Calvarial 중요 한 뼈 결함 수리 다 현미경 Vivo에서 유전자 변형 3D-PLGA/nHAp 비 계에 의해 신생 시각화

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기, 선물이 혈관 형성에서 vivo에서 시각화 하는 프로토콜에 multiphoton 현미경 검사 법에 의해 3 차원 건설 기계에서 실시간. 유전자 변형된 건설 기계에서 신생 murine calvarial 중요 한 뼈 결함 모델에서 연구 했다. 더 많은 새로운 혈관 컨트롤에서 보다 처리 그룹에서 발견 했다.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

비판적으로 크기의 뼈 결함의 재건 복구, 충분 한 혈액 공급의 부족 하 고 새로운 조직의 괴 사를 일으키는 동안 가난한 신생 조직 엔지니어링 건설 기계 내에서 인해 심각한 임상 문제 남아 있다. 신속한 vascularization 새로운 조직의 생존 및 기존 호스트 조직 통합에 대 한 중요 한 전제 조건입니다. 맥 관 구조 건설 기계에서의 드 노 보 세대 뼈 재생 좀 더 효율적인, 수 있도록 복구를 발판으로 성장 하는 조직에서 가장 중요 한 단계 중 하나입니다. 이 문제를 해결 하려면 소재 비 계의 유전 수정 골 신생을 촉진 하는 데 사용 됩니다. 그러나, 시각화 및 추적 vivo에서 실시간으로 3 차원 (3D) 건설 기계 또는 새로운 뼈 조직에 혈관 형성은 여전히 뼈 조직 공학에 대 한 장애물. Multiphoton 현미경 (MPM) 고해상도 및 최소한-침략 적 방식으로 생물학 구조에서 체적 데이터를 취득할 수 있는 새로운 바이오 이미징 양식 적임 이다. 이 연구의 목적은 multiphoton 현미경에 vivo에서 calvarial 중요 한 뼈 결함 수리에 대 한 유전자 변형된 3D-PLGA/nHAp 비 계에 신생을 시각화 했다. PLGA/nHAp 건설 기계 했다 공업화 신생을 촉진 하 고 뼈 재생을 향상 하려면 lentiviral 벡터 (LV-pdgfb)를 들고 성장 인자 pdgf b 유전자의 지속적인된 납품에 대 한. 비 계 이식 calvarial 중요 한 뼈에서 마우스 모델을 결함, PHp 건설 기계에서 혈관 영역 (BVAs) PH 건설 기계에서 보다 훨씬 더 높은 했다. 또한, pdgf b 와 신생 관련 유전자, vWFVEGFR2의 식을 대응 하 게 증가 했다. MicroCT 분석 새로운 뼈 형성을 극적으로 향상 PHp 그룹에서 다른 그룹에 비해 표시. 우리의 지식, 이것은 multiphoton 현미경 조사는 3 차원 생물 분해성 scaffold에서 vivo에서 및 실시간으로 신생 뼈 조직 공학에 사용 되었다 처음으로.

Introduction

뼈는 개별1의 수명 기간 동안 개장 하 고 매우 vascularized 조직 이다. 큰 뼈 결함 없앤 외상, 종양 절제, 또는 craniofacial 기형 발생의 신속 하 고 효과적인 뼈 재생 복잡 한 생리 적 과정 이다. 뼈 결함 수리를 위해 사용 하는 전통적인 치료 접근 포함 autograft와 이식 이식, 하지만 그들의 사용을 포함 여러 문제 및 제한 사항, 제한 된 가용성, 중요 한 기증자 사이트 병 적 상태, 감염의 위험이 높은 고 면역 거부2,3호스트. 그러나, 인공 뼈 이식 이러한 제한을 완화 하는 효율적인 대안을 제공 합니다. 그들은 생 분해성 소재로 만들어질 수 있다, 적당 한 기 공 크기, 조작 하기 쉬운 하 고 유전자 변형된4,5일 수 있다.

현재, 다양 한 조직 엔지니어링 건설 기계 조직 공학 뼈6,7의 개발에 고용 되었다 있다. 뼈 수리 및 재생을 보다 효과적으로 유도 하기 위해 설계 된 바이오 성장 인자와 함께 등장 있고 달성 좋은 결과8,9. 불행 하 게도, 짧은 반감기, 잃게 쉬운 활동 및 치료 효능에 대 한 성장 인자의 supraphysiological 복용량 그들의 임상 응용 프로그램10을 제한합니다. 이러한 문제를 해결 하려면 대신 성장 인자 성장 인자 유전자의 뼈가 있는 결함과 질병11,12의 치료에 대 한 bioactivity를 유지 하는 효과적인 방법으로 입증 되었습니다. 바이러스 성 벡터는 유망한 납품 효율성13를 표현 하는 그들의 높은 인해 조직 재생에 대 한 도구.

성장 요인 중 혈소판 파생 된 성장 인자 (PDGF-BB)에서 선정 되었다이 연구는 물질과 엽 고 osteogenic 셀, chemoattractant 뿐만 아니라 신생14,15 에 대 한 자극 제 이기 때문에 . 이전 전 임상 및 임상 연구는 PDGF BB 홍보할 수 있는 안전 하 고 효과적으로 잇 몸 뼈가 있는 결함16,17뼈 수리 했다. 최근 연구 PDGF BB 동기 부여 내 피 세포 이동과 확산 vivo에서18,19신생을 자극 한다는 것을 밝혔다. 또한, PDGF BB 렌더링할 수 있습니다 또한 중간 엽 줄기 세포 (MSCs) 내 피 세포20, 그리고이 더 하이라이트에 neovascularization에서 MSCs의 잠재적인 역할을 차별화 할 수 있습니다. 따라서, 맥 관 구조 건설 기계 PDGF BB와에 드 노 보 형성 유도 뼈 조직 공학에서 공중 발판으로 성장 하는 조직의 수리를 위해 중요 한 단계입니다.

뼈 결함 치유 조정된 골 및 신생 수리 위치21에서 요구 하는 동적 조직 전체적 프로세스입니다. 이식된 조직 설계 건설 기계에 Neoangiogenesis 영양분 및 산소 성장 및 생존 및 변화 낭비를 제거 하기 위한 세포 공급에 대 한 필수적인 전제입니다. 일반적으로 사용 하는 이미징 방법, 엑스레이 포함 하 여 마이크로-계산 단층 (microCT), 자기 공명 영상 (MRI), 스캐닝 전자 현미경 (SEM), 광학 일관성 단층 촬영 (OCT), 그리고 confocal 레이저 스캐닝 현미경 검사 법, 대신 적용 됩니다. 신생 정보22,23를 조직학 검사. 그러나, 이러한 방법을 시각화 및 뼈 조직 공학에서 3D 건설 기계에 neovasculature 측정에 다양 한 장애물의 얼굴. Multiphoton 현미경 (MPM)는 동시에 세포, 세포 외 기질, 시각화 및 주변 혈관 네트워크의 뚜렷한 장점이 비교적 새로운 바이오 이미징 기술 vivo에서. 그것은 깊은 조직 침투에 대 한 고유의 3 차원 이미징 능력을 소유 하 고 낮은 photodamage 발생. 따라서, 지난 10 년간, MPM 생물 의학 연구24, 신경 과학, 면역학, 줄기 세포 역학 등에서 많은 관심을 얻고 있다. 그러나, 그것은 거의 정형 외과 연구에 사용 됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

동물 보호 관리 및 사용의 실험실 동물의 광 동성에 대 한 가이드 준수 했다. 모든 절차는 감독 및 동물 연구, 심천 연구소의 첨단 기술, 과학의 중국 아카데미에 대 한 윤리 위원회의 승인 아래 수행 했다.

1. lentiviral (LV) 생산

Spe를 사용 하 여 세포 발기인의 하류
  1. lentiviral 식 벡터 (pLenti6/5-eGFP 또는 LV eGFP)에 사용자 지정 다중 복제에 pdgf b cDNA 클론 사이트 나 고 샐 내가 pLenti6/5-PDGFB-eGFP 플라스 미드 (LV-pdgfb) 25 구성 제한 사이트.
  2. 공동 바이러스 포장 플라스 미드 (pLP1, pLP2, 및 pVSV G)와 transfecting에 의해 HEK 293 피트 셀에서 lentiviral 입자 (LV-pdgfb)을 생산 클로로퀸과 인산 칼슘 표준 방법을 사용 하 여 (최종 농도: 25 µ M) 25.
  3. transfection의 48 h 후 수확 하 고 포함 하는 바이러스의 500 mL 필터링 필터 (0.45 μ m)와 표면에 뜨는. 그 후, ultracentrifugation 89000 x g 2 h. Resuspend 인산 염 버퍼 식 염 수 (PBS), aliquot의 200 µ L에 대 한에 의해 바이러스 성 입자를 집중 하 고-80에서 저장 ° c.
  4. Lentivirus titer를 확인 하려면 24 시간 연속적으로 희석 lentiviral 솔루션 HEK293T 셀을 품 어 하 고 앞에서 설명한 25 lentiviral titer 계산.

2. 3D 인쇄 PLGA/nHAp 건설 기계 및 동원 정지 LV의 제조

균질 솔루션 1, 4-dioxane의 20 ml에서
    (폴 리 D, L-lactide-co-glycolide) PLGA의 분해 20 g
  1. 소재. Nanosized 우연 (나노-hydroxyapatide) 파우더 (nHAp)의 2 세대 솔루션을 추가 합니다; PLGA: nHAp 비율 10:1 (w/w) 이어야 합니다.
  2. 혼합된 솔루션을 적극적으로 저 어 (교 반 속도: 1500 rpm) 16 h 유니폼 붙여넣기를 형성 하는 자력을 사용 하 여 실내 온도에. 미리 디자인 된 모델 26;에 따라 붙여넣기 레이어, 레이어, 하단 맨 위로, 예금 전산화 노즐 3 차원 낮은 온도 프린터를 사용 하는 다공성 PLGA/nHAp 건설 기계에 그것을 조작합니다 기 공 크기는 장비의 범위는 200에서 400 µ m.
  3. 진공 freeze-dry 용 매를 가능한 한 완전히 제거 하 48 h에 대 한 건설 기계. 살 균에 대 한 1 시간을 위한 75% 에탄올 솔루션에는 건설 기계를 흡수 하 고 중립, 무 균 건설 기계를 얻으려면 lyophilize.
    참고: 진공 동결에 대 한 주요 매개 변수 포함 응축 온도 (° C) 및 진공도 (Pa). 45의 진공도 따라 Pa, PLGA/nHAp 건설 기계 진공 48 h 철저 하 게 용 매를 제거를 위한-78 ° C에서 동결된 했다.
  4. LV 입자의 추가 10 µ L (4.5 x 10 5) PLGA/nHAp 각 하 (4 m m x 2 m m x 4) 발판 및 흡착 수 있도록 습도 인큐베이터에서 37 ° C에서 2 시간에 대 한 건설 기계를 품 어.
  5. Immobilization, 후 린스 언바운드 LV 입자를 제거 하는 PBS로 두번 건설 기계. 스냅-액체 질소에 LV 입자 코팅 건설 기계를 동결, 다시, lyophilize 및 나중에 사용-80 ° C에 저장.

3. 생체 외에서 건설 기계 및 LV 변환 활동 분석 결과에서 LV 입자 방출의 속도 론

  1. 품 3D 건설 (4 m m x 2 m m x 4) 기계 운반 LV 녹색 형광 단백질 (LV-eGFP, 10 5 LV 입자 x 4.5) 2.0 mL 극저온에서 완전 한 DMEM 1 mL에 5 일 동안 떨고와 37 ° C에서 튜브.
  2. 1 mL 샘플 마다 12 h 12 h에서 120 h 후 부 화를 하 고 매체를 대체. 각 시간 지점에서 추가 대신 인큐베이션 매체의 1 mL 신선한 매체의 1 mL.
  3. 수집 된 미디어를 사용 하 여 48 h. 흐름 cytometry 27에 의해 세포 GFP-긍정적인 HEK293T의 수를 결정 하 여 생리 LV 입자 수 측정에 대 한 공동 배양 하 여 HEK293T 셀 transduce.
    1. HEK293T 셀을 시험 하기 전에 문화 매체를 제거 하 고 두 번 PBS와 HEK293T 세포를 씻어. Lentivirus를 포함 하는 수집 된 미디어 (1 mL/음) 잘 하는 건설 기계에서 발표 추가 하 고 37 ° c 습도 인큐베이터에서 48 h에 대 한 HEK293T 셀으로 문화.

4. 생체 외에서 골 수 파생 된 MSC (BMSC) 마이그레이션 평가

  1. 마이그레이션 분석 결과 전에 준비 BMSCs 토마토 형광 단백질 (BMSCs T)와 PDGF BB 단백질 (BMSCs P) 28.
  2. Boyden 챔버 8 µ m의 기 공 크기는 24-잘 접시와 폴 리 카보 네이트 필터를 사용 하 여 BMSC 마이그레이션 분석 결과 수행.
    1. 장소 BMSCs의 0.5 mL (5 x 10 4) 위 약 실에서 토마토 형광 단백질 (BMSCs T)를 표현 하는 LV와 페. BMSCs의 0.5 mL를 배치 (2 x 10 5) 더 낮은 약 실에서 PDGF BB 단백질 (BMSCs-P)를 표현 하는 LV와 페.
  3. 이 실험에서 6 개 그룹을 포함 하 고 각의 더 낮은 구획에 500 µ L을 추가.
    A. 빈 제어, 혈 청 무료 중간만
    B. FBS 제어, 중간 10% 보충 FBS
    C. PDGF BB 제어, 혈 청 무료 매체에서 4 ng/mL PDGF BB
    D. PDGF BB 압류 그룹, PDGF BB (4 ng/mL)와 안티-PDGF-BB (4 ng/mL)에 polyclonal 항 체 혈 청 무료 매체
    E. BMSC 그룹, 혈 청 무료 매체에서 2 x 10 5 BMSCs
    F. BMSCs-P 그룹, 2 x 10 5 BMSCs-P 세럼 무료 매체.
  4. 5% CO 2와 37 ° C 습도 인큐베이터에서 48 h에 품 어. 나중에, 낮은 챔버에 마이그레이션된 셀을 제거 하 고 cytometry에 의해 그들을 BMSCs-T의 수의 정량화에 대 한 수집.
  5. 제거 낮은 챔버에 마이그레이션된 셀 셀 스 크레이 퍼를 사용 하 여 측면 및 2 mL PBS의 마이그레이션된 셀 resuspend
      . 교류 cytometry 29에 의해 마이그레이션된 BMSCs-T 수를 계량.

5. Murine Calvarial 중요 한 뼈 결함 모델 및 비 계 이식의 설립

참고: 남성 BALB/c 마우스 (7 주 이전) 광 동 의료 실험실 동물 센터 (광 동, 중국)에서 구입 했다.

Calvarial 뼈 결함에 대 한
  1. 등록 42의 총 남성 쥐 실험. 다음과 같은 치료를 수신 하는 각 그룹에서 14와 3 그룹으로 쥐를 무작위로 분할: 그룹 A, 임 플 란 트; 그룹 B, PH 건설 기계 이식 (PLGA/nHAp); 그리고 그룹 C, PHp 건설 기계 이식 (PLGA/nHAp/LV-pdgfb).
  2. Anesthetize 나트륨 pentobarbital (50 mg/kg)의 복 관리와 동물. Depilatory 붙여 털을 제거 하 고 첫 번째 절 개를 하기 전에 75% 알코올 솔루션으로 머리 피부를 청소. 아직도 수술 동안 계속 정위 적 악기와 함께 각 마우스의 머리를 해결.
  3. 메스와 초기 절 개 하 고 재치 확대1 cm 선형 피부 절 개를 만드는 h가 위. 멸 균 면봉을 사용 하 여 두개골의 뼈 표면을 두개골의 뼈에서과 다쳤어요.
  4. 판형 버를 사용 하 여 calvaria 30의 왼쪽에 4 m m 직경 임계 크기 결함을 만들. 뼈의 결함 사이트에 발판을 이식.
    참고: 중요 한 크기 결함 (CSDs) 원래로 정의 된 " intraosseous 가장 작은 크기는 특정 뼈와 동물의 수명 기간 동안 자발적으로 치료를 하지 것입니다 동물의 종에 상처 "이 실험, 4 mm 직경 결함에 중요 한 크기 뼈 결함에 따라는 이전 연구 31 , 32.
  5. 안과 집게를 사용 하 여 외과 사이트를 커버 하기에과 다시 부드럽게 이동. Cm 당 3 개의 바늘으로 베인된 피부 봉합.
  6. 는 post-operational 치료를 수행합니다. 통증을 완화 하 고 진통 buprenorphine (0.1 mg/kg)를 관리 합니다. 동물 깨어난다 때까지 열 패드와 체온을 유지 한다. 연속적으로, 음식 및 물 동물 먹이 그리고 매일 테스트의 끝까지 그들의 활동을 기록. 참고: 이전에 절차에 따라 당신의 현지 동물 보호 위원회 지침. 관리할 수 진통

6. Vivo에서 신생 내에 뼈 같이 결함이 MPM의 이미징

참고: FITC 활용 250 kD dextran (10mg/mL) 식 염 수에 높은 SNR (신호 대 잡음 비율) 새로운 혈관의 이미지를 쥐에 주입 정 맥 했다 33 이전 연구 따르면. 참고로이 생존 절차입니다.

  1. 2 광 양자 흥분된 형광 (TPEF)와 두 번째 고조파 생성 (SHG) 신호 이미징 multiphoton 현미경 (MPM) 시스템 조립.
  2. 는 Pentobarbital 나트륨 (50 mg/kg)의 복 주입으로 동물을 anaesthetize 하 고 동물 실험을 통해 37 ° C에서 체온을 유지 하기 위해가 열 플레이트에 고정. 100% 산소에서 3.0 %isoflurane 가스를 사용 하 여 이미징 프로세스 동안 만족 스러운 마 취와 무 통을 유지. Intraperitoneally 염 분 (200 µ L/동물) 이미징 하기 전에 탈수를 방지 하기 위해 주입.
  3. 조정 860에 펨 티타늄 사파이어 레이저 nm. Galvo 거울의 쌍을 검색 하 여 512 x 512 µ m 샘플링 영역을 만들고 사용 하 여 focusthe 여기 광속 NA1.0 물 침수 렌즈 샘플에 backscattered TPEF/SHG 신호를 수집.
    참고:는 이미지는 홈-빌드 multiphoton 현미경 이미징 시스템 (MPM)에서 수행 되었다. 이미징, 동안 펨 티타늄 사파이어 레이저 860 조정 최적의 여기 파장으로 nm. 레이저 빔 래스터 검 류 계 거울의 쌍을 사용 하 여 샘플 평면에 걸쳐 스캔 했다. 685의 dichroic 거울을 통과 후 nm, 빔 20 X NA1.0 목표에는 표본에 집중 했다. 유도 TPEF SHG 신호는 동일한 목적에 의해 수집 되었다. 신호는 위에서 언급 한 고 680 nm 짧은 패스 필터에 의해 순화 dichroic 거울에 의해 여기 레이저에서 분리 했다. TPEF 및 SHG 신호 섬유 번들에 의해 수집 된 되었고 한 분을 실시. 검출기에는 분 광 전 증폭 관 관 (Pmt)의 선형 배열 했다. 400에서 16 연속 스펙트럼 대역에 신호를 기록 하는 기능을 제공 하는 분 및 선형 배열 Pmt의 조합 600 nm nm, 12.5 nm 간격. 따라서, TPEF 및 SHG 신호는 동시에 감지 되었고 스펙트럼 도메인에서 분리. 또한, 3D 영상에 대 한 축 모터 이미징 깊이 제어 하 사용 되었다. 각 이미지의 영역 512 x 512 µ m로 설정 했다 고 깊이 간격 2 µ m (제어 그룹, 5 µ m)로 설정 되었습니다. 특히, 각 결함에 5 사이트 통계적 데이터를 수집 하는 몇 군데 했다 하 고 선택 된 이미징 사이트 결함에 따라 균등 하 게 하 고 무작위로 배포 했다.
  4. 혈관 형성을 측정 하기 위해 통계적으로 중요 한 데이터를 수집 하려면 각 결함에 스캔 5 사이트.
    1. 사용 검색 사이트는 결함에 따라 균등 하 게 무작위로 배포. 컨트롤 그룹에 대 한 필드의 원래 뼈 지역 및 결함의 가장자리 (FOV) 커버를 볼 하지만 PH 및 PHp 그룹에 대 한 FOV 이식된 발판에.
    2. 메스를 사용 하 여 1 cm 선형 피부 절 개를 하 고 이식 사이트를 공개를 고정에 열려 피부를 봉합 합니다. 한 방울의 물 찍기 렌즈와 물 유리를 이식 사이 주사기를 사용 하 여.
  5. 취득 이미지 스택 모든 12 기간 이미징 2 h 이상 s. 표시 및 사용자 지정 MATLAB 프로그램을 사용 하 여 체적 데이터를 분석 하 고 계량 ImageJ 소프트웨어 34 , 35와 혈관 영역.

7. Pdgf b와 실시간 정량 Pcr에 의해 신생 관련 유전자의 유전자 표정 분석

참고: 일반적인 단계 PCR 수행: 95 ° C 30에 대 한 s, 5 95 ° C의 40 주기 들, 그리고 30 s. 포스트 PCR 용 해를 위한 60 ° C 곡선 확인 단일 대상 확대의 특이성 그리고 β-말라 상대적인 관심사의 유전자의 배 변경 결정 했다. 각 샘플에 대 한 반응이 세 번 테스트를 했다.

  1. 수확 건설 기계와 2, 4, 및 8 주 후 작업 36에서 실험 쥐에서 조직 이식; 제어 그룹 샘플 (n = 4), 인접 한 뼈 조직에서 해야한다 같은 시간 지점에서 촬영.
    참고: 각 시간 시점에서 (2, 4, 8 주), CO 2 흡입와 쥐 안락사. 해 부는 calvaria, 그 후, 제거 하 고는 calvaria에서 이식된 건설 기계 수확.
  2. 상업용 시 약을 사용 하 여 제조 업체에 따라 각 샘플에서 총 RNA 추출을 ' s 프로토콜. 역방향 전송 키트를 사용 하 여 역방향-cDNA 제조 업체 다음으로 RNA 녹음 ' s 프로토콜.
  3. SYBR 녹색 탐지 시스템;를 사용 하 여 수행 양적 실시간 PCR 뇌관 표 1에 나열 됩니다.
Primer(5'–3')
유전자 앞으로 리버스
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-말라 GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

표 1: Pimer 세트.

8. 뼈 재생의 MicroCT 분석

  1. 8 주 후 작업에 CO 2 흡입와 Euthanize 쥐. 통풍이 잘되는 환경에서 부드럽게 각 마우스 청소 마우스 케이지로 놓고 anaesthetize는 안락사 하기 전에 마우스를 케이지로 CO 2 가스 펌프.
  2. 뼈 결함 영역의 microCT 이미징 두개골 해 부. 사용자는 다음과 같은 실험에서 매개 변수 검색: 9 µ m 해상도, 알 0.5 m m 필터, 50 kV 전압 및 현재 142 µ A.
  3. 정찰구조체 상용 소프트웨어를 사용 하 여 모든 영상 데이터는 회사에 의해 제공. CTAn 소프트웨어의 보정 기능을 사용 하 여 스캔 보정.
    주: 각 검사에 쥐에서 Hounsfield 단위 (HU) 두고.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

원통형 다공성 PLGA/nHAp 투어 높이 0.6 m m와 4mm 직경에서 3D 프린터 조작 했다. 장비의 형태학 스캐닝 전자 현미경과 microCT를 통해 분석 되었다. 그림 1A 이식된 발판의 사진을 보여줍니다. MicroCT 검색 공개 숨 구멍의 85% 이상 크기 200에서 400 µ m (그림 1B)에 배열 했다. Sem의 영상 시연 발판의 표면 (그림 1의 D-F) 건설 기계 내부 상호 micropores (직경 약 5-10 µ m)와 거친 microtopography 했다. 코팅된 LV eGFP 입자의 총 금액의 약 40% (4.5 x 105) 24 시간 이내 초기 버스트 효과 함께 시작 PLGA/nHAp 건설 기계에서 발표. 출시 LV 바이러스의 bioactivity 24 시간에 정상을 도달 하 고 지속적으로 감소, 120 h (그림 2)에 0에 접근. 이러한 데이터는 대부분 비 계-움직일 LV 입자의 bioactivity 최대 96 h에 대 한 유지 될 수 나타냅니다. MSCs-T의 마이그레이션 용량 조사 여부 LV pdgf b cDNA를 들고 수 익스프레스 BMSC chemotaxis 이어질 같이 FACS 메서드를 관찰 되었다 그림 3. 긍정적인 통제 (C)와 PDGF BB 표현 하는 그룹 (F) 다른 4 그룹 보다 상당히 높은 수준의 BMSC 마이그레이션 전시. 또한, 그룹 F에서 BMSCs의 마이그레이션이 그룹 c에서 보다 훨씬 높은 다른 4 개의 그룹 중 BMSC 마이그레이션에 상당한 차이가 있었다.

뼈 결함 내 신생 MPM 스캔 하 여 8 주 후 주입을 2에서 평가 했다. 그림 4A MPM 검사에서 마우스의 도식 적인 그림을 보여 줍니다. 확실 한 신생 PH 및 PHp 그룹 검색 되었습니다 하지만 혈관 결함 지역에 걸쳐 섬유질 막 층에만 (그림 4B)을 형성 제어 그룹에서 거의 관찰 했다. GIF 그래프 표시 (보충 자료) 각 그룹의 혈관 단층 촬영기. 새로운 혈관의 지역 점차 증가 그룹에서 시간이 지남에 PH와 PHp, 비슷한 증가 패턴. 8 주에 혈관 비슷한 형태에서 초기 단계;에서 등장 유일한 변화는 작은 혈관의 증가 (그림 4B) 건설 기계에 성장 했다 이었다. PHp 그룹의 BVA 높았다 크게 보다는 다른 두 그룹의 모든 시간에 포인트 (그림 4C). 또한, 많은 콜라겐 증 착 사이트, SHG 신호 (그래프와 GIF 그래프에서 녹색 색상) 제어 그룹 (그림 4B)에 PH 및 PHp 그룹으로 표시 했다.

PDGF BB 표현과 신생의 관계를 명확히 하기 위해 우리는 2, 4, 및 8 주 후 주입 ( 에서 실시간 정량 Pcr 방법으로 유전자 사본 식 수준 pdgf b, vWFVEGFR2 의 비교 그림 5). 예상 했던 대로, pdgf b 식 했다 크게 증가 모든 시간 지점에서 PHp 그룹 제어 및 PH 그룹 (그림 5A)에 비해 5-13 시간 증가 함께. 제어 및 PH 그룹 사이의 큰 차이 PDGF BB 식 수준 거의 남아 있었다 주 8, 주 2에서에서 일정 그림 5A와 같이. 모든 3 명 그룹에서 vWFVEGFR2 의 mRNA 식 수준을 점차적으로 증가 하 고 3 포인트 (그림 5B 5c) 시간에 PHp 그룹에서 가장 높은 했다. 산도 그룹에 대 한 분명 한 신생 (그림 4B)에 불구 하 고 컨트롤 그룹에 비해 아무 통계적 의미 했다.

Pdgf b추가 확인-뼈 재생에서 vivo에서 남성 BALB/c 마우스에서 비판적으로 크기의 calvarial 결함을 사용 하 여 포함 된 건설 기계 홍보, 8 주에 뼈 재생을 평가 하기 위해 정보 제공 microCT 검색 포스트 주입입니다. 그림 6에서 같이, 제어 및 PH 그룹에서 훨씬 새로운 뼈 반면 결함 PHp 그룹에는 건설 기계에 새로운 뼈 조직 ingrowth의 질량으로 가득 차 있었다.

Figure 1
그림 1: 3D PLGA/nHAp 비 계의 구조 특성. 3 차원 인쇄 비의 (A) 사진. 발판의 전반적인 다공성의 (B) A microCT 이미지. (C) 비 계 표면 microtopography 관찰 sem의 60 X 2000 X (D), 5000 X (E), 그리고 10, 000 배 확대 (F). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: Lentivirus LV GFP 입자의 Bioactivity의 평가의 준비. (A) lentiviral 벡터 구성의 도식 적인 표현입니다. Transfection의 48 h 후 HEK 293 피트 셀 빛 (B)와 형광 필드 (C) 조건에서 관찰 되었다. (D) PLGA/nHAp 건설 기계에서 누적 발표 LV GFP 입자의 bioactivity의 생체 외에서 평가. 모든 데이터는 평균 ± SEM으로 제공 됩니다 (n = 4). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3입니다. PDGF BB Bioactivity BMSC 마이그레이션의 유력한 혈 요소 응답으로. BMSCs-T (5 x 104) transwell 약 실, 위에 다양 한 조건 미디어 챔버의 하단에 배치와 함께 시드 했다. (A) 빈 제어, 혈 청 자유로운 매체에만; (B) FBS 제어, 중간 보충 10 %FBS; (C) PDGF BB 제어, 4 ng/mL PDGF BB 혈 청 무료 매체; (D) PDGF BB 압류 그룹, PDGF BB (4 ng/mL)와 안티-PDGF-BB (4 ng/mL) polyclonal 항 체 혈 청 무료 매체; (E) BMSCs 그룹, 2 x 105 BMSCs 혈 청 무료 매체; 그리고 (F) BMSCs-P 그룹, 2 x 105 BMSCs-P 세럼-무료 매체에. 모든 데이터는 평균 ± SEM으로 표시 됩니다 (n = 4). #: 그룹 C와 F, # p 그룹 제외 하 고 모든 다른 그룹 간의 비교 < 0.0001. *: F 그룹과 다른 그룹 사이의 비교 * p < 0.05, * * * p < 0.0001. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 고해상도 다 현미경 (SHG/TPEF) 이미징와 마우스 Calvaria 뼈 결함 지역에 신생의 정량화 합니다.합니다 > MPM 검사에서 마우스의 개요 그림 (A) A. 오렌지 원형 나타냅니다 결함 사이트, 빨간색 tubules 혈관, 나타내고 녹색 콜라겐을 나타냅니다. (B) Unoperated 및 운영된 동물 8 주 후 이식에 MPM와 검사 되었다. SHG, TPEF, SHG/TPEF 병합, 그리고 3D 이미지 표시 됩니다. 점선 따라 뼈 결함 SHG 신호에 따라 제어 그룹에서 경계를 나타냅니다. (C) 혈관 영역 정량화 결함 영역 내에서 제어, PH, 그리고 PHp의 2 주에서 8 주 후 이식에. 모든 데이터는 평균 ± SEM으로 표시 됩니다 (n = 5). : 그룹 PH와 PHp, p 통계 분석 < 0.0001. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: Pdgf b (A)와 신생 관련 유전자 vWF (B)와 3 그룹에 VEGRF2 (C) 식의 실시간 정량 분석. 샘플 4 동물에서 각 시간 지점에 대해 분석 했다. #: # p PHp와 PH 그룹 간의 비교 < 0.05, # p < 0.01, 및 #p < 0.0001. *: PHp 및 제어 그룹 사이 비교 * p < 0.05, * * p < 0.01, 그리고 * * * p < 0.0001. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: Vivo에서 뼈 형성 MicroCT 검사의 평가. 이식된 건설 기계 없이 제어 그룹. 산도 그룹 내에서 PLGA/nHAp 비 계만 이식. LV-pdgfb 입자에 의해 수정 하는 이식된 PLGA/nHAp 비 계 내에서 PHp 그룹. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

뼈는 지속적으로 치유 하 고 개별1의 일생 내내 개장 독특한 용량 매우 vascularized 조직 이다. Vascularization의 레벨은 골 및 결함 수리를 위해 중요 하다. 낮은 vascularization 조직 공학 뼈의 넓은 임상 응용 프로그램을 제한합니다. 건설 biomimetics의 이론에 따르면 매우 vascularized 조직 공학 뼈 큰 세그먼트 뼈 결함을 복구 하기 위한 도구가 되고있다. 장비의 다양 한 종류는 비교적 작은 뼈가 있는 결함을 수리에 성공적으로 적용 되었습니다. 그러나, 중요 한 뼈 결함, 아직도 얼굴 장애물, 복구 장비의 응용 프로그램에 대 한 부족 한 혈액 때문에 주로 공급 결함 수리에 대 한. 따라서, 큰 뼈 결함 복구의 과정에서 혈액 공급을 개선 조직 공학의 주요 문제 중 하나입니다.

수 있는 자극, 모집, chemotaxis, 차별화, 그리고 에 있는 neovasculature와 뼈 형성에 필요한 세포의 확산을 촉진 필요한 morphogenetic 분야를 설정 하는 데 도움이 생리 활성 소재 코팅 건설 기계를 사용 하는 사람들 37. 조직 설계 건설 기계에 Neovasculature 산소 및 영양소, 제품, 폐기물의 제거에 대 한 셀에 대 한 필수적 이다 궁극적으로 장비의 기능의 성취에 대 한. 이 연구의 목표 신생 calvarial 중요 한 뼈 결함 수리에 대 한 유전자 변형, 3D 인쇄 PLGA/nHAp 발판에서 vivo에서 multiphoton 현미경으로 조사 하 고 사용 하 여 뼈 재생의 효과 평가 했다 microCT입니다.

뼈 조직 공학, 생체 내에서 시각화 및 뼈 중 건설 기계에 neovascularization의 정량화에 극적인 업적에도 불구 하 고 재생 여전히 도전 이다. 가장 미세한 이미징 시스템 신생에 체적 정보를 제공할 수 없습니다. 전통적인 이미징, microCT, MRI, 조직학 분석 등, 복잡, 파괴 하 고 힘 드는 방법과 낮은 공간적 해상도 및 긴 이미지 수집38시간. 그러나, MPM 이미징 혈관을 캡처할 수 있는 새로운 바이오 이미징 양식 적임 vivo에서 고해상도 및 최소 침 습 방식 신호 이다. 그것은 새로운 배 10 µ m (그림 4B) 보다 얇은 감지 수 있습니다. 혈관 이미지 외 우리 또한 새로운 콜라겐 증 착 (그림 4B에서 그린 색상)와 보충 자료에 GIF 그래프의 다른 각도에서 뼈 조직 형성을 나타내는 SHG 신호에 표시 된 대로 관찰. 이론적으로, 조 영제를 사용 하지 않고 혈관 이미지를 얻을 수 있습니다. 그러나, 현재 연구에 우리 더 나은 이미지를 얻을 대비 에이전트를 사용 하 고 적절 한 스캐닝 깊이 되도록 현지 피부를 제거. 이 것이 필요 하지 않을 때 더 강력한 이미징 시스템 진정으로 비 침략 적 영상에 대 한 미래에 사용할 수 있습니다.

우연은 좋은 osteoconduction 및 osteoinduction 특성 널리 사용 되는 뼈 조직 재생에 대 한 생물 의학 물자 이다. 우연은 DNA 벡터 바인딩 및 유지 하 고 바이러스 성 벡터39를 포함 하 여 벡터를 안정화의 좋은 기능이 있습니다. Microsized 우연에 비해 nanosized 우연 입자 높은 특정 표면 영역을 보유 하 고 따라서 더 나은 셀룰러 동작 및 기계적 특성40을 표시. 이러한 이유로, nHAp 입자는 장비의 구성 요소 중 하나입니다. 그림 1에 표시 된 PLGA/nHAp 비 계의 표면과 단면 SEM 이미지 조작된 건설 기계 전시 잘 상호 연결 된 기 공 구조와 균일 하 게 분산된 기 공 크기를 나타냅니다. 소재 캐리어에 바이러스의 동원 정지 바이러스 활동에 영향을 미칠 수 있습니다. 따라서, 우리는 건설 기계에서 그들의 transfection 활동을 조사 하 여 발표 하는 LV 입자의 bioactivity 테스트. LV는 건설 기계와 그들의 bioactivities에서 입자의 릴리스 프로필 평가 했다 생체 외에서5 일 (그림 2)에 대 한 생리 활성 LV 입자의 제어 납품을 보여주는. 또한, 우리의 생체 외에서 연구 기본 MSCs의 마이그레이션 자극 PDGF BB의 잠재력에 집중 했다. 이러한 결과 LV 입자 표현 생리 PDGF-BB와 효과적으로 자극된 BMSC 마이그레이션 제안.

신생 및 뼈 재생에서 비보에대 한 용량 확인 PHp 건설 기계 murine calvarial 중요 한 뼈 결함으로 이식 했다. 혈관 형성 신생 마커, 실시간 정량 분석 및 혈관 밀도 SHG/TPEF 영상으로 관찰로 확인 됐다. 두 실험의 두 세트는 신생과 혈관 형성 했다 크게 향상 유전자 변형 건설 기계 치료와 함께 시연 했다. 이러한 결과 PDGF BB 직접 자극 하는 신생, 뿐만 아니라 다른 신생 관련 유전자 유도 나타냅니다. 한편, microCT 측정 pdgf b을 보여-건설 기계를 포함 하는 것은 크게 승진 뼈 형성 되지 않은 건설 기계에 비해 발판에 neovasculature와 잘 연결 합니다. 이 결과 유전자 변형, 생리 건설 기계 신생 조직 재생을 크게 향상 시킬 것을 나타냅니다.

여기에 제시 된 결과 장비의 lentivirus 중재 유전자 조작 가능성이 향상 된 신생 통해 murine calvarial 중요 한 뼈 결함 모델에 큰 뼈가 있는 결함 수리를 용이 하 게 하는 방법을 보여 줍니다. 또한, MPM 이미징 vivo에서 신생 골 뼈에 이해 하는 독특한 도구 투어 및 특정 비 계 neovascularization에 도움이 있는지 여부의 추가 설명 가능 하 게 제공 합니다. Intravital multiphoton 현미경 이미징 생리학 그리고 이상 신생 조직 및 건설 기계에의 이해를 위한 적임을 제공 합니다. 그러나,이 기술을 사용 하 여 몇 가지 제한이 있습니다. 첫째, 수술 준비는 특정 전문 지식을 필요합니다. 단순 작업으로 인 한 염증을 크게 품질 이미징 MPM을 줄일 것 이다. 둘째, 속도 제한 이미징 MPM 때문 맞춤형 마우스 머리 홀더 심장 박동 및 호흡으로 인 한 부작용을 줄이기 위해 필요 합니다. 셋째, 장기적인 이미징, 동물 해야 합니다 intraperitoneally 또는 정 맥 주입 탈수를 방지 하기 위해 식 염 수와 함께.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

Acknowledgements

이 연구는 심천 공작 프로그램, 중국 (No. 110811003586331), 심천 기본 연구 프로그램 (제에 의해 지원 되었다 JCYJ20150401150223631, 호 JCYJ20150401145529020, 및 번호 JCYJ20160331190714896), 광 동 공공 연구 및 용량 건물 특별 프로그램 (No. 2015A020212030), 중국 (No. 81501893)의 국가 자연과학 기초, 중국 (2013CB945503)의 국가 주요 기본 연구 프로그램 그리고 민 혁신 프로그램 우수 젊은 연구자 (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics