Визуализация ангиогенеза путем микроскопии Multiphoton In Vivo в генетически модифицированных 3D-PLGA/nHAp эшафот подвздошную критических ремонта дефекта кости

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы представляем протокол для визуализации сосудов образование в естественных условиях и в режиме реального времени в 3D подмостей, multiphoton микроскопии. Ангиогенез в генетически модифицированных леса был изучен в мышиных подвздошную кость критический дефект модели. Больше новых кровеносных сосудов были обнаружены в группе лечения, чем в элементах управления.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Реконструкция критически размера костных дефектов остается серьезной проблемой клинической из-за плохой ангиогенеза в ткани инженерии леса во время ремонта, которая порождает отсутствие достаточных запасов крови и вызывает некроз новых тканей. Быстрое васкуляризации является жизненно важным условием для новой ткани выживания и интеграции с существующими ткани макроорганизма. De novo поколение сосудистую в лесов является одним из наиболее важных шагов в создании костной регенерации эффективнее, позволяя ремонта ткани расти в леске. Для решения этой проблемы, генетической модификации биоматериала лески используется для ускорения ангиогенеза и Остеогенез. Однако визуализации и отслеживания в естественных условиях формирование кровеносных сосудов в режиме реального времени и в трехмерном (3D) леса или новой костной ткани по-прежнему является препятствием для строительства костной ткани. Multiphoton микроскопии (MPM) является роман модальности био изображений, который может приобрести объемные данные из биологических структур с высоким разрешением и минимально инвазивная образом. Целью данного исследования было визуализировать ангиогенеза с multiphoton микроскопии в естественных условиях в генетически модифицированных 3D-PLGA/nHAp леску для ремонта подвздошную кость критический дефект. PLGA/nHAp леса были функционализированных для устойчивой доставки гена фактора роста pdgf-b , перевозящих лентивирусные векторы (LV -pdgfb) с целью облегчения ангиогенеза и укреплению костной регенерации. В имплантированных эшафот подвздошную кость критических дефектов модель мыши, области кровеносный сосуд (BVAs) в PHp леса были значительно выше, чем в PH подмостей. Кроме того выражение по ангиогенез связанных генов, vWF и VEGFR2и pdgf-b увеличилось соответственно. MicroCT анализ показал, что новые формирования костей в группе PHp значительно улучшились по сравнению с другими группами. Насколько нам известно это первый раз, multiphoton микроскопии был использован в костной ткани Инжиниринг расследовать ангиогенеза в 3D эшафот био разложению в естественных условиях и в режиме реального времени.

Introduction

Кости является весьма васкуляризированной ткани, которая продолжает переделывать во время существования отдельных1. Быстрое и эффективное костной регенерации больших костных дефектов в результате травмы, исправления, резекции опухоли или черепно-лицевых аномалий это сложный физиологический процесс. Традиционные терапевтические подходы, используемые для ремонта дефектов костей включают аутотрансплантатом и аллотрансплантата имплантации, но их использование предполагает некоторые проблемы и ограничения, такие, как ограниченная доступность, значительных доноров сайте заболеваемости, высокий риск инфекции, и размещать иммунной отклонение2,3. Однако искусственные костных имплантатов предлагают эффективную альтернативу для смягчения этих ограничений. Они могут быть сделаны из биоразлагаемых материалов, легко изготовить с подходящей поры и может быть генетически модифицированных4,5.

В настоящее время были использованы различные ткани инженерные строительные леса в развитии костной ткани инженерии6,7. Чтобы побудить кости ремонт и восстановление более эффективно, инженерии биоматериалов, в сочетании с факторами роста возникли и достигнутые хорошие результаты8,9. К сожалению короткий период полураспада, легко потерять активности и дозировка supraphysiological факторов роста для терапевтической эффективности ограничить их клинические приложения10. Для преодоления этих проблем, была продемонстрирована доставки генов факторов роста вместо факторы роста как эффективный подход для поддержания препараты для лечения костных дефектов и болезней11,12. Вирусных векторов являются перспективными доставки инструменты для регенерации тканей из-за их высокой, выражая эффективности13.

Среди факторов роста в этом исследовании был выбран тромбоцитарный фактор роста (PDGF-BB), потому что это не только Митоген и хемотаксического мезенхимальных и Остеогенные клетки, но и стимулятор по ангиогенез14,15 . Предыдущие доклинические и клинические исследования показали, что PDGF-BB может безопасно и эффективно содействовать кости ремонт в пародонтальных дефектов костной16,17. Недавние исследования показали, что PDGF-BB стимулирует ангиогенез, мотивирующих эндотелиальных клеток миграции и пролиферации в vivo18,19. Кроме того PDGF-BB, также могут оказывать способны дифференцироваться в эндотелиальных клеток20и это далее подчеркивается потенциальной роли MSCs в неоваскуляризации при мезенхимальных стволовых клеток (МСК). Таким образом вызывая образование de novo сосудистую в леса с PDGF BB является важным шагом для ремонта ткани, превратилась в леса в кости тканевой инженерии.

Исцеление дефекта кости является динамической ткани морфогенетических процесс, который требует скоординированных остеогенез и ангиогенез на ремонт позиции21. Neoangiogenesis в имплантированных ткани инженерии леса является необходимым предварительным условием для питания клеток питательными веществами и кислородом для роста и выживания и для удаления метаболические отходы. Часто используемые методы обработки изображений, включая рентгеновские микро вычисляемые (microCT) томография, магнитно-резонансная томография (МРТ), растровая электронная микроскопия (SEM), оптическая когерентная томография (Окт) и Конфокальная лазерная сканирующая микроскопия, применяются вместо Гистологическое исследование для получения ангиогенеза информации22,23. Однако эти методы сталкиваются с различными препятствиями в визуализации и измерения это в 3D леса в кости тканевой инженерии. Multiphoton микроскопии (MPM) является сравнительно новым био изображения метод, который имеет явное преимущество одновременно визуализировать клетки, внеклеточная матрица, и окружающие сосудистой сети в vivo. Он обладает имманентной трехмерных изображений возможности для проникновения глубоких тканей и вызывает низкий фотоповреждения. Таким образом в течение последнего десятилетия, MPM привлекла много внимания в биомедицинские исследования24, в том числе в неврологии, иммунологии и динамики стволовых клеток. Однако это едва используется в ортопедических исследований.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Уход за животными был в соответствии с руководство по уходу и использованию лабораторных животных провинции Гуандун. Все процедуры были проведены под наблюдением и одобрения Комитета по этике для животных исследований, Шэньчжэнь институты передовых технологий, Китайская академия наук.

1. лентивирусные (LV) производства

  1. клонов cDNA pdgf-b в вектор лентивирусные выражение (pLenti6/5-eGFP или LV-eGFP) на пользовательских несколько Клонирование сайт вниз по течению промотора цитомегаловирус, используя Spe я и Сал Я места ограничения для построения pLenti6/5-PDGFB-eGFP плазмида (LV - pdgfb) 25.
  2. ГЭС - 293 FT клетки производят лентивирусные частиц (LV - pdgfb), совместно transfecting с вирусом упаковки плазмид (pLP1, pLP2 и pVSV-G) с помощью метода стандартного фосфата кальция с хлорохином (конечная концентрация: 25 мкм) 25.
  3. после 48 ч трансфекции, урожай и фильтровать 500 мл, содержащих вирус супернатанта с фильтром (0,45 мкм). Впоследствии, концентрата вирусных частиц ultracentrifugation на 89000 x g для 2 h. Ресуспензируйте в 200 мкл фосфат амортизированное saline (PBS), аликвота и хранить на -80 ° C.
  4. Для определения титра антител человека, инкубировать HEK293T клетки с серийно разбавленный раствор лентивирусные за 24 часа и рассчитать лентивирусные титр, как описано выше 25.

2. Изготовление 3D-печати PLGA/nHAp подмостей и LV иммобилизации

материал
  1. растворяют 20 g PLGA (поли-D, L-лактида co гликолидных) в 20 мл 1,4-диоксан сформировать однородный раствор. Добавить 2 g наноразмерных порошковых HAp (нано hydroxyapatide) (nHAp) в решение; PLGA: nHAp соотношение должно быть 10:1 (w/w).
  2. Размешивать энергично смешанного решения (перемешивания скорость: 1500 об/мин) при комнатной температуре для 16 h, с помощью магнитной мешалкой для формирования единой пасты. Изготовить его в пористых PLGA/nHAp строительные леса с помощью 3D принтер низкотемпературные с компьютеризированной сопла, что депозиты пасты слой за слоем, снизу вверх, по словам готовую модель 26; размеры пор подмости в диапазоне от 200 до 400 мкм.
  3. Вакуумный freeze-dry леса в течение 48 часов, чтобы как можно скорее полностью удалить растворителем. Замочите подмости в 75% этанола раствор для 1 h для стерилизации и lyophilize получить нейтральной, асептических подмостей.
    Примечание: Основные параметры для вакуума для включают конденсации температуры (° C) и степень вакуума (Pa). Вакуумные степень 45 ПА, PLGA/nHAp леса были вакуум, Сублимированные замораживанием при-78 ° C в течение 48 часов для тщательного удаления растворителя.
  4. Добавить 10 мкл LV частиц (4,5 x 10 5) для каждого PLGA/nHAp эшафот (4 x 4 x 2 мм) и инкубировать подмости для 2 ч при 37 ° C в увлажненные инкубатор, чтобы позволить адсорбции и.
  5. После иммобилизации, промойте подмости дважды с PBS для удаления несвязанных LV частиц. Snap заморозить покрытием частиц подмости LV в жидком азоте, lyophilize снова и хранить при температуре-80 ° C для использования в будущем.

3. В пробирке Кинетика LV частиц освобождения от леса и LV трансдукции деятельности пробирного

  1. инкубировать 3D подмостей (4 x 4 x 2 мм) проведение LV-Зеленый флуоресцентный белок (LV-eGFP, 4.5 x 10 5 LV частицы) в 1 мл полного DMEM 2.0 мл криогенных флаконов при 37 ° C с встряхивания в течение 5 дней.
  2. Взять образец 1 мл каждые 12 ч от 12 h до 120 h после инкубации и заменить среды. В каждый момент времени, добавьте 1 mL свежих средних вместо 1 мл среды инкубации.
  3. Использовать собранные средства массовой информации передавать HEK293T клетки путем совместного инкубации за 48 ч. мера количество биоактивных LV частиц, определяя количество HEK293T GFP-положительных клеток путем потока цитометрии 27.
    1. До преобразователя HEK293T клетки, удалите питательной среды и промыть HEK293T клетки дважды с PBS. Добавление собранных средств массовой информации, содержащие Лентивирусы освобожден от подмости хорошо (1 мл/а) и культуры с HEK293T клеток для 48 ч при 37 ° C в увлажненные инкубатора.

4. В пробирке Оценка миграции костного мозга, полученных MSC (BMSC)

  1. перед assay переноса, подготовить BMSCs, выражая томатный флуоресцентный белок (BMSCs-T) и PDGF-BB белков (BMSCs-P) 28.
  2. Выполнения BMSC assay переноса с камерой Бойден, используя 24-ну пластины и фильтры из поликарбоната с порами размером 8 мкм.
    1. Место 0,5 мл BMSCs transfected (5 x 10-4) с LV, выражая томатный флуоресцентный белок (BMSCs-T) в верхних палатах. Место 0,5 мл BMSCs (2 x 10 5) transfected с LV, выражая PDGF-BB белков (BMSCs-P) в нижних камерах.
  3. Включают в себя шесть групп в этом эксперименте и 500 мкл нижнии отсек каждой скважины.
    А. бланк контроля, сыворотка бесплатно средний только
    B. FBS управления, средний с 10% FBS
    управления C. PDGF-BB, 4 нг/мл PDGF-BB в среде, свободной от сыворотки
    D. PDGF-BB захватить группы, PDGF-BB (4 нг/мл) и Поликлональные антитела анти PDGF-BB (4 нг/мл) в Сыворотка бесплатно среднего
    E. BMSC группа, 2 x 10 5 BMSCs в среде, свободной от сыворотки
    Группа F. BMSCs-P, 2 x 10 5 BMSCs-P в свободной среде сыворотки.
  4. Инкубируйте 48 ч в 5% CO 2 и 37 ° C в увлажненные инкубатора. После этого, удалите перенесенные клетки на нижней стороне камеры и собрать их для количественной оценки числа BMSCs-T подачей cytometry.
    1. Удалить перенесенные клетки на нижней палаты стороне с помощью скребка клетки и Ресуспензируйте миграции клеток с 2 мл ФСБ. Подсчитать количество перенесенных BMSCs-T потока цитометрии 29.

5. Создание мышиных подвздошную критических модель дефекта кости и леска трансплантации

Примечание: мужской BALB/c мышей (7 недель) были приобретены от Гуандун лабораторных животных медицинский центр (Гуандун, Китай).

Эксперимент
  1. Заявка в общей сложности 42 самцов мышей для дефекта подвздошную кость. Случайным образом разделить мышей на три группы, четырнадцать в каждой группе, которые получают следующие виды лечения: Группа A, без имплантатов; Группа B, PH подмостей имплантированных (PLGA/nHAp); и группы C, PHp подмостей имплантированных (PLGA/nHAp/LV-pdgfb).
  2. Анестезировать животных с администрацией внутрибрюшинного Пентобарбитал натрия (50 мг/кг). Удалить меха депиляционный пастой и чистой кожи головы с 75% спиртовой раствор прежде чем сделать первый разрез. Исправить руководитель каждой мыши с помощью стереотаксической инструмента держать его еще во время операции.
  3. Первоначальный надрезают с помощью скальпеля и затем увеличить его острословияh ножницы для создания линейный разрез 1-см. Скрип надкостницы от кости черепа раскрыть поверхности костей черепа с помощью стерильного ватного тампона.
  4. Для создания критического размера дефекта 4 мм в диаметре на левой стороне Кальвария 30
  5. использовать трепаном заусенцев. Пересадить эшафот в сайт дефекта кости.
    Примечание: Критический размер дефектов (ЦСО) первоначально были определены как " наименьший размер внутрикостной ранение в частности кости и видов животных, которые не исцелит спонтанно во время существования животного. " в этом эксперименте, 4 мм в диаметре дефекта Это критический размер дефекта кости, согласно ранее исследования , 31- 32.
  6. Использовать пинцет глазной вернуться надкостницы мягко освещать хирургической сайта. Шовные резаная кожи с трех строчек на см.
  7. Выполнять послеоперационное ухода. Администрировать болеутоляющее бупренорфин (0,1 мг/кг) для облегчения боли. Поддерживать температуру тела с грелку, до тех пор, пока животное просыпается. Впоследствии кормить животных с пищей и водой и записывать их деятельность каждый день до конца испытания. Примечание: Обезболивание может проводиться до процедуры в зависимости от вашего Комитета руководящие принципы местных животных ухода.

6. В естественных условиях Визуализационная диагностика ангиогенеза в дефект кости с MPM

Примечание: конъюгированных FITC 250 кд декстрана (10 мг/мл) в солевых внутривенно вводили мышей для получения высокой SNR (отношение сигнал шум) изображения новых кровеносных сосудов по словам предыдущего исследования 33. Пожалуйста, обратите внимание, что это процедура выживания.

  1. собрать multiphoton микроскопии (MPM) системы возбужденных флуоресценции двух фотонов (TPEF) и второй гармоники поколения сигнала (SHG) томографии.
  2. Обезболивают животных с внутрибрюшинного введения Пентобарбитал натрия (50 мг/кг) и иммобилизации животных на нагревательной пластинки для поддержания их тела температуры при 37 ° C на протяжении экспериментов. Используйте 3,0% изофлюрановая газ в 100% кислорода для поддержания удовлетворительного анестезия и анальгезия при визуализации процесса. Внутрибрюшинно придать физраствора (200 мкл/животное) для предотвращения обезвоживания организма до изображений.
  3. Мелодия Фемтосекундный Ti-сапфирового лазера до 860 нм. Создать зону 512 x 512 мкм выборки путем сканирования пару гальво зеркал и использовать NA1.0 погружения в воду объектива до focusthe луча возбуждения в выборку и собирать рассеяния сигнал TPEF/ГСП.
    Примечание: Изображения была выполнена на дом-multiphoton микроскопических изображений системы построения (MPM). Во время визуализации, Ti-Сапфир фемтосекундный лазер был настроен до 860 нм как оптимальный возбуждения волны. Лазерный луч был растрового сканирования через плоскость образца, используя пару зеркал гальванометра. После прохождения через дихроичное зеркало 685 Нм, луч было сосредоточено на образца 20 X NA1.0 цели. Индуцированная сигналов TPEF и SHG были собраны по той же цели. Сигналы были разделены от лазерного возбуждения дихроичное зеркало упомянутых выше и очищается фильтром короткий перевал 680 нм. Сигналы TPEF и SHG были собраны в пучок волокон и для спектрографа. Детектор-на спектрограф был линейный массив фотоэлектронный умножитель труб (PMT). Сочетание спектрограф и линейный массив ПМЦ предложил возможность записывать сигнал в 16 последовательных диапазонах от 400 Нм до 600 Нм, интервалы 12,5 Нм. Таким образом сигналы TPEF и SHG были обнаружены в то же время и отделены в спектральных областях. Кроме того для 3D визуализации, осевой двигатель был использован для управления глубиной визуализации. Площадь каждого изображения было равным 512 x 512 мкм, и был установлен интервал глубины до 2 мкм (контрольной группы, 5 мкм). В частности, 5 сайтов на каждого дефекта были образы для сбора статистически значимые данные, и выбранных изображений сайты были распределены равномерно и случайно вдоль дефект.
  4. Сканирования 5 сайтов на каждого дефекта для сбора статистически значимые данные для измерения формирования судна.
    1. Использование сканирования сайтов и случайно равномерно распределены вдоль дефекта. Для группы управления, имеют области просмотра (ПЗ) крышка первоначальной площади кости и края дефекта, но для рН и PHp групп, имеют ПЗ на имплантированный эшафот.
    2. Сделать 1 см линейный разрез с помощью скальпеля и шовные открытой кожи для фиксации раскрыть узел трансплантации. Чтобы поместить каплю воды между погружения объектива и пересадке сформировать стакан воды использовать шприц.
  5. Получить изображение суммируется каждые 12 s над 2 h изображений период. Отображать и анализировать объемных данных с помощью пользовательской программы MATLAB и количественного определения области кровеносный сосуд с ImageJ программного обеспечения 34 , 35.

7. Анализ выражения геном pdgf-b и ангиогенез связанных генов RT-ПЦР

Примечание: ПЦР была выполнена после обычных шагов: 95 ° C за 30 сек, 40 циклов 95 ° c за 5 s и 60 ° C за 30 с. пост-ПЦР плавления кривые подтвердил специфичность одной цели усиления, и складки изменения гена интереса по отношению к β-актина был определен. Реакция для каждой выборки был испытан в три раза.

  1. Урожай имплантированных подмостей и тканей от экспериментальных мышей на 2, 4 и 8 недель после операции 36; контроль образцов группы (n = 4), принятым на тех же точках времени, должен быть из прилегающих костной ткани.
    Примечание: В каждый момент времени (2, 4 и 8 недель), умерщвлены мышей с CO 2 ингаляции. Вскрыть Кальвария и, впоследствии, удалить и урожай имплантированных подмости от Кальвария.
  2. Использовать коммерческие реагент для извлечения всего РНК из каждого образца, по словам производителя ' протокол s. Использование обратной транскрипции Кит обратить вспять-транскрибировать РНК в cDNA после производитель ' протокол s.
  3. Выполнять Количественная ПЦР в реальном времени с помощью системы обнаружения зеленый SYBR; праймеры, перечислены в таблице 1.
Primer(5'–3')
гена вперед обратный
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA АГ TCCATGCTGGTCACTAACAGAA G
β-актина GTATCCATGAAATAAGTGGTTAC общ ЦААТ GCAGTACATAATTTACACAGAAG

Таблица 1: наборы Pimer.

8. MicroCT анализ костной регенерации

  1. Euthanize мышей с CO 2 ингаляции в 8 недель после операции. В хорошо проветриваемом помещении, осторожно поместите каждую мышь в клетку чистой мыши и перекачивать газ CO 2 в клетке обезболивают мышей до эвтаназии.
  2. Вскрыть черепа для изображений microCT региона дефекта кости. Пользователь следующие параметры в экспериментах сканирования: 9 мкм резолюции, Аль фильтр 0,5 мм, напряжение 50 кв и 142 МКА текущей.
  3. РеконСтруктура всех визуализации данных с использованием коммерческого программного обеспечения предоставляемых компанией. Калибровка сканирования, используя функцию калибровки программного обеспечения CTAn.
    Примечание: Место Блок Hounsfield (Ху) под мышей в каждом сканирования.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Цилиндрические пористых PLGA/nHAp помостами 0,6 мм в высоту и 4 мм в диаметре были сфабрикованы с 3D-принтер. Морфологии подмости были проанализированы с помощью сканирующей электронной микроскопии и microCT. Рисунок 1A показывает фотографию имплантированных эшафот. MicroCT сканирование показал, что более 85% поры имеют размеры от 200 до 400 мкм (Рисунок 1B). SEM изображений показал, что поверхность леска грубой микротопографии, с микропоры (диаметром около 5-10 мкм), которые соединены внутри леса (рис. 1 D-F). Примерно 40% от общей суммы покрытой LV-eGFP частиц (4,5 x 105) освобождены от PLGA/nHAp подмостей, начал с эффектом первоначальный всплеск в течение 24 ч. Биологическую выпустила LV вирусов достиг 24 h на саммите и затем непрерывно уменьшается, приближается к 0 в 120 h (рис. 2). Эти данные указывают, что отпорности наиболее эшафот иммобилизованных LV частиц может поддерживаться до 96 часов. Потенциал миграции MSCs-T было отмечено с методом СУИМ расследовать ли LV, перевозящих cDNA pdgf-b может выразить и привести к BMSC хемотаксис, как показано в Рисунок 3. Положительный контроль (C) и PDGF-BB-выражая группы (F) выставлены значительно более высокий уровень миграции BMSC чем другие 4 группы. Кроме того миграция BMSCs в группе F был значительно выше, чем в группе с. Существовали никаких существенных различий в BMSC миграции среди других групп, 4.

От 2 до 8 недели после вживления ангиогенеза в костный дефект был оценен MPM сканирования. На рисунке 4A показывает схематическое изображение мыши под MPM сканирования. Очевидные ангиогенеза был обнаружен в группах PH и PHp, но кровеносные сосуды были едва наблюдаемых в контрольной группе, где только слой фиброзной мембраны во всем регионе дефекта формируется (рис. 4В). GIF графики показывают кровеносного сосуда томографы каждой группы (Дополнительные данные). Площадь новых кровеносных сосудов постепенно увеличивается с течением времени в группах PH и PHp, с аналогичными все шаблоны. На 8 неделе судов появился аналогичны в морфологии наблюдается на ранней стадии; Единственное изменение было, что все большее число небольших судов растет в леса (Рисунок 4B). BVA группе PHp был значительно выше, чем, что из двух других групп все время точек (рис. 4 c). Кроме того было много сайтов осаждения коллагена, как указано SHG сигналов (зеленый цвет диаграмм и графиков GIF) в группах PH и PHp, но не в группе контроля (рис. 4В).

Для того, чтобы уточнить взаимосвязь PDGF-BB выражения и ангиогенез, мы сравнили уровни выражения гена Стенограмма pdgf-b, vWFи VEGFR2 с методом RT-ПЦР на 2, 4 и 8 недель после имплантации ( Рисунок 5). Как и ожидалось, pdgf-b выражение был значительно увеличен в группе PHp на все моменты времени, с 5 - 13 раз больше, по сравнению с управления и PH групп (Рисунок 5A). Без значимого различия между группой PH и управления, и уровень экспрессии PDGF-BB практически остается неизменным от недели 2 недели 8, как показано на рисунке 5А. Выражение уровни mRNA vWF и VEGFR2 во всех трех группах постепенно увеличивается и время были самыми высокими в группе PHp на всех трех точек (Рисунок 5B и 5 C). Для группы PH был без статистической значимости, по сравнению с контрольной группой, несмотря на очевидные ангиогенез (рис. 4В).

Для дальнейшего подтверждения, что pdgf-b-содержащих подмостей содействовать костной регенерации в естественных условиях используя критически размера черепа дефекты в самцов мышей BALB/c, microCT сканирование представил информацию для оценки костной регенерации на 8 недель после имплантации. Как показано на рисунке 6, дефекты в группе PHp были заполнены с массой новых врастания костной ткани в леса, в то время как существует гораздо меньше новой кости в области контроля и PH групп.

Figure 1
Рисунок 1: структурная характеристика 3D PLGA/nHAp эшафот. (A) фотография 3D печатной леску. (B) microCT изображения общей пористости эшафот. (C) микротопографии поверхности леску под наблюдением SEM в 60 X 2000 X (D), 5000 X (E) и 10 000 X увеличение (F). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: подготовка человека и оценки отпорности частиц LV-GFP. (A) схематическое представление лентивирусные векторной конструкции. После 48 ч трансфекции ГЭС - 293FT клетки были замечены в свет (B) и флуоресценции поле (C) условиях. (D) в vitro оценки отпорности LV-GFP частиц, совокупно освобожден от PLGA/nHAp подмостей. Все данные представлены как среднее ± SEM (n = 4). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3. Биологическую PDGF-BB как ответ мощным эозинофилов фактором миграции BMSC. BMSCs-T (5 x 10-4) были посеяны на вершине transwell камер, с различными средствами массовой информации состояния в нижней части камеры. (A) пустой элемент управления, сыворотка бесплатно средний только; FBS (B) контроля, средний с 10% FBS; (C) PDGF-BB управления, 4 нг/мл PDGF-BB в сыворотки свободной среде; (D) PDGF-BB захватить группы, PDGF-BB (4 нг/мл) и Поликлональные антитела анти PDGF-BB (4 нг/мл) в среде, свободной от сыворотки; (E) BMSCs, группа, 2 x 105 BMSCs в сыворотке бесплатно среде; и (F) BMSCs-P группа, 2 x 105 BMSCs-P в среде, свободной от сыворотки. Все данные отображаются как среднее ± SEM (n = 4). #: сравнение между группой C и всех других групп, за исключением группы F, # p < 0,0001. *: сравнение между группой F и все другие группы, * p < 0,05, *** p < 0,0001. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: Изображения с высоким разрешением Multiphoton микроскопии (ГСП/TPEF) и количественная оценка ангиогенеза в регионе дефекта кости Кальвария мыши.trong > схематическая иллюстрация (A) A мыши под MPM сканирования. Оранжевый круг представляет сайт дефекта, красный трубочки представляют кровеносных сосудов, и зеленый представляет коллагена. (B) Unoperated и эксплуатируемых животных были отсканированы с MPM на 8 недель после имплантации. ГСП, TPEF, ГСП/TPEF объединены, и 3D-изображения отображаются. Пунктирная линия представляет собой границу вдоль дефект кости в группе управления, основанный на ГСП сигналов. (C) кровеносного сосуда области количественной оценки в зоне дефекта контроля, рН и PHp от 2 недели в неделю 8 после имплантации. Все данные отображаются как среднее ± SEM (n = 5). : Статистический анализ между группами PH и PHp, p < 0,0001. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: RT-ПЦР анализ по ангиогенез связанных генов vWF (B) и pdgf-b (A) и VEGRF2 (C) выражение в трех группах. Были проанализированы образцы из 4 животных для каждой точки времени. #: сравнение между группами PHp и рН, # p < 0,05, # p < 0.01, а #p < 0,0001. *: сравнение между PHp и управления группами, * p < 0,05, ** p < 0.01, и *** p < 0,0001. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: Оценка в естественных условиях формирования костей с MicroCT сканирования. Контрольной группы без имплантированных подмостей. Группа PH в пределах имплантированных PLGA/nHAp эшафот только. Группа PHp в пределах имплантированных PLGA/nHAp эшафот, изменена LV- pdgfb частиц. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Кости является весьма васкуляризированной ткани с уникальной способностью постоянно исцелить и переделывать на протяжении всей жизни отдельных1. Уровень васкуляризации имеет важное значение для ремонта остеогенез и дефект. Низкая васкуляризации ограничивает широкое клиническое применение тканей инженерии костей. Создание высоко васкуляризированной костной ткани инженерии согласно теории биомиметики стала инструментом для ремонта дефектов костей большого сегмента. Различные виды лесов были успешно применяется для ремонта сравнительно небольших костных дефектов. Однако для критических костных дефектов, применение строительных лесов для ремонта по-прежнему сталкивается препятствий, главным образом из-за недостаточно крови поставок для ремонта дефектов. Таким образом улучшение кровоснабжения в процессе ремонта больших костных дефектов является одним из основных вопросов в тканевой инженерии.

Люди используют Биоактивный материал покрытием лесов, чтобы помочь установить необходимые морфогенетических поля, которые могут стимулировать, набора и продвижения хемотаксис, дифференциации и пролиферации клеток, необходимых для формирования это и кости 37. это в ткани инженерии лесов имеет важное значение для клеток для получения кислорода и питательных веществ, для удаления отходов и в конечном счете для выполнения функции лесов. Цели этого исследования были расследовать ангиогенеза с в vivo multiphoton микроскопии в генетически модифицированных, 3D-печати PLGA/nHAp леску для ремонта дефекта черепа критических костных и оценить последствия использования регенерации костной ткани microCT.

Несмотря на драматические достижения в кости тканевой инженерии, в vivo визуализации и количественной оценки неоваскуляризация в леса во время костной регенерации по-прежнему является проблемой. Наиболее микроскопических изображений системы не способны обеспечить объемную информацию по ангиогенез. Традиционные методы изображений, например microCT, МРТ и гистологические анализы, разрушительной, сложным и трудоемким и низкого пространственного разрешения и длинные изображения приобретение раз38. MPM изображений то, что роман модальности био изображений, которые могут захватить кровеносный сосуд сигналов в vivo с высоким разрешением и минимально инвазивной образом. Он способен обнаружить новые сосуды тоньше, чем 10 мкм (рис. 4В). Помимо изображений кровеносный сосуд мы также наблюдали массу нового коллагена осаждения (зеленый цвет в рисунке 4В) и GIF графиков в дополнительном материале, как указано SHG сигналы, которые указывают на образование костной ткани под другим углом зрения. Теоретически могут быть получены изображения сосудов без использования контрастного вещества. Однако в настоящем исследовании, мы использовали контрастного вещества для получения лучшего изображения и удаляются местные кожные обеспечить надлежащую глубину сканирования. Это было бы ненужным, когда более мощных систем тепловидения доступны в будущем действительно неинвазивной визуализации.

ЛПГ является биомедицинских материалов для костной регенерации тканей, которая широко используется из-за его хорошей osteoconduction и osteoinduction черты. ЛПГ имеет хорошие возможности привязки ДНК векторов и сохраняя и стабилизации векторов, включая вирусных векторов39. По сравнению с миниатюрные HAp, наноразмерных частиц HAp обладают высокой конкретных областях поверхности и таким образом показать лучше сотовой поведение и механических свойств40. По этим причинам nHAp частицы являются одним из компонентов подмостей. Поверхности и поперечного сечения изображения SEM PLGA/nHAp эшафот, показанный на рисунке 1 показывает, что сфабрикованные подмости exhibit хорошо взаимосвязанных пористую структуру и размеры равномерно распределенными порами. Иммобилизация вируса на биоматериала перевозчиков могут влиять на активность вируса. Таким образом мы протестировали отпорности LV частицы освобожден от подмости исследуя их трансфекции деятельности. Релиз профили LV частиц из леса и их bioactivities были оцененные в пробирке, демонстрируя контролируемые поставки биологически активных частиц LV за пять дней (рис. 2). Кроме того наши в vitro исследования сосредоточены на потенциал PDGF-BB стимулировать миграцию первичных MSCs. Эти результаты показывают, что частицы LV выразил биоактивные PDGF-BB и эффективно стимулировали BMSC миграции.

Для подтверждения возможности по ангиогенез и костной регенерации в естественных условиях, PHp леса были имплантированы в мышиных подвздошную критических костных дефектов. Формирование судно было подтверждено ангиогенных маркеров, RT-ПЦР анализа и плотностью кровеносных сосудов наблюдается с ГСП/TPEF изображений. Оба из этих двух наборов экспериментов показал, что ангиогенез и формирование кровеносных сосудов были значительно улучшилось с лечением генетически модифицированных строительных лесов. Эти результаты показывают, что PDGF-BB не только непосредственно стимулирует ангиогенез, но также побуждает других генов, связанных с ангиогенеза. Между тем, microCT измерения продемонстрировать что pdgf-b-содержащих лесов значительно способствовали формирования костей, по сравнению с неизмененной подмости, который хорошо коррелирует с это в эшафот. Эти результаты показывают, что генетически модифицированные, биоактивных лесов значительно улучшить ангиогенеза и регенерации тканей.

Представленные здесь результаты демонстрируют, что человека опосредованной генетической модификации подмостей облегчает ремонт больших костных дефектов в мышиных подвздошную кость критический дефект модели, вероятно через улучшение ангиогенеза. Кроме того в естественных условиях MPM изображений обеспечивает уникальный инструмент понять ангиогенеза и остеогенез в кости помостами и позволяет дальнейшее выяснение ли определенные леску выгодно неоваскуляризации. Multiphoton прижизненной микроскопии изображений обеспечивает механизм для понимания физиологии и патофизиологии ангиогенеза в тканях и подмости. Однако существует несколько ограничений, при использовании этого метода. Во-первых хирургические подготовка требует определенного опыта. Воспаление, вызванное неквалифицированных операции значительно уменьшит MPM, качественное изображение. Во-вторых благодаря MPM изображений ограничения скорости, мышь специально разработанный держатель необходим для снижения артефактов, вызванных пульса и дыхания. В-третьих для долгосрочного изображений, животных должны быть внутрибрюшинно или внутривенно вводят физиологического раствора для предотвращения обезвоживания организма.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что они не имеют никаких финансовых интересов.

Acknowledgements

Это исследование было поддержано программе Павлин Шэньчжэнь, Китай (№ 110811003586331), Шэньчжэнь базовой программы исследований (No. JCYJ20150401150223631, № JCYJ20150401145529020 и No. JCYJ20160331190714896), Гуандун государственных исследований и укрепления потенциала специальной программы (№ 2015A020212030), Национальный природный науки фонд Китая (№ 81501893), программа национального майор Basic исследований Китая (2013CB945503) и СИАТ инновационной программы для отличные молодых исследователей (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics