르면 있지만, 스트레이너를 통해 통합 솔루션을 모두 쏴.
  5. 스트레이너 캡과 소용돌이 관을 누릅니다.
  6. SC-그의 또는 SC-레우 200 μl로 가득 수집 튜브를 (1.6-ML Eppendorf 튜브) 준비합니다.
  7. 셀 정렬을 시작하고 제조업체 설명서에 따라 설정을 조정합니다.
  8. 소용돌이 수집 관 (코트 매체로 벽을에)와 셀 정렬에를로드하기 전에 세포를 포함하는 관 모두.
  9. 샘플의 유동 세포 계측법 데이터를 수집. GFP을 포함하지 않는 변형은 대조군이 될 수 있습니다.
  10. 정렬을위한 문을 그립니다. (A)높은 GFP의 강도를 전시 할 수 셀 집계를 방지하기 위해 FSC 높이의 줄거리와 FSC를 사용하여 펄스 폭 및 펄스 높이 MoFlo 정렬 또는 불균형 작은 FSC 높이의 도면을 사용하여 앞으로 분산 (FSC)에 어울리지 않게 큽니다 펄스 폭과 특이점을 취소 FACSAria 정렬 (그림 5, 왼쪽 위 패널)의 공간을 제공합니다. (B) 대형 FSC (면적)은 세포 집계에 예상되어 있기 때문에, 낮은 FSC, 측면 분산 (SSC) 세포 파편은 종종 발견되는 값으로 지역을 피하면서 만 FSC의 낮은 20 %에 세포를 (그림 5, 오른쪽 상단 패널). (C) SSC (지역)와 GFP 신호 (지역) 종종 긍정적으로 서로 관련되어 있습니다. 단순히 위의 문 주어진 가장 밝은 세포를 복용 때문에도 높은 SSC 값이 세포에 풍부 것, 각 지점에서 가장 밝은 세포의 비슷한 비율을 취할 GFP 강도와 SSC의 도면을 사용하여 인구의 주변을 따라 문을 그려 SSC 축 (그림 5, bott의)도 톰 - 좌. (C)에서 선택한 인구 (B)에서 선택한 인구의 0.1-1 %이어야합니다.
  11. (3.10)에 기준을 제공 수집 관에 200 세포를 정렬합니다. 필요에 따라 전용 masse 과정 또는 더 복잡한 인구를 요구하는 다른 프로젝트에 대한 더 많은 세포를 정렬합니다.
  12. 소용돌이 수집 관은 매체와 정렬 셀을 포함합니다.
  13. 판 genotyping에 대한 YPDA 접시에 세포의 일부 (예를 들어, 50 셀).
  14. 2 일 30 ° C에서 판을 품다.
  15. (1.8) - 단계 (1.5)에 따라 ~ 12 식민지의 lysate를 확인합니다.
  16. 부드럽게 팁과 플레이트를 터치하여 G418 및 NAT를 포함하는 YPDA 플레이트에 입단에 사용되는 팁 (1.5)에 잔여 세포를 전송합니다. 선택한 haploids이 접시에 성장해서는 안됩니다. Diploids 더 GFP 사본이있을 수 있으므로 밝게 할 수 있습니다. 이 테스트는 haploid 선택의 효율성을 표시 할 수 있습니다.
  17. genotyping를 들어, 10 μl PCR R을 사용하여 lysate의 1 μl를 분석순서 CCTGAGAAAGCAACCTGACC의 입문서와 짝을 각각 삭제 유전자의 상류 측면을 노릴 지역에 anneals하는 기대 입문서로 eaction.
    멀티 플렉스 PCR 반응 가능하면 (조건은 단일 돌연변이의 lysates를 사용하여 결정 할 수 있습니다.) 또는 384도 형식 - PCR은 96에서 수행 할 수 있습니다. 후자의 형식은 최소 5와 μl의 반응 볼륨에 적합합니다. PCR 마스터의 Arraying은 프리 머 이러한 믹스에 세포 lysates의 추가는 멀티 채널 피펫 또는 액체 처리 로봇을 사용하여 수행 할 수에 차이가 조화를 이루고 있습니다. 다른 PCR 믹스에 동일한 lysate을 추가 할 때 팁 변경은 선택 사항입니다.
  18. PCR 제품을 분석합니다. 젤 XL 울트라 V-2 전기 시스템 (Labnet)는 멀티 채널 피펫을 사용하여 샘​​플 로딩과 호환됩니다.
  19. 의 정보 (3.16) 및 (3.18)에 따라 genotypes을 원하는 한 것 haploids를 확인합니다.
  20. 신선한 플레이트 (YPDA, CAA-우라, 또는 SC-Ura-His/Leu)에 이러한 변종을 설정합니다. 또한,에서 그들을 동결-80에서 25 % 글리세롤 ° C. 이러한 삭제 유전자 및 펄스 - 필드 겔 전기 영동을위한 야생 형 시퀀스의 부재의 확인 등의 추가 시험이 권장됩니다.
  21. 유용한 긴장과 성적 자전거 (2.1)를 반복합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

네 GFP-마크 삭제합니다 (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) 수행 - haploid 변형은 네 삭제를 수행 α-haploid 변형으로 건너되었을 때 (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), 두 삭제와 (ycl033cΔ yer042wΔ)은 두 변종이 대표에서 공유 결과는 얻은 것입니다. 짝짓기 혼합물은 diploids을 선택 G418 및 NAT를 포함하는 YPDA 매체에 배양되었다. 그 결과 diploids는 sporulation 매체에 배양 하였다. 포자는 zymolyase 치료와 sonication에 의해 분산, 그리고 haploid 선택 미디어에서 germinated되었습니다. 세포는 다음 GFP를 표현하도록 유도했다. 흐름 cytometer로 문을 사용하여 셀의 인구는 쓰레기 또는 셀 집계 (그림 5)를 포함 할 가능성이 있다는 선정되었습니다. 이 인구 내에서 세포의 가장 밝은 1퍼센트가 정렬되었습니다. 정렬 셀과 정렬되지 않은 세포는 제노했다그들은 접시에 식민지를 형성 한 후 입력. 무작위로 선택된 식민지는 일부 diploids의 능력을 얻은 것을 제안, G418 및 NAT, 정렬되지 않은 샘플에 대한 성장 16 식민지의 2에서의 세포 및 정렬 샘플에 대한 성장 26 식민지 18에서의 세포를 포함하는 YPDA 판에 나가 줄무늬 때 haploid - 선택 마커를 표현하고이 실험의 haploid - 선택과 GFP 유도 단계에서 전달합니다. Diploids는 더 큰 GFP의 수는 포함 복사에 아마 인해 정렬 샘플에 풍부하게되었습니다. haploids는 PCR로 분석되었을 때, 정렬 셀에 삭제의 평균 수는 ± 0.4 5.1이었다 (N = 8, SEM이 표시). 이러한 세포의 네이 교차하여 6 삭제, 삭제의 maximally 수를했다. 정렬되지 않은 샘플의 Haploids는 3.4 ±했다 평균 0.2 삭제 (N = 14).

별도의 실험, 일곱, GFP-마크 삭제 (YE를 들고-haploid 변형에r042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) 8 삭제를 들고 α-haploid 변형으로 건너되었습니다 (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), 네 일반적인 삭제로 (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) 두 변종에 포함되어 있습니다. diploids이 sporulation 매체에 선택하고 이후 배양되었을 때, 세포의 약 20 %가 미세 관찰 (N> 100)을 기준으로 sporulated. 포자가 분산하고 germinated 된 후, 결과 haploids는 명시 적 GFP를 유도되었으며 위의 형광을 기준으로 정렬. 61 무작위로 선택된 셀의 하나는 정렬 세포가 주로 haploid 것으로 제안, G418 및 NAT를 포함하는 YPDA 판에서 자랐습니다. PCR (그림 6)로 분석하면, 정렬 셀 8.8의 평균 삭제 번호를 가지고 ±0.3 (N = 12, SEM을 표시), 열 삭제를 포함하는 다섯 셀 포함합니다. 임의의 분리에서 발생하는 정렬되지 않은 셀의 삭제 예상 수는 7.5이었다.

그림 1
1 그림. 현미경으로 그린 몬스터. 형광 micrographs은 비 돌연변이 스트레인 (왼쪽), ProMonster 스트레인 (가운데), 그리고 16 GFP의 괴물 스트레인을 (오른쪽)를 보여줍니다. 동일한 노출, 밝기, 및 대비 설정은 이미지에 사용되었다.

그림 2
그림 2. 그린 몬스터 과정입니다. 단일 돌연변이 haploids (밝은 녹색)의 계획이 결합되어 있습니다. 결합 diploids의 sporulation 동안 Meiotic 재조합 0-GFP 세포 (오프 화이트), 1-GFP 세포 (밝은 녹색), 2-GFP 세포 (어두운 녹색)의 혼합물을 생성합니다. 흐름세포 계측법은 2 GFP 세포에 풍부하게 greenest 셀을 선택하는 데 사용됩니다. 통합 분자 도구 - haploids (그의 +), α-haploids (레우 +) 및 diploids (G418 및 NAT-저항)의 선택을 가능하게합니다. 이주기는 변경의 늘어나는 번호를 베어링 변종에 풍부하게 반복됩니다.

그림 3
그림 3. GFP의 삭제 카세트와 GMToolkits. GFP 삭제 카세트는 GFP의 리포터 유전자와 효모 변환 마커 (URA3)를 포함하고 있습니다. tetO이 발기인은 rtTA의 전사 인자의 작용을 통해 매체에 doxycycline의 추가에 의해 inducible입니다. GFP 레벨이 단백질을 할 수 또는에서 어떤 독성 효과를 용납 할 셀의 최대 용량에 도달하면, 그 표현은 doxycycline 농도를 낮추는 방법으로 아래로 다이얼 할 수 있습니다 (우리가했던 것을 그러나주의 심지어 GFP의 16 부)과 같은 포화 또는 독성 효과를 관찰 없습니다. 이 카세트는 PCR을 사용하여 특정 동종 시퀀스를 부착하여 어떤 유전자 나 지역을 타겟팅 할 수 있습니다. 또한, 동일한 동종 시퀀스와 보편적 인 GFP 삭제 카세트 편리하게 효모 한방 컬렉션의 변종에 KanMX4의 방문 패드 '를 타겟팅 할 수 있습니다. YFG 당신이 제일 좋아하는 유전자를 나타냅니다. 수직 라인 상자가 DNA 바코드를 나타냅니다. GMToolkits은 CAN1 현장에 통합되어 있습니다. STE2-his5 마커와 STE3-LEU2 마커는 - haploids은 히스티딘 각각, 류신의 부재에서 성장에만 α-haploids의 부재에서 성장 할 수 있도록 haploids의 결합 형 특정 방식으로 표현됩니다. G418 및 NAT에 대한 저항에 대한 선택하면 동시에 한 GMToolkit의 KanMX4 궤적과 다른에서 NatMX4 궤적에 대한 선택하므로 diploids에 선택합니다.

_content "강한 : 유지 - together.within 페이지 ="항상 "> 그림 4
4 그림. GFP 카세트의 올바른 통합을 확인. 보편적 인 GFP 카세트는 GFP-마크 삭제에 효모 삭제 컬렉션에서 사용할 수있는 모든 KanMX4 - 마크 삭제를 변환하는 데 사용할 수 있습니다. 상류 측면을 노릴 지역 anneals는 카세트의 시작 부분 (단계 1.9의 PCR)에 anneals는 밴드를 만들어야한다고 역 입문서와 페어링하는 기대 입문서와 올바르게 생성 GFP의 삭제 allele로, PCR 반응. 하류 측면을 노릴 지역 anneals은 카세트 (PCR B)의 말에 anneals가 제품을 만들어야 앞으로 입문서와 페어링하는 역 프라이머와 PCR. KanMX4 카세트 (PCR C) 이내 또는 대상 유전자 (PCR D)의 야생 형 시퀀스로 단련이 프리 머와 단련이 프리 머와 PCR는 밴드가 생성해서는 안됩니다. 빨간색 화살표는 PCR 프라이머를 나타냅니다. 브랙켓은 PCR 반응으로 증폭 영역을 보여줍니다. 상자는 GFP 카세트 (녹색), KanMX4 카세트 (노란색), 또는 좋아하는 유전자 (YFG, 회색)를 나타냅니다. 블랙 라인은 효모 염색체의 측면을 노릴 시퀀스를 나타냅니다.

그림 5
그림 5. 유동 세포 계측법. 2 변종, 유전자형과 하나의 십자가에서이 실험 haploid 자손에 ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ과 유전자형과 다른 ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ GFP를 표현하도록 유도했다. 각 유전자 삭제 GFP 카세트했다. 앞으로 분산 공간과 앞으로 분산 높이 (P1), 어울리지 않게 큽니다 앞으로 분산 영역이 제외 된 경우가 많다 셀을 합산 (에 기초하여 게이팅 세포. 앞으로 분산과 측면 분산 (P2), CE의 기준 게이팅 셀 별가장 낮은 앞으로 분산과 측면 분산과 쓰레기를 제외하면서 앞으로 분산의 낮은 20 % 재편이 허용되었다. 사이드 분산 및 GFP 신호 (P3)의 기준 게이팅 셀에 의해 주어진 측 분산 범위에서 그 나라의 더 많은 형광 셀이 촬영되었다. 고속 GFP, P3 인구를 선택하는 데 사용되는 하나 동일한 게이트 제외 컨트롤의 유사 선택한 셀에 대한 다이어그램에 표시된하지 않는 meiotic 믹스와 부정적인 컨트롤 샘플의 비교를 허용 할 수 있습니다.

그림 6
6 그림. 정렬 긴장을 Genotyping. PCR은 하류 측면을 노릴 지역 anneals는 앞으로 입문서와 페어링하는 역 프라이머를 사용하여 수행되었다 그 카세트의 끝으로 anneals. 밴드의 존재는 GFP 카세트의 존재를 나타냅니다. 별도의 실험 보여준 열두 변종 죄수의 모든yer042w Δ 삭제 및 ykr011c Δ 삭제를 주석 박.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

우리가 그린 몬스터 접근 방식을 개발로서, 우리는 게놈 다시 정리하기로 이어지는, 다른 GFP 교체 카세트 사이의 재조합의 가능성에 관심을했습니다. 이 가능성에 대한 완화하는 것은 성공적으로 결합하고 세포의 감수 분열의 여러 순찰을받은 세포에 대한 선택입니다. 재 배열 genomes을 간직한 세포는 동일한 다시 정리하기없이 셀에 결합 후 더 적합 할 것으로 예상됩니다. 사실, 우리는 GFP 카세트 11 사이의 재조합에 의한 게놈 불안정성을 관찰 없습니다. 그러나, 우리는 완전히이 가능성을 제외 할 수 없습니다, 그래서 그것은 사용자가 다시 정리하기 위해 생성 된 변종을 테스트하는 것이 좋습니다. 펄스 - 필드 겔 전기 영동은 총 이상을 감지하는 데 사용할 수 있습니다. 삭제 내에서 시퀀스에 소둔 프리 머와 PCR은 야생 형 시퀀스의 부재를 확인하는 데 사용할 수 있습니다.

설립 긴장, GF의 형광 수준에 따라P 강도는 채도가 한 16 삭제 11 테스트 범위 내에서 문제가 아니라는 것을 제안, 삭제의 수와 거의 선형 관계를했습니다. 그러나, 많은 비 중복 삭제와 긴장과 후반 라운드에서, 우리는 두 부모의 모든 삭제의 조합을 간직한 이론적으로 셀 반면, 약 2 각 라운드의에 의해 인구에 삭제의 평균 수를 증가 만 할 수 있었다 GFP 선택에 완벽한 엄중이 달성 된 경우 종자가 한 번에 결합 될 수 있습니다. 한 제한은 isogenic 세포 사이 GFP 강도의 휴대 전화의 변화입니다. 대표 결과에서 두 번째 예에서는 인구의 세포 만 0.8 %이 교차 (11 삭제 네 가지가 부모 haploids 모두에 의해 공유 된)에 가능했다 11 개 삭제가 될 것으로 예상됩니다. 그러나, 더 풍부한 열 삭제 종자는 GFP 강도의 분포가됩니다 중복 11 삭제 stra의기능. 따라서 인구의 더 작은 부분은 우선적으로 11 삭제 긴장의 GFP 강도 분포의 높은 꼬리에서 11 삭제 변종을 선택 선택해야합니다. 하나의 솔루션은 단순히 높은 GFP 강도와 rarer 세포를 정렬 할 수있는 기준을 마련 할 수 있습니다. 또 다른 방법은 동시에 같은 tetO이 발기인을 통해 표현 내부 표준 단일 사본에 존재 다른 색깔의 형광 단백질 기자를 측정 할 수 있습니다. 이 전략은 따라서 - 정규화 GFP 강도 측정 16,17의 휴대 전화 편차를 줄이기 위해 외부 소음을 취소 할 것으로 예상됩니다.

희귀 한 다중 돌연변이를 획득의 어려움은 이러한 변종의 가능성이 느린 성장 속도에 의해 악화 될 수있다. 다중 돌연변이는 유동 세포 계측법을 사용하여 풍부하고 있지만 그들은 배관공의 형제에 의해 프로세스의 나머지 기간 동안 outcompeted 될 수 있습니다. 세대의 수를 최소화하는 방법효모 긴장이 받아야, 우리는 각 단계에서 선택되어 원하는 ploidy의 세포 그냥 충분한 증폭을 제공합니다 작은 문화 볼륨을 사용하는 것이 좋습니다.

여러 삭제는 사이클 당 취득 할 수 있기 때문에, 초록 괴물 방법은 더 빠르게 순차적 방법 11보다 멀티 돌연변이를 구성하는 데 사용할 수 있습니다. 삭제의 특정 하위 집합이 합성 치명적인 관계가있는 경우, '막 다른 골목'은 순차 접근 방법으로 발생 될 수 있습니다. 이 제한은 초록 괴물 접근 방식에 의해 피할 수 삭제의 전체 집합을 축적 대한 가능한 경로의 공간에서하는 샘플. 초록 괴물 과정의 더 많은 병렬 전용 masse 버전은 삭제의 가장 큰 편 수에 도달하는 경로를 찾는 데 유용합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

관심 없음 충돌이 선언 없습니다.

Acknowledgments

이 작품은 FPRFPR에 YS, RSL의 알프레드 P. 슬로안 재단의 교부금 및 건강 교부금의 미국 국립 연구소 R01 HG003224와 R21 CA130266에 미국 국방 고급 연구 프로젝트 기관 계약 N66001-12-C-4039에 의해 지원했던 건 또한 고급 연구 캐나다 연구소에서 친목 의해 캐나다 우수 연구 의자 프로그램에 의해 지원됩니다.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics