El Proceso de Monstruo Verde para la generación de cepas de levadura que llevan deleciones múltiples genes

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

El método monstruo verde permite el montaje rápido de deleciones múltiples marcados con un gen reportero que codifica la proteína verde fluorescente. Este método se basa en la conducción de las cepas de levadura a través de ciclos repetidos de surtido sexual de las deleciones y de enriquecimiento basado en la fluorescencia de las células que llevan más deleciones.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenotipos para un gen de supresión a menudo se revela sólo cuando la mutación se prueba en un fondo genético particular o 1,2 condición ambiental. Hay ejemplos en los que muchos genes deben ser eliminados para desenmascarar funciones ocultas genes 3,4. A pesar del potencial para descubrimientos importantes, las interacciones genéticas que involucran tres o más genes son en gran parte inexplorado. Búsquedas exhaustivas de múltiples interacciones mutantes sería poco práctico debido a la gran cantidad de posibles combinaciones de supresiones. Sin embargo, los estudios de conjuntos seleccionados de genes, como los juegos de paralogs con un mayor priori la posibilidad de compartir una función común, sería informativo.

En la levadura Saccharomyces cerevisiae, gen knockout se logra mediante la sustitución de un gen con un marcador seleccionable mediante recombinación homóloga. Debido a que el número de marcadores es limitado, se han desarrollado métodos para retirar y volver a utilizar el sam e 5,6,7,8,9,10 marcador. Sin embargo, las mutaciones de ingeniería secuencialmente múltiples utilizando estos métodos lleva mucho tiempo debido a que el tiempo requerido amplía de forma lineal con el número de deleciones que se genera.

A continuación se describe el método de Monstruo Verde para rutinariamente la ingeniería de múltiples eliminaciones en la levadura 11. En este método, una proteína verde fluorescente (GFP) reportero integrado en deleciones se utiliza para las cepas de etiquetas cuantitativamente de acuerdo con el número de deleciones contenidas en cada cepa (Figura 1). Rondas repetidas de surtido de GFP-marcados deleciones a través de apareamiento de levadura y la meiosis junto con citometría de flujo de enriquecimiento de las cepas que llevan más de estas deleciones conducir a la acumulación de deleciones en las cepas (Figura 2). Realización de varios procesos en paralelo, con cada proceso de incorporar una o más supresiones por ronda, reduce el tiempo necesario para la construcción de la cepa.

contenido "> El primer paso es preparar un solo haploides mutantes llamado 'ProMonsters', cada uno de los cuales lleva un reportero GFP en un locus eliminado y uno de los 'toolkit' loci, ya sea GMToolkit-un monstruo verde o GMToolkit α-en el . can1Δ locus (Figura 3) utilizando cepas de la colección de supresión de levadura 12, GFP-marcadas deleciones pueden ser convenientemente generado mediante la sustitución de la casete KanMX4 común existente en estas cepas con una GFP universal - URA3 Cada fragmento contiene GMToolkit:. sea la a - o α-apareamiento de tipo específico del marcador de selección haploide 1 y exactamente uno de los dos marcadores que, cuando ambos están presentes GMToolkits, colectivamente permiten la selección de diploides.

El segundo paso consiste en llevar a cabo el ciclo sexual a través del cual loci de deleción se pueden combinar en una sola célula por la variedad aleatoria y / o RECOMB meióticaminación que acompaña a cada ciclo de apareamiento y la esporulación.

Protocol

1. Generación de ProMonsters

  1. Preparar el casete GFP reemplazo universal mediante la amplificación de un tetO 2-GFP marcador y el marcador URA3 a partir del plásmido pYOGM012 (resistencia a ampicilina) usando cebadores con secuencias:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG y GTACCGGGTAATAACTGATATAAT GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC (regiones en negrita proporcionar homología con las regiones flanqueantes de la casete KanMX4 permite la sustitución específica). La reacción de PCR se llevó a cabo con la polimerasa Phusion, tampón de HF, y 3% de sulfóxido de dimetilo (New England BioLabs) a partir de la concentración de plantilla de ADN de 0,5 ng / l. El programa de PCR es de 98 ° C durante 30 segundos y 35 ciclos de 98 ° C durante 10 s, 49 ° C durante 30 seg, y 72 ° C durante 1,5 min. El volumen de reacción debe ser> 50 l para proporcionar suficiente ADN para cada experimento de transformación. Nosotros purificamosel producto usando un QIAquick PCR kit de purificación (Qiagen) con ~ 50 l de la reacción de PCR procesado por columna, pero omitiendo la etapa de purificación puede aumentar el rendimiento de los transformantes.
    Alternativamente, liberar un fragmento que contiene el tetO 2-GFP y URA3 marcadores, así como las regiones homólogas para KanMX4 focalización, por digestión del plásmido pYOGM057 (resistencia a ampicilina) usando la enzima de restricción EcoRI (New England Biolabs). La concentración de ADN en esta reacción debe ser ~ 30 ng / ul. El volumen de reacción debe ser> 34 l.
    Para la integración de la casete de GFP en una región que no sea KanMX4, ajuste la región de homología de los cebadores de PCR indicados a los correspondientes secuencias homólogas.
  2. Transformar una cepa haploide-una de la colección de levadura knockout KanMX4 12 con la casete de GFP supresión universal. Siguiendo el protocolo por Woods y Gietz 13 0,34 l de laMuestra de ADN (producto de PCR purificado o restricción no purificado digest) se debe utilizar para cada experimento de transformación. Placa quinto de la mezcla de transformación uno sobre una placa de CAA-Ura (0,67% de base nitrogenada de levadura, 2% de glucosa, 0,6% de ácido casamino, 0,0025% hemisulfato de adenina, 0,005% de triptófano, y 2% de agar).
  3. Streak los transformantes en un fresco CAA-Ura placa para obtener colonias aisladas.
  4. Transferir las células de una colonia en una placa de YPDA contenía 200 mg / ml de G418 para confirmar la falta de crecimiento. Para confirmar la integración de las buenas prácticas agrarias con éxito, siga los pasos (1,5) - (1,9) para realizar la PCR de colonias.
  5. Añadir las células tomadas de una colonia en 2 l de tampón de lisis (0,1 M de fosfato sódico, pH 7,4, 1 unidad de zimoliasa ZymoResearch) en un tubo de 0,2-ml PCR o un pocillo de una placa de 96 pocillos. Mezclar pipeteando la solución dentro y fuera de una punta de pipeta.
  6. Superposición con una gota (aproximadamente 20 l) de aceite mineral con un Pipetman P200 (Gilson).
  7. Incubar la mezcla a 37 °C durante 20 min y después a 95 º C durante 10 min.
  8. Diluir el lisado con 50 l de agua. Mezclar pipeteando la solución dentro y fuera diez veces.
  9. Analizar 1 l de lisado utilizando el 10-mu l reacciones de PCR con (A) un cebador directo que hibrida con la región aguas arriba de acompañamiento emparejado con un cebador de la secuencia CCTGAGAAAGCAACCTGACC (285 pb desde el comienzo de la cassette), (B) un inverso cebador que hibrida con la región aguas abajo junto con un cebador de la secuencia GCATTGGGTCAACAGTATAG (375 pb desde el extremo), (C) dos cebadores que se reasocian a KanMX4 con las secuencias CGTACTCCTGATGATGCATG y GACGAAATACGCGATCGCTG (181 pb), y (d) dos cebadores que hibridar con la secuencia de tipo salvaje del gen diana (Figura 4). (D) es importante porque aproximadamente el 8% de las cepas en las colecciones de deleción se sabe que contienen aneuploidía 14. Un transformante correcta debe ser positiva con (A) y con (B), y negativa (C) y (D).
  10. Para introducir unGMToolkit en el transformante, añadir aproximadamente 250.000 células de la cepa transformada y 250.000 células de cualquiera de RY0146 (que contiene GMToolkit-a) o RY0148 (que contiene GMToolkit-α) en un tubo de 1,6 ml Eppendorf. Vortex. Los genotipos de RY0146 y RY0148 son MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-His5] y MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], respectivamente. pr denota promotor. El número de células debe ser estimada a partir de la densidad óptica del cultivo precedente.
  11. Centrifugar a 800 xg durante 2 min.
  12. Eliminar el sobrenadante.
  13. Para permitir el intercambio de aire, hacer un agujero en la tapa usando una chincheta se trató con 70% de etanol.
  14. Añadir 50 l de medio YPDA (1% extracto de levadura, 2% de peptona, 2% de glucosa, y 0,003% hemisulfat adeninae). Vortex.
  15. Centrifugar a 800 xg durante 5 min.
  16. Colocar el tubo en una caja húmeda. Esto puede ser creado con una caja de punta vacío, un soporte de punta pequeña, y una toalla de papel húmeda.
  17. Incubar la caja durante la noche a 30 ° C.
  18. Seleccione diploides se aparearon por primera en estrías, las células en una placa CAA-Ura. Incubar la placa a 30 ° C durante un día.
  19. Tomando las células de la zona de mayor racha, a cabo para asegurarse colonias aisladas en placas de YPDA (1% extracto de levadura, 2% de peptona, 2% de glucosa, 0,003% hemisulfato de adenina, y 2% de agar) que contenían 200 ug / ml de G418 para la selección de diploides que contiene una o GMToolkit-100 ug / ml nourseotricina (Nat) 15 para la selección de diploides contienen GMToolkit-α.
  20. Incubar la placa a 30 ° C durante 3 días.
  21. A partir de una colonia aislada, transferir la mayor parte de las células a 500 l de medio de agar sin GNA (1% extracto de levadura, 3% de caldo nutriente Difco, y 5% de glucosa, la glucosa autoclave y el resto de tque los componentes por separado como 2 × soluciones para evitar la caramelización) en un tubo de cultivo de 5-ml con la tapa aflojada.
  22. Gire el tubo horizontalmente durante cinco horas a 30 ° C. El eje de la rotación debe ser paralelo al eje longitudinal del tubo.
  23. Confirmar que las colonias utilizadas en (1,21) son Ura + estriando a cabo en una placa CAA-Ura.
  24. Centrifugar el tubo a 800 xg durante 2 min. Eliminar el sobrenadante.
  25. Añadir 500 ul de medio de esporulación mínima (1% de acetato de potasio, 0,005% de acetato de zinc; filtro a esterilizar). Vortex.
  26. Centrifugar el tubo a 800 xg durante 2 min. Eliminar el sobrenadante.
  27. Repetir (1,25) - (1,26) dos veces.
  28. Añadir 1 ml de medio de esporulación mínimo suplementado con 7,5 mg / ml de lisina, 7,5 mg / ml de leucina, 5 mg / ml de histidina, 5 mg / ml de metionina, y 1,25 g / ml uracilo (para mejorar la tasa de esporulación de las cepas auxotróficas) . Vortex.
  29. Girar el tubo a temperatura ambiente durante un día.
  30. Girar el tubo a 30 ° C durante 2 días.
  31. Centrifugar 125 l de esta mezcla en un tubo de 1,6 ml Eppendorf-a 800 xg durante 2 min. Eliminar el sobrenadante.
  32. Añadir 50 l de solución de zimoliasa (100 mM tampón fosfato de sodio, pH 7,4, 1 M sorbitol, y 2 unidades de zimoliasa ZymoResearch). Mezclar pipeteando la solución dentro y fuera de una punta de pipeta.
  33. Incubar a 30 ° C durante 1 hr.
  34. Añadir 50 l de 0,02% de NP-40. Mezclar pipeteando la solución dentro y fuera de una punta de pipeta.
  35. Deje el tubo a temperatura ambiente durante cinco minutos.
  36. Añadir 500 ul de agua.
  37. Colocar el tubo en hielo.
  38. Sonicar esta mezcla dos veces en el ajuste de salida de 1 (débil ajuste) durante 15 segundos utilizando una micropunta de 3,2 mm con Sonifier 450 (Branson). Entre las dos rondas de tratamiento con ultrasonidos, poner el tubo en hielo para recuperar la temperatura de 0 ° C ~
  39. Centrifugar los tubos a 800 xg durante 5 min. Eliminar el sobrenadante.
  40. Añadir 200 l de SC-Ura-His(A) o SC-Ura-Leu (α) medio, dependiendo de si la cruz es para la incorporación de una o GMToolkit-α-GMToolkit. Para preparar el medio, hacer SC-Ura-His-Leu medio (0,67% de base nitrogenada de levadura, 2% de glucosa, 0,01% de arginina, 0,01% de ácido aspártico, ácido glutámico 0,01%, 0,01% de isoleucina, 0,01% de lisina, 0,01% de metionina , 0,01% de fenilalanina, 0,08% de serina, treonina 0,04%, 0,002% de tirosina, valina 0,03%, 0,0025% de adenina, 0,005% de triptófano, 0,003% de adenina, y 0,005% de triptófano) y lo complementan con histidina o leucina estéril antes de su uso para la concentración final de 0,01%.
  41. Hacer un agujero en la tapa usando una chincheta trató con 70% de etanol.
  42. Girar el tubo en posición horizontal a 30 º C durante 2 días. El eje de la rotación debe ser paralelo al eje longitudinal del tubo.
  43. Streak las células en una placa de agar SC-Ura-His o SC-Ura Leu-(los ingredientes y además: un 2% de agar, ácido aspártico y treonina debe ser añadido después de unutoclaving, añadir histidina y leucina antes de servir) para hacer colonias aisladas de las cepas ProMonster.

2. Ciclismo Sexual

  1. Girar un cultivo de una cepa de GFP supresión establecido en 100 l de SC-His (a) o SC-Leu (α) en función de tipo de apareamiento a 30 º C durante la noche usando un tubo de 1,6 ml Eppendorf. Para el intercambio de aire, hacer un agujero con un alfiler tratados con etanol al 70%. Gire el tubo horizontal. El eje de la rotación debe ser paralelo al eje longitudinal del tubo. Es posible cruzar a través de múltiples cepas de apareamiento en masa. Cuando una muestra según se usa directamente para este propósito, cultivar las células en 200 ul a 30 º C durante 2 días. Para preparar el medio, añadir uracilo (concentración final: 0,0025%) e histidina (0,01%) o leucina (0,01%) a SC-Ura-His-Leu medio.
  2. Mezclar 250.000 a-haploides y 250.000 células haploides α-células de supresión cepas GFP en un Eppe 1,6 mlndorf tubo. Vortex.
  3. Aparearse estas células por los siguientes pasos (1,11) - (1,17).
  4. Transferir 10 l de la mezcla a 500 apareamiento medio GNA l que contiene 200 mg / ml de G418 y 100 mg / ml Nat. en un tubo de cultivo de 5-ml con una tapa aflojada. La partida OD 600 es aproximadamente 0,1.
  5. Girar el cultivo a 30 ° C durante 24 hr. Esto permite la selección de diploides porque diploides sólo contiene tanto KanMX4 en GMToolkit-a y NatMX4 en GMToolkit-α puede crecer en presencia de G418 y Nat (Figura 3).
  6. Transferir 20 l de la cultura de un día y 500 l de GNA fresco que contiene G418 y NAT. La partida OD 600 es aproximadamente 0,2.
  7. Girar el tubo a 30 ° C durante 5 horas para llevar las células a la fase log (OD 600 de ~ 1).
  8. Siga los pasos (1,24) - (1,38) para esporular los diploides y aislar esporas.
  9. Dividir la suspensión de células esporuladas en dos 300-lpartes y poner cada uno en un aparte de 1,5 ml tubo Eppendorf.
  10. Centrifugar los tubos a 800 xg durante 5 min. Eliminar el sobrenadante.
  11. Para el sedimento de un tubo, añadir 100 ml de SC-Su medio para seleccionar una haploides. Para la pastilla del otro tubo, añadir 100 ml de SC-Leu medio para seleccionar α haploides.
  12. Gire los tubos a 30 ° C durante la noche. La final OD 600 debe ser inferior a 0,5. Si OD 600 tiende a ser demasiado alto, tratar el cultivo a temperatura ambiente.
  13. Para inducir la GFP, añadir 100 l de fresco SC-His (a) o SC-Leu (α) que contenía 20 mg / ml de doxiciclina. La concentración final de la doxiciclina es 10 mg / ml. Vortex.
  14. Girar los tubos a 30 ° C durante 2 días.

3. Citometría de Flujo

  1. Añadir 900 l de pre-filtrada tampón TE (pH 7,5) que contenía 10 mg / ml de doxiciclina a un tubo de polipropileno de 5-ml (BD Falcon # 352063) con la tapa intercambia con una célulacolador tapa de un tubo de poliestireno de 5-ml (BD Falcon # 352235). Tubos de polipropileno son adecuados para citometría de flujo. La tapa del colador se desea para eliminar partículas grandes.
  2. Coloque con cuidado 75 l de tampón TE con doxiciclina en la tapa de la celda-colador.
  3. Añadir 25 l de las células inducidas a la solución de la tapa.
  4. Mientras presiona la punta del Pipetman contra la malla, tirar toda la solución combinada a través del filtro.
  5. Presione hacia abajo la tapa del filtro y el tubo de vórtice.
  6. Preparar los tubos de recogida (1,6 ml tubos Eppendorf) llenos con 200 l de SC-His-Leu-o SC.
  7. Inicie el clasificador de células y ajustar la configuración de acuerdo con el manual del fabricante.
  8. Vortex tanto el tubo de recogida (para revestir la pared con el medio) y el tubo que contiene las células antes de cargarlos en el clasificador de células.
  9. Adquirir datos de citometría de flujo de la muestra. Una cepa no contiene GFP puede ser un control negativo.
  10. Dibuja puertas para la clasificación. (A)Para evitar que los agregados de células, lo que podría exhibir la intensidad GFP alta, descartar los valores extremos con un ancho de pulso desproporcionadamente grande para dispersión frontal (FSC) con una parcela de ancho de pulso y la altura del pulso para MoFlo clasificador o altura FSC desproporcionadamente pequeña con una parcela de altura FSC y FSC área para FACSAria clasificador (Figura 5, arriba a la izquierda del panel). (B) Dado que gran FSC (área) se espera para los agregados celulares, sólo tienen células en la parte baja del 20% en FSC, evitando al mismo tiempo las regiones con menor dispersión FSC y lateral (SSC) valores donde a menudo se encuentran los restos celulares (Figura 5, superior derecha del panel). (C) SSC (área) y la señal de GFP (área) a menudo se correlacionan positivamente. Porque simplemente tomando las más brillantes células dadas las puertas anteriores también se enriquecería por células con un alto valor SSC, dibujar una puerta a lo largo de la periferia de la población mediante un gráfico de la intensidad de las buenas prácticas agrarias y la cooperación Sur-Sur para tomar un porcentaje similar de los más brillantes de células de cada punto del eje SSC (Figura 5, Bottom-izquierda diagrama). La población seleccionada en (C) debe ser 0.1-1% de la población seleccionada en (B).
  11. Ordenar 200 células en el tubo de recogida dados los criterios de (3,10). Para un proceso en masa o para otros proyectos que requieren una población más complejos, ordenar más células según sea necesario.
  12. Vortex el tubo de recogida para cubrir las células clasificadas con el medio.
  13. Placa de un subconjunto de células (por ejemplo, 50 células) en una placa YPDA para la genotipificación.
  14. Incubar la placa a 30 ° C durante 2 días.
  15. Hacer un lisado durante ~ 12 colonias siguiendo los pasos (1,5) - (1,8).
  16. Transfiera las células residuales en la punta utilizada en (1,5) a un punto en un plato que contiene YPDA G418 y Nat tocando suavemente la placa con la punta. Haploides seleccionados no deben crecer en esta placa. Diploides puede tener más copias buenas prácticas agrarias y por lo tanto puede ser más brillante. Esta prueba puede mostrar la eficiencia de la selección haploide.
  17. Para la genotipificación, 1 l de analizar el lisado utilizando un 10-l PCR reaction con un cebador directo que hibrida con la región flanqueante aguas arriba de cada gen suprimido emparejado con un cebador de la secuencia CCTGAGAAAGCAACCTGACC.
    Multiplex PCR reacciones si es posible (condiciones se pueden determinar usando lisados ​​de mutantes individuales). PCR puede realizarse en un 96 - 384 o bien formato. Este último formato es adecuado para el volumen de reacción de tan poco como 5 l. Arraying de PCR mezclas de reacción que difieren en la adición de cebadores y lisados ​​de células a estas mezclas pueden ser llevadas a cabo utilizando una pipeta multicanal o un robot de manejo de líquidos. Tip cambios son opcionales cuando se añade el lisado mismo a diferentes mezclas de PCR.
  18. Analizar los productos de PCR. El sistema Gel XL Ultra V-2 electroforesis (Labnet) es compatible con la carga de la muestra utilizando pipetas multicanal.
  19. Basado en información de (3,16) y (3,18), identificar los haploides probables que han deseadas genotipos.
  20. Establecer estas cepas en un plato fresco (YPDA, CAA-Ura, o SC-Ura-His/Leu). Además, los congelan en25% de glicerol a -80 ° C. Las pruebas adicionales como confirmación de la ausencia de tipo salvaje secuencias de los genes suprimidos y de campo pulsado electroforesis en gel se recomienda.
  21. Repita el ciclo sexual de (2,1) con cepas útiles.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cuando una cepa haploide a-con cuatro supresiones marcadas GFP-(ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) se cruzó con una cepa haploide-α con cuatro supresiones (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), con dos deleciones (ycl033cΔ yer042wΔ) compartida por dos cepas, un representante resultado se obtuvo. La mezcla de apareamiento se cultivaron en medio YPDA contenía G418 y Nat para seleccionar los diploides. Los diploides resultantes se cultivaron en medio de esporulación. Las esporas se dispersaron por tratamiento zimoliasa y sonicación, y se germinaron en medio de selección haploides. Las células fueron inducidas a continuación, para expresar GFP. Uso de puertas con un citómetro de flujo, una población de células fue seleccionada que es poco probable que contienen agregados de desechos o de células (Figura 5). Dentro de esta población, la más brillante 1% de las células fueron ordenados. Las células clasificadas y no clasificadas células fueron genoescrito después de que se formaron colonias en una placa. Cuando las colonias seleccionadas al azar se sembraron en estrías sobre una placa de YPDA contenía G418 y Nat, las células de 2 de 16 colonias crecieron para la muestra sin clasificar, y células procedentes de 18 de 26 colonias crecieron para la muestra ordenados, lo que sugiere que algunos diploides ganó la capacidad para expresar un marcador de selección haploide y propagado durante las fases de selección y haploide-GFP-inducción en este experimento. Diploides se enriquecieron más en la muestra según presumiblemente debido a la mayor cantidad de GFP copia que contenían. Cuando haploides se analizaron con PCR, el número medio de deleciones en las células clasificadas era 5,1 ± 0,4 (n = 8; SEM se muestra). Cuatro de estas células tenían seis supresiones, el número máximo posible de deleciones para esta cruz. Haploides de la muestra no seleccionada tenía 3,4 ± 0,2 deleciones en promedio (n = 14).

En un experimento separado, una cepa haploide-una con siete marcadas GFP-deleciones (Yer042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) se cruzó con una cepa haploide α-viajaban ocho supresiones (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), con cuatro eliminaciones comunes (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) contenidos en las dos cepas. Cuando diploides fueron seleccionados y cultivados posteriormente en el medio de esporulación, aproximadamente el 20% de las células esporuladas basa en la observación microscópica (n> 100). Después de que las esporas se dispersaron y se germinaron, los haploides resultantes fueron inducidas para expresar GFP y ordenados en función de la fluorescencia como anteriormente. Sólo uno de 61 células seleccionadas al azar crecieron en una placa YPDA contenía G418 y Nat, lo que sugiere que las células según se haploides predominantemente. Cuando se analizaron con PCR (Figura 6), las células clasificadas tenía el número promedio de eliminación de 8,8 ±0,3 (n = 12; SEM mostrados), incluyendo cinco células que contienen diez deleciones. El número esperado de deleciones para una célula no seleccionada resultante de la segregación al azar era 7,5.

Figura 1
Figura 1. Monstruos verdes bajo el microscopio de fluorescencia. Micrografías muestran una cepa no mutante (izquierda), una cepa ProMonster (centro), y una cepa monstruo 16-GFP (derecha). Idéntico exposición, el brillo y el contraste se utiliza para las imágenes.

Figura 2
Figura 2. El esquema del proceso Monstruo Verde. Sola mutantes haploides (luz verde) se acoplan. Recombinación meiótica durante la esporulación de los diploides se aparearon genera una mezcla de 0-GFP células (de color blanco), 1-GFP células (luz verde), y 2-GFP células (verde oscuro). Flujocitometría se utiliza para seleccionar la más verde de células enriquecidas para las células GFP-2. Integrados herramientas moleculares permiten la selección de un haploides-(His +), α-haploides (Leu +) y diploides (G418 y Nat-resistencia). Este ciclo se repite para enriquecer para las cepas que llevan un número cada vez mayor de las alteraciones.

Figura 3
Figura 3. Cassettes GFP deleción y GMToolkits. Casetes GFP deleción contienen un gen reportero GFP y un marcador de transformación de levadura (URA3). El tetO 2 promotor es inducible por la adición de doxiciclina en el medio a través de la acción del factor de transcripción rtTA. Si el nivel de GFP alcanza la máxima capacidad de las células para hacer la proteína o de tolerar cualquier efecto tóxico de la misma, la expresión puede ser marcado por reducción de la concentración de doxiciclina (cuenta sin embargo que hizo no observar tal saturación o efectos de toxicidad incluso con 16 copias de GFP). Este casete se pueden dirigir a cualquier gen o región de unión específicos por secuencias homólogas utilizando PCR. Alternativamente, el cassette GFP supresión universal con idénticas secuencias homólogas pueden ser convenientemente dirigido a "pistas de aterrizaje" KanMX4 en cepas de la colección nocaut levadura. YFG denota su gen favorito. Caja con líneas verticales denota código de barras del ADN. GMToolkits se integran en el locus CAN1. El marcador de STE2-His5 y el marcador STE3-LEU2 se expresan de una manera específica en el tipo de apareamiento haploides para permitir sólo un haploides-para crecer en ausencia de histidina y sólo α haploides para crecer en ausencia de leucina, respectivamente. Seleccionando para resistencia a G418 y Nat se lo selecciona para el locus KanMX4 en una GMToolkit y el locus NatMX4 en el otro y, por tanto selecciona para diploides.

_content "fo: keep-together.within-page =" always "> Figura 4
Figura 4. Confirmación de la correcta integración del casete de GFP. Un casete de GFP universal se puede utilizar para convertir cualquier supresión KanMX4-marcadas disponibles en la colección de supresión de levadura a una deleción GFP-marcado. Con un alelo GFP supresión generado correctamente, la reacción de PCR con un cebador directo que hibrida con la región aguas arriba de acompañamiento emparejado con un cebador inverso que hibrida con el principio de la casete (PCR A del Paso 1,9) debe hacer una banda. PCR con un cebador inverso que hibrida en la región corriente abajo flanqueando emparejado con un cebador directo que hibrida con el extremo de la casete (PCR B) debe hacer un producto. PCR con dos cebadores que hibridan dentro de la casete KanMX4 (PCR C) o con dos cebadores que hibridan con la secuencia de tipo salvaje del gen diana (PCR D) no debe producir una banda. Red flecha denota un cebador de PCR. Bracmercado muestra una región amplificada con una reacción de PCR. Caja indica el cassette GFP (verde), el casete KanMX4 (amarillo), o su gen favorito (YFG, gris). Línea de color negro indica una secuencia de acompañamiento en un cromosoma de la levadura.

Figura 5
Figura 5. La citometría de flujo. En este experimento, la progenie haploide de un cruce de dos cepas, uno con el genotipo ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ y el otro con el genotipo ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ fueron inducidas para expresar GFP. Cada una deleción del gen tenían un cassette GFP. Por las células de activación periódica sobre la base del área de dispersión hacia adelante y la altura a la dispersión frontal (P1), los agregados de células (que tienden a tener desproporcionadamente gran área de dispersión hacia adelante fueron excluidos. Por las células de activación periódica sobre la base de dispersión hacia adelante y la dispersión lateral (P2), cells en la parte baja del 20% en dispersión frontal fueron aceptados, excluyendo los residuos con el menor dispersión frontal y dispersión lateral. Por las células de activación periódica sobre la base de dispersión lateral y la señal de GFP (P3), las células más fluorescentes entre los de una amplia dispersión lateral dado se tomaron. Para permitir la comparación de la mezcla meiótica y la muestra de control negativo que no expresa GFP, una puerta idéntica a la utilizada para la selección de la población P3 se muestra en un diagrama de las células de manera similar seleccionado del control negativo.

La figura 6
Figura 6. Genotipificación de las cepas según. PCR se realizó usando un cebador inverso que hibrida en la región corriente abajo flanqueando emparejado con un cebador directo que hibrida con el extremo de la casete. La presencia de banda indica la presencia de la casete de GFP. Un experimento por separado mostró que todo el con doce cepasmantener la supresión yer042w Δ y la supresión ykr011c Δ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

A medida que desarrollamos el enfoque Monstruo Verde, estábamos preocupados con la posibilidad de recombinación entre diferentes cassettes GFP reemplazo, lo que lleva a la reordenación del genoma. Mitigar contra de esta posibilidad es nuestra selección para las células que han superado con éxito múltiples rondas de apareamiento y la meiosis. Las células que llevan genomas reordenados se espera que sean menos aptos después del apareamiento con las células sin un reordenamiento idénticos. En efecto, no se observó ninguna inestabilidad del genoma resultante de la recombinación entre cassettes GFP 11. Sin embargo, no podemos excluir completamente esta posibilidad, por lo que se recomienda a los usuarios probar las tensiones generadas por reordenamiento. Electroforesis de campo pulsado en gel puede ser utilizado para detectar anormalidad bruto. PCR con los cebadores de hibridación a secuencias dentro de la deleción se pueden utilizar para confirmar la ausencia de secuencias de tipo salvaje.

Sobre la base de los niveles de fluorescencia de las cepas establecidos, GFIntensidad P tenía una relación casi lineal con el número de supresiones, lo que sugiere que la saturación no es un problema dentro de la gama probada de uno a 16 supresiones 11. Sin embargo, incluso en las rondas posteriores con las cepas con muchos deleciones que no se solapan, hemos sido capaces de sólo aumentar el número medio de deleciones en la población por aproximadamente dos en cada ronda, mientras que teóricamente una célula que lleva la unión de todas las deleciones en el parental dos cepas podrían combinar a la vez si rigurosidad perfecto para la selección de GFP se lograron. Una limitación es la variación de célula a célula de la intensidad de GFP entre células isogénicas. En el segundo ejemplo de resultados representativos, sólo el 0,8% de las células en la población se espera que tenga todas las 11 deleciones que eran posibles en esta cruz (cuatro de las 11 deleciones fueron compartidos por ambos parentales haploides). Sin embargo, los más abundantes de diez cepas de deleción tendrán una distribución de la intensidad de GFP que se solapa con la de la estra 11-supresiónins. Por lo tanto, una porción aún más pequeña de la población se debe seleccionar para seleccionar preferentemente 11-cepas de deleción de la cola superior de la distribución de intensidad de GFP de cepas de 11-de supresión. Una solución puede ser aumentar simplemente el umbral para ordenar más raras células con GFP intensidad más alta. Otra solución puede consistir en medir simultáneamente un patrón interno, un reportero proteína fluorescente de un color diferente que está presente en una sola copia, expresada a través de la misma tetO 2 promotor. Esta estrategia se espera que cancelar el ruido extrínseca para reducir la variación de célula a célula de mediciones de la intensidad de este modo normalizado GFP 16,17.

La dificultad de obtener raras múltiples mutantes puede ser exacerbada por la tasa de crecimiento potencialmente lento de estas cepas. Multi-mutantes se enriquecen mediante citometría de flujo, pero se pueden outcompeted durante el resto del proceso por el ajustador hermanos. Para minimizar el número de generacionescepas de levadura someterse, recomendamos pequeños volúmenes de cultivo que proporcionan amplificación justo suficiente de células de la ploidía deseado que se seleccionan en cada paso.

Debido a múltiples eliminaciones pueden ser adquiridos por ciclo, el método monstruo verde se puede utilizar para ensamblar múltiples mutantes más rápidamente que los métodos secuenciales 11. Si subconjuntos específicos de deleciones tienen relaciones sintéticas letales, 'extremos muertos' se pueden encontrar con los enfoques secuenciales. Esta limitación se puede evitar mediante el enfoque Monster Green, que se toman muestras del espacio de caminos posibles hacia la acumulación de todo el conjunto de deleciones. Cuanto más paralelo en versión masa del proceso de Monstruo Verde puede ser muy útil en la búsqueda de un camino para llegar al mayor número tolerable de eliminaciones.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Este trabajo fue apoyado por el contrato de EE.UU. Defense Advanced Research Projects Agency N66001-12-C-4039 a YS, una beca de la Fundación Alfred P. Sloan para RSL, y los EE.UU. Institutos Nacionales de Salud subvenciones R01 R21 CA130266 HG003224 y fue a FPRFPR también con el apoyo de una beca del Instituto Canadiense para la Investigación Avanzada y por la excelencia Canada Research Chairs programa.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics