Visualisation de l’angiogenèse par microscopie Multiphoton In Vivo en échafaudage de 3D-PLGA/PNVS génétiquement modifiés pour la réparation osseuse défaut critique substance

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous présentons ici un protocole afin de visualiser les vaisseaux sanguins formation in vivo et en temps réel en 3D échafaudages par microscopie multiphoton. L’angiogenèse dans les échafaudages génétiquement modifiés a été étudiée dans un modèle de défaut murine substance osseuse critique. Plus de nouveaux vaisseaux ont été détectés dans le groupe de traitement que chez les témoins.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La reconstruction des défauts osseux taille critique reste un problème clinique grave en raison de la mauvaise angiogenèse dans les échafaudages tissulaire lors de la réparation, ce qui donne lieu à un manque d’approvisionnement suffisant en sang et provoque des nécroses des tissus nouveaux. La vascularisation rapide est une condition sine qua non pour la survie de tissus nouveaux et l’intégration avec les tissus de l’hôte. La génération de novo du système vasculaire dans les échafaudages est l’une des étapes plus importantes dans la fabrication de la régénération osseuse plus efficace, permettant de réparer les tissus à se transformer en un échafaudage. Pour résoudre ce problème, la modification génétique d’un échafaudage de biomatériau est utilisée pour accélérer l’angiogenèse et l’ostéogenèse. Cependant, la visualisation et suivi en vivo formation de vaisseaux sanguins en temps réel et en trois dimensions (3D) échafaudages ou nouveau tissu osseux est toujours un obstacle pour l’ingénierie tissulaire osseuse. La microscopie multiphoton (MPM) est une nouvelle modalité de bio-imagerie qui peut acquérir des données volumétriques de structures biologiques de manière à haute résolution et mini-invasive. L’objectif de cette étude était de visualiser l’angiogenèse avec la microscopie multiphoton in vivo dans un échafaudage de 3D-PLGA/PNVS génétiquement modifié pour la réparation de défauts de substance osseuse critique. PLGA/PNVS échafaudages ont été fonctionnalisés pour la prestation continue d’un gène de pdgf-b de facteur de croissance transportant des vecteurs LENTIVIRAUX (LV -pdgfb) afin de faciliter l’angiogenèse et à améliorer la régénération osseuse. Dans un OS critique substance implantés échafaudage défaut modèle murin, les zones de vaisseaux sanguins (BVAs) dans PHp échafaudages ont été significativement plus élevées que dans les échafaudages de PH. En outre, l’expression de pdgf-b et gènes liés à l’angiogenèse, vWF et VEGFR2, augmenté proportionnellement. Plus l’analyse a indiqué que la nouvelle formation osseuse dans le PHp group a grandement amélioré par rapport aux autres groupes. À notre connaissance, c’est la première fois la microscopie multiphoton fut utilisée en ingénierie tissulaire osseuse pour enquêter sur l’angiogenèse dans un échafaudage biodégradables 3D in vivo et en temps réel.

Introduction

L’OS est un tissu très vascularisé qui continue à remodeler au cours de la durée de vie d’un individuel1. La régénération osseuse rapide et efficace des défauts grand OS résultant d’un traumatisme, non syndiqué, résection de la tumeur ou des malformations cranio-faciales est un processus physiologique complex. Les approches thérapeutiques traditionnels utilisés pour la réparation osseuse défaut incluent implantation autogreffe et allogreffe, mais leur utilisation implique plusieurs problèmes et limitations, telles que la disponibilité limitée, morbidité site donateur important, un risque élevé d’infection, et l’hôte de rejet immunitaire2,3. Cependant, les greffes osseuses artificielle offrent une alternative efficace pour pallier ces limitations. Ils peuvent être faits de matériaux biodégradables, sont faciles à être fabriquer avec une taille de pore adapté et peuvent être génétiquement modifié4,5.

Actuellement, divers tissus ingénierie échafaudages ont été employés dans le développement de l’ingénierie tissulaire osseuse6,7. Pour induire la régénération et la réparation osseuse plus efficacement, biomatériaux machiné, combinée à des facteurs de croissance ont émergé et obtenu de bons résultats8,9. Malheureusement, la courte demi-vie, activité de facile-à-perdant et supra-physiologiques dosage des facteurs de croissance de l’efficacité thérapeutique de limiter leur application clinique10. Pour résoudre ces problèmes, la livraison des gènes du facteur de croissance plutôt que de facteurs de croissance a été démontrée comme une approche efficace pour maintenir l’activité biologique pour le traitement des défauts osseux et maladies11,12. Vecteurs viraux sont prometteurs de livraison des outils pour la régénération des tissus en raison de leur haute exprimant l’efficacité13.

Parmi les facteurs de croissance, facteur de croissance dérivé des plaquettes (PDGF-BB) a été choisi dans cette étude, car il est non seulement un mitogène et facteur chimiotactique pour les cellules mésenchymateuses et ostéogéniques, mais aussi un stimulant pour l’angiogenèse14,15 . Des études précliniques et cliniques antérieures ont montré que le PDGF-BB pourrait promouvoir efficacement et en toute sécurité la réparation osseuse parodontale défauts osseux16,17. Des études récentes ont révélé que PDGF-BB stimule l’angiogenèse en motivant endothelial cell migration et prolifération en vivo18,19. En outre, PDGF-BB peut également rendre des cellules souches mésenchymateuses (CSM) capables de se différencier en cellules endothéliales20et ce d’autres points culminants le rôle potentiel de MSCs dans la néovascularisation. Par conséquent, induisant la formation de novo de vascularisation dans les échafaudages avec PDGF-BB est une étape importante pour la réparation des tissus cultivés dans les échafaudages en ingénierie tissulaire osseuse.

La guérison osseuse défaut est un processus morphogénétiques tissu dynamique qui exige une ostéogenèse coordonnée et angiogenèse à la réparation des postes21. Néoangiogenèse dans implanté échafaudages tissulaire est une condition préalable essentielle pour l’approvisionnement des cellules avec des nutriments et l’oxygène pour la croissance et de survie et pour l’élimination des déchets métaboliques. Couramment utilisé de méthodes d’imagerie, y compris les rayons x micro-calculé tomographie (microCT), l’imagerie par résonance magnétique (IRM), microscopie électronique à balayage (SEM), tomographie à cohérence optique (OCT) et laser confocal, microscopie à balayage, sont appliquées au lieu de examen histologique pour obtenir l’angiogenèse informations22,23. Cependant, ces méthodes font face à divers obstacles à visualiser et à mesurer les neovasculature en 3D échafaudages en ingénierie tissulaire osseuse. La microscopie multiphoton (MPM) est une technique de bio-imagerie relativement nouveau qui a l’avantage de simultanément la visualisation des cellules, matrice extracellulaire et entourant les réseaux vasculaires in vivo. Il possède une capacité d’imagerie tridimensionnelle inhérente pour la pénétration des tissus profonds et provoque le photovieillissement faible. Par conséquent, au cours de la dernière décennie, MPM a gagné beaucoup d’attention dans les études biomédicales24, y compris en neurosciences, immunologie et de dynamique des cellules souches. Toutefois, il est à peine utilisé dans la recherche orthopédique.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

la protection des animaux était en conformité avec le Guide pour le soin et l’utilisation du laboratoire animaux de la Province du Guangdong. Toutes les procédures ont été effectuées sous la surveillance et l’approbation du Comité d’éthique pour la recherche animale, Shenzhen Institutes of Advanced Technology, Académie chinoise des Sciences.

1. Production des gènes (LV)

site
  1. Clone le cDNA de pdgf-b dans un vecteur d’expression des gènes (pLenti6/5-eGFP ou LV-eGFP) à un multiple-clonage personnalisé en aval du promoteur cytomégalovirus utilisant Spe I et Sal J’ai des sites de restriction pour construire le plasmide pLenti6/5-PDGFB-eGFP (LV - pdgfb) 25.
  2. Produisent des Particules Lentivirales (LV - pdgfb) des cellules HEK - 293 FT par transfectants conjointement avec des plasmides d’emballage de virus (pLP1, pLP2 et pVSV-G) à l’aide de la méthode standard phosphate de calcium à la chloroquine (concentration finale : 25 µM) 25.
  3. après 48 h de la transfection, récolter et filtrer 500 mL contenant virus du surnageant avec un filtre (0,45 µm). Par la suite, se concentrent les particules virales par ultracentrifugation à 89 000 x g pendant 2 h. remettre dans 200 µL de tampon phosphate salin (PBS), aliquote et stocker à -80 ° C.
  4. Pour déterminer le titre des lentivirus, incuber les cellules HEK293T avec en série des gènes solution pendant 24 h et calculer le titre des gènes, comme décrit précédemment 25.

2. Fabrication d’imprimés 3D PLGA/PNVS échafaudages et immobilisation LV

  1. dissoudre 20 g de PLGA (Poly D, L-lactide-co-glycolide) matériel dans 20 mL de 1, 4-dioxane pour former une solution homogène. Ajouter 2 g de taille nanométrique poudre HAp (nano-hydroxyapatide) (PNVS) à la solution ; la PLGA : PNVS rapport devrait être de 10:1 (w/w).
  2. Agiter la solution mixte vigoureusement (en mélangeant Vitesse : 1500 tr/min) à température ambiante pendant 16 h, à l’aide d’un agitateur magnétique pour former une pâte homogène. Il fabriquer dans les échafaudages PLGA/PNVS poreux à l’aide d’une imprimante 3D de basse température avec une buse informatisée qui dépose le bas couche par couche, de pâte vers le haut, selon un modèle préconçu 26 ; la taille des pores des échafaudages varie de 200 à 400 µm.
  3. Vide lyophiliser les échafaudages pendant 48 h enlever le dissolvant aussi complètement que possible. Faire tremper les échafaudages en solution alcoolique 75 % pendant 1 h pour la stérilisation et lyophiliser pour obtenir des échafaudages neutres, aseptiques.
    Remarque : Les paramètres importants pour la lyophilisation sous vide incluent la température de condensation (° C) et le degré de vide (Pa). En vertu d’un degré de vide de 45 Pa, les échafaudages PLGA/PNVS étaient vide lyophilisé à-78 ° C pendant 48 h à complètement éliminer le solvant.
  4. Ajouter 10 µL de particules LV (4,5 x 10 5) à chaque PLGA/PNVS d’échafaudage (4 x 4 x 2 mm) et incuber les échafaudages pendant 2 h à 37 ° C dans un incubateur humidifié pour permettre à adsorption.
  5. Après l’immobilisation, rincer les échafaudages deux fois avec du PBS pour enlever les particules de LV non liés. Clin d’oeil-gel les échafaudages de particules revêtus de LV dans l’azote liquide, lyophiliser nouveau et stocker à-80 ° C pour une utilisation future.

3. In Vitro Cinétique de libération de particules LV d’échafaudages et d’analyse d’activité de Transduction LV

  1. Incuber les échafaudages 3D (4 x 4 x 2 mm) comptable LV-vert protéine fluorescente (LV-eGFP, 4,5 x 10 5 LV particules) dans 1 mL de DMEM complet à 2,0 mL cryogénique flacons à 37 ° C sous agitation pendant 5 jours.
  2. Prendre un échantillon de 1 mL chaque 12 h de 12 h à 120 h après d’incubation et remplacer le support. À chaque moment, ajouter 1 mL de milieu frais au lieu de 1 mL de milieu d’incubation.
  3. Utiliser les médias collectés pour transmettre les cellules HEK293T co incubation pendant 48 h. mesure le nombre de particules de LV bioactifs en déterminant le nombre de séropositifs au GFP HEK293T cellules par cytométrie de flux 27.
    1. Avant de faire les cellules HEK293T, enlevez le milieu de culture et rincer les cellules HEK293T deux fois avec du PBS. Ajouter les médias collectés contenant lentivirus détache les échafaudages dans le puits (1 mL/puits) et de la culture avec les cellules HEK293T pendant 48 h à 37 ° C dans un incubateur humidifié.

4. In Vitro Évaluation de la Migration de MSC (BMSC) moelle osseuse

  1. avant le test de migration, préparer BMSC exprimant la protéine fluorescente de tomate (BMSC-T) et de protéines (BMSC-P) de PDGF-BB 28.
  2. Effectuer le test de migration BMSC avec une chambre de Boyden, utilisant une plaque 24 puits et filtres en polycarbonate avec une taille de pores de 8 µm.
    1. Place 0,5 mL de BMSC (5 x 10, 4) transfectées avec LV exprimant la protéine fluorescente de tomate (BMSC-T) dans les cavités supérieures. Verser 0,5 mL de BMSC (2 x 10, 5) transfectées avec LV exprimant la protéine PDGF-BB (BMSC-P) dans les cavités inférieures.
  3. Comprend six groupes dans cette expérience et ajouter 500 µL dans le compartiment inférieur de chaque puits.
    A. blank contrôle, sans sérum moyen seulement
    contrôle B. FBS, moyenne additionné de 10 % FBS
    contrôle C. PDGF-BB, 4 ng/mL PDGF-BB dans un milieu sans sérum
    D. PDGF-BB saisir groupe, PDGF-BB (4 ng/mL) et anticorps polyclonal anti-PDGF-BB (4 ng/mL) en un milieu sans sérum
    groupe BMSC E., 2 x 10 5 BMSC dans un milieu sans sérum
    groupe F. BMSC-P, 2 x 10 5 BMSC-P dans un milieu sans sérum.
  4. Incuber pendant 48 heures à 5 % de CO 2 et 37 ° C dans un incubateur humidifié. Ensuite, enlever les cellules migrés sur le côté inférieur de la chambre et à leur rassemblement pour la quantification du nombre de BMSC-T par cytométrie.
    1. Supprimer cellules migrés sur la chambre basse côté à l’aide d’un grattoir de cellules et remettre en suspension les cellules migrées avec 2 mL de PBS. Quantifier le nombre de migré BMSC-T par écoulement cytometry 29.

5. Création d’un modèle murin substance critique de défaut en os et échafaudage Transplantation

Remarque : souris mâles BALB/c (7 semaines) ont été achetées à Guangdong Medical Laboratory Animal Center (Guangdong, Chine).

Experiment de souris mâles
  1. inscrire un total de 42 pour le défaut de substance osseuse. Au hasard de diviser les souris en trois groupes, avec quatorze ans dans chaque groupe qui reçoivent des traitements suivants : groupe A, à aucun implants ; Le groupe B, les échafaudages PH implanté (PLGA/PNVS) ; et le groupe C, PHp échafaudages implantés (PLGA/PNVS/LV-pdgfb).
  2. Anesthésier les animaux avec l’administration intrapéritonéale de pentobarbital de sodium (50 mg/kg). Enlever la fourrure avec pâte épilatoire et nettoyer la peau de tête avec la solution d’alcool 75 % avant d’effectuer la première incision. Fixer la tête de chacune des souris avec un instrument stéréotaxique pour le garder encore pendant la chirurgie.
  3. Faire une incision initiale avec un scalpel et puis agrandissez-le with ciseaux pour créer une incision de 1 cm de peau linéaire. Gratter le périoste de l’os du crâne pour révéler la surface osseuse du crâne à l’aide d’un coton-tige stériles.
  4. Permet de créer un défaut de taille critique de 4 mm de diamètre sur le côté gauche de la calotte cranienne 30 une bavure de trépan. Repiquez l’échafaud dans le site du défect osseux.
    NOTE : Défauts de taille critique (CSDs) ont été définis initialement comme " la plus petite taille intra-osseux enroulé dans un OS particulier et les espèces animales qui ne guérira pas spontanément au cours de la durée de vie de l’animal. " dans cette expérience, le défaut de 4 mm de diamètre est un défect osseux de taille critique, selon l’étude précédemment 31 , 32.
  5. Utiliser forceps ophtalmique pour ramener le périoste doucement pour couvrir le champ opératoire. Suturer la peau incisée avec trois mailles / cm.
  6. Soins post-opérationnelle Perform. Administrer l’analgésique buprénorphine (0,1 mg/kg) pour soulager la douleur. Maintenir la température du corps avec un coussin chauffant jusqu'à ce que l’animal se réveille. Par la suite, nourrir les animaux avec la nourriture et d’eau et d’enregistrer leur activité tous les jours jusqu'à la fin de l’essai. Remarque : L’analgésie peut être administrée avant l’intervention selon vos directives de Comité animalier local.

6. In Vivo Imagerie de l’angiogenèse dans l’aménagement le défect osseux avec MPM

Remarque : conjugué FITC 250 kD dextran (10 mg/mL) dans une solution saline était par voie intraveineuse injectées à des souris d’obtenir haute-SNR (rapport signal sur bruit) images de nouveaux vaisseaux sanguins selon une précédente étude 33. Veuillez noter que ceci est une procédure de survie.

  1. monter le système de microscopie multiphoton (MPM) pour deux photons fluorescence excité (TPEF) et de l’imagerie de signal (SHG) deuxième génération harmonique.
  2. Anesthésier les animaux avec une injection intrapéritonéale de pentobarbital de sodium (50 mg/kg) et immobiliser les animaux sur une plaque chauffante pour maintenir leur température corporelle à 37 ° C au cours des expériences. Utilisez gaz isoflurane 3,0 % dans 100 % d’oxygène pour maintenir satisfaisante anesthésie et analgésie pendant le processus d’imagerie. Injecter par voie intrapéritonéale saline (200 µL/animal) pour prévenir la déshydratation avant imagerie.
  3. Tune le laser femtoseconde Ti-Sapphire à 860 nm. Créer une zone de 512 x 512 µm d’échantillonnage par balayage d’une paire de miroirs galvo et utiliser lentille d’objectif-immersion dans l’eau NA1.0 à faisceau d’excitation focusthe dans l’échantillon et de recueillir le signal TPEF/SHG rétrodiffusé.
    Remarque : L’imagerie a été réalisée sur un système d’imagerie microscopique multiphotonique (MPM) de maison-construction. Au cours de l’imagerie, un laser femtoseconde Ti-Sapphire était réglé à 860 nm comme la longueur d’onde d’excitation optimal. Le faisceau laser a été raster analysé à travers un plan d’échantillonnage à l’aide d’une paire de miroirs de galvanomètre. Après avoir passé à travers un miroir dichroïque de 685 nm, le faisceau se concentrait sur l’échantillon par un objectif de NA1.0 X 20. Les signaux TPEF et SHG induits ont été recueillies par le même objectif. Les signaux ont été réparties du laser d’excitation par le miroir dichroïque mentionnés ci-dessus et purifiée par un filtre de courte passe de 680 nm. Les signaux TPEF et SHG ont été recueillies par un faisceau de fibres et menées à un spectrographe. Le détecteur sur le spectrographe était une rangée linéaire de tubes photomultiplicateurs (PMT). La combinaison du spectrographe et linéaire PMTs a offert la possibilité d’enregistrer le signal dans 16 bandes spectrales consécutives, de 400 nm à 600 nm, à des intervalles de 12,5 nm. Par conséquent, les signaux TPEF et SHG ont été détectés en même temps et séparés dans des domaines spectres. En outre, pour l’imagerie 3D, un moteur axial a été utilisé pour contrôler la profondeur d’imagerie. La zone de chaque image a été fixée à 512 x 512 µm, et l’intervalle de profondeur a été fixé à 2 µm (groupe témoin, 5 µm). Notamment, 5 sites sur chaque défaut ont été imagées pour collecter les données statistiquement significatives, et les sites d’imagerie sélectionnés ont été distribués uniformément et au hasard le long de la défectuosité.
  4. Scan 5 sites sur chaque défaut de recueillir des données statistiquement significatives pour mesurer la formation de vaisseaux.
    1. Utilisation numérisation sites régulièrement et aléatoirement répartis le long de la défectuosité. Pour le groupe témoin, ont le champ d’afficher la couverture (FOV) la zone osseuse d’origine et le bord de la hernie, mais pour les groupes de PH et de PHp, a le champ de vision sur l’échafaud implanté.
    2. Faire une incision de 1 cm de peau linéaire à l’aide d’un scalpel et suture la peau ouverte à la fixation de révéler le site de la transplantation. Utiliser une seringue pour déposer une goutte d’eau qui sépare la lentille trempage et les greffes pour former un verre d’eau.
  5. Image Acquire empile chaque 12 s sur un 2 h, période d’imagerie. Afficher et d’analyser les données volumétriques à l’aide d’un programme personnalisé de MATLAB et de quantifier les zones de vaisseau sanguin avec ImageJ logiciel 34 , 35.

7. Analyse de l’Expression génique du pdgf-b et des gènes liés à l’angiogénèse par RT-qPCR

Remarque : PCR a été réalisée suivant la procédure habituelle : 95 ° C pendant 30 s, 40 cycles de 95 ° C pendant 5 s et 60 ° C pendant 30 s. Post-PCR fonte courbes a confirmé la spécificité de l’amplification de la cible unique, et le changement de pli du gène d’intérêt par rapport au β-actine a été déterminé. La réaction pour chaque échantillon a été testée trois fois.

  1. Récolte implanté les échafaudages et les tissus des souris expérimentales à 2, 4 et 8 semaines après l’opération 36 ; groupe échantillons de contrôle (n = 4), prises sur les mêmes points de temps, devrait être du tissu osseux adjacent.
    Remarque : À chaque point dans le temps (2, 4 et 8 semaines), euthanasié les souris avec inhalation de CO 2. Disséquer la calotte cranienne et, par la suite, de retirer et de récolter les échafaudages implantés de la calotte cranienne.
  2. Utiliser un réactif commercial pour extraire l’ARN total de chaque échantillon selon le fabricant ' protocole s. Utilisez le Kit de Transcription inverse pour renverser-transcrire l’ARN en ADNc suivant le fabricant ' protocole de s.
  3. Perform quantitative PCR en temps réel en utilisant le système de détection SYBR Green ; les amorces sont énumérés au tableau 1.
Primer(5'–3')
Gene vers l’avant Reverse
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 AG GAAATGACACTGGAGCCTACA TCCATGCTGGTCACTAACAGAA G
β-actine GTATCCATGAAATAAGTGGTTAC AGG CAAT GCAGTACATAATTTACACAGAAG

tableau 1 : ensembles de Pimer.

8. MicroCT analyse de régénération osseuse

  1. euthanasier souris dotées de CO 2 par inhalation à post-opération de 8 semaines. Dans un environnement bien aéré, délicatement placer chaque souris dans une cage propre souris et pompe à gaz de CO 2 dans la cage à anesthésier les souris avant l’euthanasie.
  2. De disséquer le crâne pour l’imagerie de la gamme de la région de défaut osseux. Utilisateur qui suit analyse les paramètres dans les expériences : 9 µm résolution, Al 0,5 mm filtre, 50 kV voltage et courant 142 µA.
  3. Reconstruct toutes les données d’imagerie utilisant des logiciels commerciaux fournis par l’entreprise. Calibrer les scans à l’aide de la fonction de calibrage d’un logiciel de CTAn.
    NOTE : Placer une unité Hounsfield (HU) sous les souris à chaque balayage.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cylindrique poreux PLGA/PNVS échafaudages 0,6 mm de hauteur et 4 mm de diamètre ont été fabriqués avec une imprimante 3D. Les morphologies des échafaudages ont été analysés par microscopie à balayage électronique et plus. Figure 1 a montre la photographie de l’échafaudage implanté. Gamme à balayage a révélé que plus de 85 % des pores ont des tailles allant de 200 à 400 µm (Figure 1 b). L’imagerie SEM a démontré que la surface de l’échafaud avait une microtopographie rugueuse, avec des micropores (diamètres environ 5-10 µm) qui reliés entre eux à l’intérieur de l’échafaudage (Figure 1D-F). Environ 40 % du montant total de particules revêtues de LV-eGFP (4,5 x 105) libéré des échafaudages PLGA/PNVS a commencé avec un effet d’éclatement initial sous 24h. La bioactivité des virus libérés de LV a atteint le sommet après 24 h et puis continuellement diminué, s’approchant de 0 à 120 h (Figure 2). Ces données indiquent que la bioactivité des particules de LV plus immobilisée échafaudage pourrait être maintenue jusqu'à 96 heures. La capacité de migration de MSCs-T a été observée avec la méthode de FACS d’étudier si LV transportant pdgf-b cDNA pourrait exprimer et conduire à la chimiotaxie BMSC, comme indiqué dans Figure 3. Fois le témoin positif (C) et le groupe exprimant le PDGF-BB (F) présentaient un niveau nettement plus élevé de migration BMSC que les 4 autres groupes. En outre, la migration des BMSC groupe f a été significativement plus élevée que dans le groupe C. Il n’y a aucune différence significative dans la migration BMSC parmi les 4 autres groupes.

L’angiogenèse dans le défect osseux a été évalué de la 2e à la 8e semaine après la nidation par MPM numérisation. Figure 4 a montre une illustration schématique d’une souris sous analyse de MPM. Angiogenèse évidente a été détectée dans les groupes PH et PHp, mais les vaisseaux sanguins étaient à peine observables dans le groupe témoin, où seulement une couche de membranes fibreuses dans toute la région de défaut de forme (Figure 4 b). Les graphiques GIF montrent les tomodensitomètres de vaisseau sanguin de chaque groupe (Données supplémentaires). La région de nouveaux vaisseaux sanguins ont augmenté progressivement au fil du temps en groupes PH et PHp, avec des profils similaires de plus en plus. À la 8ème semaine, les vaisseaux est apparu une morphologie semblable à celle observée au début du stade ; le seul changement est qu’un nombre croissant de petites embarcations se multipliaient dans les échafaudages (Figure 4 b). La BVA du groupe PHp était significativement plus élevée que que les deux autres groupes, en tout temps points (Figure 4). En outre, il y avait de nombreux sites de dépôts de collagène, comme indiqué par les signaux de SHG (la couleur verte dans les graphiques et graphiques GIF) dans les groupes de PH et PHp, mais pas dans le groupe témoin (Figure 4 b).

Afin de clarifier la relation entre expression PDGF-BB et angiogenèse, nous avons comparé les niveaux d’expression génique transcription du pdgf-b, vWFet VEGFR2 avec la méthode de la RT-qPCR à 2, 4 et 8 semaines après l’implantation ( Figure 5). Comme prévu, pdgf-b expression augmente significativement dans le groupe PHp à tous moments, avec une augmentation de 5 à 13 fois par rapport au contrôle et à des groupes de PH (Figure 5 a). Il n’y avait pas de différence significative entre le contrôle et le groupe de PH et le niveau d’expression du PDGF-BB est resté presque constant de semaine 2 à la semaine 8, tel qu’illustré à la Figure 5 a. Les niveaux d’expression de mRNA de vWF et VEGFR2 chez les trois groupes ont augmenté progressivement et étaient les plus élevés dans le groupe PHp en tout trois fois points (Figure 5 b et 5C). Pour le groupe de PH, il n’y avait aucune signification statistique par rapport au groupe contrôle, malgré l’évidente angiogenèse (Figure 4 b).

Pour confirmer que le pdgf-b-échafaudages contenant promouvoir OS régénération in vivo à l’aide de tailles critique des défauts substance chez la souris BALB/c mâle, microCT numérisation fourni des informations permettant l’évaluation de la régénération osseuse à 8 semaines après l’implantation. Comme illustré à la Figure 6, défauts dans le PHp group étaient remplies d’une masse de nouveau tissulaire de l’os dans les échafaudages, considérant qu’il y avait beaucoup moins de nouvel OS dans les groupes de PH et de contrôle.

Figure 1
Figure 1 : caractérisation d’un échafaudage PLGA/PNVS 3D. (A) photographie d’un échafaudage imprimé 3D. (B) une image de plus de la porosité globale de l’échafaudage. (C) la microtopographie de la surface de l’échafaudage observée par SEM à 60 X, 2 000 X (D), 5 000 X (E) et un grossissement de X 10 000 (F). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : préparation de l’évaluation de la bioactivité des particules LV-GFP et Lentivirus. (A) Représentation schématique de la construction du vecteur lentiviral. Après 48 h de la transfection, les cellules HEK 293 pi ont été observés sous la lumière (B) et des conditions de champ (C) de fluorescence. (D) In vitro assessment de la bioactivité des particules LV-GFP cumulativement libéré de PLGA/PNVS échafaudages. Toutes les données sont présentées comme la moyenne ± SEM (n = 4). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3. Bioactivité PDGF-BB en réponse puissant facteur chimiotactique BMSC Migration. BMSC-T (5 x 10,4) ont été ensemencés sur le dessus de transwell chambres, avec divers médias d’État placés dans le fond des chambres. (A) contrôle à blanc, un milieu sans sérum uniquement ; Contrôler la FBS (B), additionné de 10 % BF ; Contrôle (C) PDGF-BB, 4 ng/mL PDGF-BB dans un milieu sans sérum ; (D) PDGF-BB saisir groupe, PDGF-BB (4 ng/mL) et anticorps polyclonal anti-PDGF-BB (4 ng/mL) dans un milieu sans sérum ; Le groupe de BMSC (E), 2 x 105 BMSC dans un milieu sans sérum ; et (F) BMSC-P groupe, 2 x 105 BMSC-P dans un milieu sans sérum. Toutes les données sont affichées sous la moyenne ± SEM (n = 4). #: comparaison entre groupe C et tous les autres groupes, sauf le groupe F, p # < 0,0001. * : comparaison entre le groupe F et tous les autres groupes, * p < 0,05, *** p < 0,0001. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : L’imagerie haute résolution de la microscopie Multiphoton (SHG/TPEF) et la Quantification de l’angiogenèse dans la région de défectuosité osseuse de souris Calvaria.Trong > (A) A illustration schématique d’une souris sous analyse de MPM. Le cercle orange représente le site de défectuosité, les tubules rouges représentent les vaisseaux sanguins et le vert représente le collagène. (B) Unoperated et animaux exploités ont été scannées avec MPM à post-implantation de 8 semaines. SHG, TPEF, SHG/TPEF ont fusionné, et des images en 3D sont indiqués. La ligne pointillée représente la frontière le long du défect osseux dans le groupe de contrôle basé sur des signaux SHG. (C) des vaisseaux sanguins zone quantification dans la zone de défaut de contrôle, le PH et PHp de semaine 2 à post-implantatoire semaine 8. Toutes les données sont affichées sous la moyenne ± SEM (n = 5). : Analyse statistique entre les groupes PH et PHp, p < 0,0001. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : RT-qPCR analyse de pdgf-b (A) et gènes liés à l’angiogenèse vWF (B) et VEGRF2 (C) Expression en trois groupes. Des échantillons de 4 animaux ont été analysés pour chaque point dans le temps. #: comparaison entre les groupes de PHp et de PH, # p < 0,05, # p < 0,01 et p #< 0,0001. * : comparaison entre les groupes de PHp et de contrôle, * p < 0,05, ** p < 0,01, et *** p < 0,0001. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Évaluation de la Formation osseuse In Vivo avec un balayage de la gamme. Groupe témoin sans échafaudages implantés. Groupe de PH au sein de l’échafaudage PLGA/PNVS implanté seulement. Groupe PHp au sein de l’échafaudage PLGA/PNVS implanté modifié par les particules depdgfb - LV. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L’OS est un tissu très vascularisé avec une capacité unique pour guérir et remodeler tout au long de la durée de vie d’un individuel1en permanence. Le niveau de la vascularisation est important pour l’ostéogenèse et défaut de réparation. Vascularisation faible limite l’application large clinique tissulaire osseuse. Construction d’un OS tissulaire fortement vascularisé selon la théorie de biomimetics est devenu un outil pour la réparation des défauts osseux grand segment. Différents types d’échafaudages ont été appliqués avec succès pour réparer les défauts osseux comparativement faibles. Cependant, pour des défauts osseux critique, l’application des échafaudages pour réparer encore faces obstacles, principalement en raison de l’insuffisance artérielle vous fournir pour défaut de réparation. Amélioration de l’approvisionnement en sang au cours du processus de réparation des défauts osseux grand est donc un des enjeux majeurs en génie tissulaire.

Gens utilisent bioactifs échafaudages matériel-enduit qui aiderait à établir les champs morphogénétiques nécessaires qui peuvent stimuler, recruter et promouvoir la chimiotaxie, la différenciation et la prolifération des cellules nécessaires à la neovasculature et la formation osseuse 37. Neovasculature en échafaudages tissulaire est essentiel pour les cellules de recevoir oxygène et nutriments, pour l’enlèvement des matières résiduelles et finalement pour l’accomplissement de la fonction d’échafaudages. Les objectifs de cette étude ont été d’enquêter sur l’angiogenèse in vivo la microscopie multiphoton dans un échafaudage PLGA/PNVS génétiquement modifié, imprimés à la 3D pour la réparation de défauts de substance osseuse critique et d’évaluer les effets de l’utilisation de la régénération osseuse microCT.

Malgré les progrès spectaculaires en ingénierie tissulaire osseuse, la in vivo la visualisation et la quantification de la néovascularisation dans les échafaudages au cours de l’OS la régénération est toujours un défi. Systèmes d’imagerie plus microscopiques sont incapables de fournir des informations volumétriques sur l’angiogenèse. Les méthodes d’imagerie traditionnels, tels que microCT, MRI et des analyses histologiques, sont destructrices, compliqué et laborieux et faible résolution spatiale et acquisition d’images long temps38. Toutefois, l’imagerie MPM est une nouvelle modalité de bio-imagerie qui peut capturer des vaisseaux sanguins des signaux en vivo de manière à haute résolution et mini-invasive. Il est capable de détecter de nouveaux navires de moins de 10 µm (Figure 4 b). En plus d’images de vaisseaux sanguins, nous avons également observé une masse de nouveaux dépôts de collagène (la couleur verte dans la Figure 4 b) et les graphiques GIF dans les documents supplémentaires, comme il est indiqué par des signaux SHG, qui indiquent la formation du tissu osseux sous un autre angle. Théoriquement, les images de vaisseaux sanguins pourraient être obtenus sans l’aide d’agents de contraste. Toutefois, dans la présente étude, nous utilisé un agent de contraste pour obtenir les meilleures images et enlevé locale de la peau pour s’assurer de la bonne profondeur de numérisation. Cela ne serait pas nécessaire lorsque les systèmes d’imagerie plus puissants sont disponibles dans l’avenir pour l’imagerie non invasive vraiment.

PAH est un matériau biomédical pour la régénération des tissus osseux qui est largement utilisé en raison de sa bonne osteoconduction et des traits Ostéoinduction. PAH a bonne capacité de lie des vecteurs de l’ADN et conservant et stabilisation de vecteurs, y compris les vecteurs viraux39. Par rapport à micronisée HAp, les particules de taille nanométrique HAp possèdent des surfaces spécifiques élevées et donc montrent meilleur comportement cellulaire et propriétés mécaniques40. Pour ces raisons, les particules de PNVS sont une des composantes de l’échafaudage. Les images de SEM de surface et transversales de l’échafaudage PLGA/PNVS illustré à la Figure 1 indique que les échafaudages préfabriqués présentent une structure de pores bien interconnecté et la taille des pores uniformément distribuée. L’immobilisation des virus sur les transporteurs de biomatériau peut influencer l’activité du virus. Par conséquent, nous avons testé la bioactivité des particules LV libéré de l’échafaudage en enquêtant sur leur activité de transfection. Les profils de libération des particules de LV des échafaudages et leurs bioactivités ont été évalués in vitro, ce qui démontre la livraison contrôlée de particules de LV bioactives pendant cinq jours (Figure 2). Par ailleurs, notre étude in vitro axé sur le potentiel du PDGF-BB pour stimuler la migration des primaires MSCs. Ces résultats suggèrent que les particules de LV exprimée bioactif PDGF-BB et efficacement stimulée BMSC migration.

Pour confirmer la capacité de l’angiogenèse et bone regeneration in vivo, échafaudages de PHp ont été implantés dans des défauts osseux critique substance murin. Formation de vaisseaux a été confirmée avec marqueurs angiogénique, RT-qPCR analyse et densités de vaisseau sanguin observées avec l’imagerie de la SHG/TPEF. Tous les deux les deux séries d’expériences ont démontré que l’angiogenèse et la formation de vaisseaux sanguins ont été améliorées significativement avec le traitement des échafaudages génétiquement modifiés. Ces résultats indiquent que les PDGF-BB non seulement stimule directement l’angiogenèse, mais induit également des autres gènes liés à l’angiogénèse. Pendant ce temps, les mesures de microCT démontrent que pdgf-b-contenant des échafaudages considérablement favorisé la formation osseuse par rapport aux échafaudages non modifiées, qui corrèle bien avec la neovasculature à l’échafaud. Ces résultats indiquent qu’échafaudages génétiquement modifiés, bioactives améliorent de façon significative l’angiogenèse et tissu de régénération.

Les résultats présentés ici montrent que la modification génétique induite par le lentivirus des échafaudages facilite la réparation de gros défaut osseux dans un modèle de défaut murine substance osseuse critique, probablement par l’intermédiaire de l’angiogenèse améliorée. En outre, l’imagerie in vivo MPM fournit un outil unique pour comprendre l’angiogenèse et ostéogénèse osseuse échafaudages et permet aux autres élucidation de savoir si un certain échafaudage est bénéfique à la néovascularisation. Imagerie de la microscopie intravitale multiphoton fournit une modalité pour la compréhension de la physiologie et la physiopathologie de l’angiogenèse dans les tissus et les échafaudages. Cependant, il y a plusieurs limitations lors de l’utilisation de cette technique. Tout d’abord, la préparation chirurgicale nécessite une expertise particulière. L’inflammation causée par l’utilisation non qualifiée diminuera considérablement la MPM, qualité d’image. Deuxièmement, en raison de la MPM imagerie de limitation de vitesse, un support de tête de souris personnalisée est nécessaire pour réduire les artefacts causés par le rythme cardiaque et la respiration. En troisième lieu, pour l’imagerie à long terme, animaux doit être par voie intrapéritonéale ou intraveineuse injecté avec du sérum physiologique pour éviter la déshydratation.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt financier concurrentes.

Acknowledgements

Cette étude a été financée par le programme de paon Shenzhen, Chine (no 110811003586331), le programme de recherche fondamentale de Shenzhen (no. JCYJ20150401150223631, no JCYJ20150401145529020 et no JCYJ20160331190714896), le Guangdong Public Research and Capacity Building programme spécial (n° 2015A020212030), la Fondation nationale des sciences naturelles de Chine (no 81501893), le programme de recherche de base Major National de Chine (2013CB945503) et le Programme d’Innovation de SIAT d’excellents jeunes chercheurs (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics