Visualisera angiogenes av Multiphoton mikroskopi In Vivo i genetiskt modifierade 3D-PLGA/nHAp byggnadsställning för Calvarial kritiska ben defekt reparation

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenterar vi ett protokoll för att visualisera blodkärl bildas i vivo och i realtid i 3D ställningar av multiphoton mikroskopi. Angiogenes i genetiskt modifierade ställningar studerades i en murina calvarial kritiska ben defekt modell. Fler nya blodkärl upptäcktes i behandlingsgruppen än i kontroller.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Återuppbyggnaden av kritiskt storlek ben defekter förblir ett allvarligt kliniska problem på grund av dålig angiogenes inom vävnadstekniska ställningar under reparation, vilket ger upphov till en brist på tillräcklig blodtillförsel och orsakar nekros av nya vävnader. Snabb vaskularisering är en avgörande förutsättning för ny vävnad överlevnad och integration med befintliga värden vävnad. De novo generering av kärlsystemet i ställningar är en av de viktigaste stegen i att effektivisera ben, vilket gör att reparera vävnad att växa till en byggnadsställning. För att tackla detta problem, används genmodifiering av en biomaterial byggnadsställning för att påskynda angiogenes och osteogenesis. Men, visualisera och spåra i vivo blodkärlsbildning i realtid och tredimensionella (3D) ställningar eller ny benvävnad är fortfarande ett hinder för bone tissue engineering. Multiphoton mikroskopi (MPM) är en roman bio-imaging modalitet som kan förvärva volymetriska data från biologiska strukturer i ett högupplöst och minimalinvasiv sätt. Syftet med denna studie var att visualisera angiogenes med multiphoton mikroskopi i vivo i en genetiskt modifierade 3D-PLGA/nHAp byggnadsställning för calvarial kritiska ben defekt reparation. PLGA/nHAp ställningar var functionalized för fortsatt leverans av en tillväxtfaktorn pdgf-b gen bär lentiviral vektorer (LV -pdgfb) för att underlätta angiogenes och att förbättra ben. I en byggnadsställning-implanterade calvarial kritiska ben defekt musmodell, blodkärl områdena (BVAs) i PHp ställningar var betydligt högre än i PH ställningar. Dessutom ökar uttrycket av pdgf-b och angiogenes-relaterade gener, vWF och VEGFR2, på motsvarande sätt. MicroCT analys visade att den nya benbildningen i gruppen PHp förbättrats dramatiskt jämfört med de andra grupperna. Till vår kunskap är detta första gången multiphoton mikroskopi användes i ben vävnadsteknik för att undersöka angiogenes i en 3D biologiskt nedbrytbar byggnadsställning i vivo och i realtid.

Introduction

Ben är en högt vaskulariserad vävnad som fortsätter att renovera under livstiden för en enskild1. Snabba och effektiva ben regenerering av stort ben defekter som följd av trauma, avsaknad av hopläkning, tumör resektioner eller kraniofaciala missbildningar är en komplex fysiologisk process. Traditionella behandlingsmetoder som används för ben defekt reparation inkluderar autograft och transplantatavstötning implantation, men deras användning innebär flera problem och begränsningar, såsom begränsad tillgänglighet, betydande givare webbplats sjuklighet, en hög risk för infektion, och värd för immun avslag2,3. Konstgjorda bone Transplanterad läderhud erbjuder dock ett effektivt alternativ för att lindra dessa begränsningar. De kan vara gjorda av biologiskt nedbrytbara material, är lätt att vara tillverka med en lämplig porstorlek och kan vara genetiskt modifierade4,5.

För närvarande har olika tissue engineering ställningar varit anställd i utvecklingen av vävnadstekniska ben6,7. Inducera ben reparation och förnyelse mer effektivt, har konstruerade biomaterial kombinerat med tillväxtfaktorer uppstått och uppnått goda resultat8,9. Tyvärr, den kort halveringstid, lätt-till-förlora aktivitet och suprafysiologiska dosering av tillväxtfaktorer för terapeutisk effekt begränsa deras klinisk tillämpning10. För att övervinna dessa problem, har leverans av tillväxtfaktor gener istället för tillväxtfaktorer påvisats som ett effektivt tillvägagångssätt att upprätthålla bioaktivitet för behandling av bendefekter och sjukdomar11,12. Virala vektorer är lovande leverans verktyg för vävnadsregeneration på grund av sin höga uttrycker effektivitet13.

Bland tillväxtfaktorer valdes trombocyt-derived tillväxt factor (PDGF-BB) i denna studie eftersom det är inte bara en mitogen och korrektiv för mesenkymala och Osteogena celler, men också en stimulerande för angiogenes14,15 . Tidigare prekliniska och kliniska studier visade att PDGF-BB kunde säkert och effektivt främja ben reparation i parodontala bendefekter16,17. Senare studier visade att PDGF-BB stimulerar angiogenes av motiverande endotelceller migration och spridning i vivo18,19. Dessutom kan PDGF-BB även återge mesenkymala stamceller (MSC) kan differentiera till endotelceller20och detta ytterligare höjdpunkter MSCs potentiella roll i kärlnybildning. Därför är förmå de novo bildandet av kärlsystemet i ställningar med PDGF-BB ett viktigt steg för att reparera vävnad vuxit till byggnadsställningar i ben vävnadsteknik.

Benläkning defekt är en dynamisk vävnad morphogenetic process som kräver samordnade osteogenesis och angiogenes vid reparation positioner21. Neoangiogenesis in implanterade vävnadstekniska ställningar är en grundläggande förutsättning för att förse cellerna med näring och syre för tillväxt och överlevnad och för att avlägsna metabola avfall. Vanligen används imaging metoder, beräknade inklusive röntgen mikro-datortomografi (microCT), magnetisk resonanstomografi (MRT), scanning electron microscopy (SEM), optisk koherenstomografi (OCT) och confocal laserscanning mikroskopi, tillämpas i stället för Histologisk undersökning att få angiogenes information22,23. Dock möter dessa metoder olika hinder i visualisera och mäta neovasculature i 3D ställningar i ben vävnadsteknik. Multiphoton mikroskopi (MPM) är jämförelsevis ny bio-imaging teknik som har den klara fördelen samtidigt visualisera celler, extracellulär matrix, och omgivande vaskulär nätverk invivo. Det äger en inneboende tredimensionell avbildning förmåga för djup vävnad penetration och orsakar låg photodamage. Därav, under det senaste decenniet, MPM har fått mycket uppmärksamhet i biomedicinska studier24, inklusive i immunologi, neurovetenskap och stamceller dynamics. Det används dock knappt i ortopedisk forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

djur vården var i överensstämmelse med guiden för skötsel och användning av laboratorium djur i provinsen Guangdong. Alla förfaranden utfördes under tillsyn och godkännande av den etiska kommittén för djur forskning, Shenzhen institut av avancerad teknik, kinesiska vetenskapsakademin.

1. lentiviral (LV) produktion

  1. klon den pdgf-b cDNA i ett lentiviral uttryck vektor (pLenti6/5-andra eller LV-andra) på en anpassad multipel-kloning platsen nedströms av cytomegalovirus arrangören använder Spe jag och Sal Jag begränsning platser att konstruera de pLenti6/5-PDGFB-andra plasmid (LV - pdgfb) 25.
  2. Producera lentiviral partiklar (LV - pdgfb) från HEK - 293 FT celler genom samtidig transfecting med virus förpackning plasmider (pLP1, pLP2 och pVSV-G) med standard kalciumfosfat metod med klorokin (slutlig koncentration: 25 µM) 25.
  3. efter 48 h av transfection, skörda och filtrera 500 mL virusinnehållande supernatanten med ett filter (0.45 µm). Därefter koncentrera viruspartiklarna genom ultracentrifugering vid 89 000 x g i 2 h. Omsuspendera i 200 µL fosfatbuffrad saltlösning (PBS), alikvotens och lagra vid -80 ° C.
  4. För att fastställa antikroppnivåns på lentivirus, inkubera HEK293T celler med seriellt utspädd lentiviral lösning för 24 h och beräkna lentiviral titern, som tidigare beskrivits 25.

2. Tillverkning av 3D-tryckt PLGA/nHAp ställningar och LV immobilisering

  1. Lös 20 g av PLGA (Poly D, L-laktid-co-glykolid) material i 20 mL 1,4-dioxan att bilda en homogen lösning. Tillsätt 2 g nanosized HAp (nano-hydroxyapatide) pulver (nHAp) till lösningen; PLGA: nHAp förhållandet bör vara 10:1 (w/w).
  2. Rör den blanda lösningen kraftigt (omrörning hastighet: 1500 rpm) vid rumstemperatur för 16 h med en magnetomrörare till en jämn smet. Fabricera det in i porösa PLGA/nHAp ställningar med en 3D låg temperatur-skrivare med en datoriserad munstycke som deponerar den klistra in lager-för-lager, nedifrån och upp, enligt en fördefinierad modell 26; porstorlek på byggnadsställningarna sträcker sig från 200 till 400 µm.
  3. Vakuum kaseinbanden ställningar för 48 h ta bort vätska så fullständigt som möjligt. Blötlägg ställningar i 75% etanol lösning för 1 h för sterilisering och lyophilize för att få neutrala, aseptisk ställningar.
    Obs: De viktigaste parametrarna för vakuum frystorkning inkludera kondensation temperaturen (° C) och vakuum grad (Pa). Under en vakuum grad av 45 Pa, de PLGA/nHAp ställningar var vakuum frystorkat vid-78 ° C för 48 h att noggrant avlägsna lösningsmedlet.
  4. Lägg till 10 µL av LV partiklar (4,5 x 10 5) till varje PLGA/nHAp schavotten (4 x 4 x 2 mm) och inkubera i ställningar för 2 h vid 37 ° C i en fuktad inkubator att tillåta adsorption.
  5. Efter immobilisering, skölj ställningar två gånger med PBS ta bort obundna LV partiklar. Snapin-frysa de LV partikel-belagd ställningar i flytande kväve, lyophilize igen och förvaras vid-80 ° C för framtida användning.

3. In Vitro Kinetiken av LV partikel utsläpp från ställningar och LV transduktion aktivitet Assay

  1. Inkubera 3D ställningar (4 x 4 x 2 mm) redovisade LV-grönt fluorescerande protein (LV-andra, 4,5 x 10 5 LV partiklar) i 1 mL av komplett DMEM i 2,0 mL kryogen injektionsflaskor vid 37 ° C med skakningar i 5 dagar.
  2. Ta en 1 mL prov varje 12 h från 12 h till 120 h efter inkubation och ersätta mediet. Vid varje tidpunkt, tillsätt 1 mL av färskt medium i stället för 1 mL inkubation medium.
  3. Använda insamlade media för att transduce HEK293T celler av samtidig inkubation för 48 h. Mät antalet bioaktiva LV partiklar genom att bestämma antalet GFP-positiva HEK293T av flöde flödescytometri 27.
    1. Före transducing HEK293T cellerna, ta bort odlingsmediet och skölj HEK293T cellerna två gånger med PBS. Lägg till insamlade media som innehåller lentivirus frigörs från ställningar till brunnen (1 mL per brunn) och kultur med HEK293T celler för 48 h vid 37 ° C i en fuktad inkubator.

4. In Vitro Bedömning av benmärgen-derived MSC (BMSC) Migration

  1. innan migreringen analysen, förbereda BMSCs uttrycker tomat fluorescerande protein (BMSCs-T) och PDGF-BB protein (BMSCs-P) 28.
  2. Utför BMSC migration analysen med en Boyden kammare med en 24-well platta och polykarbonat filter med en porstorlek av µm 8.
    1. Plats 0,5 mL av BMSCs (5 x 10 4) transfekterade med LV uttrycker tomat fluorescerande protein (BMSCs-T) i övre kamrarna. Häll 0,5 mL av BMSCs (2 x 10 5) transfekterade med LV uttrycker PDGF-BB protein (BMSCs-P) i de nedre kamrarna.
  3. Inkluderar sex grupper i detta experiment och tillsätt 500 µL till det nedre facket i varje brunn.
    A. Tom kontroll, serumfritt medium endast
    B. FBS kontroll, medellång kompletteras med 10% FBS
    C. PDGF-BB kontroll, 4 ng/mL PDGF-BB i serumfritt medium
    D. PDGF-BB gripa PDGF-BB-gruppen (4 ng/mL) och anti-PDGF-BB (4 ng/mL) polyklonala antikroppar i serumfritt medium
    E. BMSC grupp, 2 x 10 5 BMSCs i serumfritt medium
    F. BMSCs-P grupp, 2 x 10 5 BMSCs-P i serum gratis medium.
  4. Inkubera i 48 timmar vid 5% CO 2 och 37 ° C i en fuktad inkubator. Efteråt, ta bort migrerade cellerna i den nedre kammare sidan och samla dem för kvantifiering av antalet BMSCs-T genom flödescytometri.
    1. Ta bort migrerade celler i den nedre kammaren sida använder en cell skrapa och resuspendera migrerade cellerna med 2 mL PBS. Kvantifiera antalet migrerade BMSCs-T genom flödet flödescytometri 29.

5. Inrättandet av en murina Calvarial kritiska ben defekt modell och byggnadsställning Transplantation

Obs: manliga BALB/c-möss (7 veckor gamla) köptes från Guangdong Medical Laboratory Animal Center (Guangdong, Kina).

  1. Registrera sammanlagt 42 hanmöss calvarial ben felet experimentera. Slumpmässigt dela möss i tre grupper, med fjorton i varje grupp som får följande behandlingar: grupp A, inga implantat; Grupp B, PH ställningar implanteras (PLGA/nHAp); och grupp C, PHp ställningar implanteras (PLGA/nHAp/LV-pdgfb).
  2. Söva djuren med intraperitoneal administrering av natrium pentobarbital (50 mg/kg). Ta bort päls med hårborttagningsprodukter pasta och rensa huvudet huden med 75% alkohollösning innan första snittet. Fixa huvudet av varje mus med ett stereotaktiska instrument för att hålla den stilla under kirurgi.
  3. Gör ett inledande snitt med en skalpell och sedan förstora det with sax för att skapa en 1 cm linjär huden snitt. Skrapa periostet från ben av kraniet att avslöja benytan av skallen med en steril bomullspinne.
  4. Använda en trephine burr för att skapa en 4 mm diameter kritisk-storlek defekt på vänster sida av calvaria 30. Transplantera ställningen i ben defekten.
    Obs: Kritisk storlek defekter (värdepapperscentraler) definierades ursprungligen som " den minsta storleken intraosseous sår i en särskilt ben och djurarter som inte kommer att läka spontant under livstid den djur. " i detta experiment, 4 mm diameter defekten är en kritisk storlek ben defekt, enligt den tidigare studien 31 , 32.
  5. Använd oftalmologiska pincett för att flytta periostet tillbaka försiktigt att täcka operationsområdet. Sutur anskäras huden med tre maskor per cm.
  6. Utför postoperativ vård. Administrera den analgetiska buprenorfin (0,1 mg/kg) för att lindra smärta. Upprätthålla kroppstemperaturen med en värmedyna tills djuret vaknar. Därefter mata djuren med mat och vatten och registrera deras aktivitet varje dag fram till slutet av testet. Obs: Analgesi kan administreras före proceduren beroende på din lokala djurvård kommittén riktlinjer.

6. In Vivo Avbildning av angiogenes inom the ben defekt med MPM

Obs: FITC-konjugerad 250 kD dextran (10 mg/mL) i saltlösning injicerades intravenöst i möss att erhålla hög-SNR (signal-brus-förhållande) bilder av nya blodkärl enligt en tidigare studie 33. Observera att detta är en överlevnad procedur.

  1. montera multiphoton mikroskopi (MPM) systemet för två-photon glada fluorescens (TPEF) och andra harmoniska generation signal (SHG) imaging.
  2. Bedöva djuren med en intraperitoneal injektion pentobarbital natrium (50 mg/kg) och immobilisera djuren på en värmeplattan till upprätthålla deras kroppstemperatur på 37 ° C under experimenten. Använda 3,0% isofluran gas i 100% syre för att upprätthålla tillfredsställande anestesi och analgesi under avbildningsprocessen. Intraperitonealt injicera saltlösning (200 µL/djur) för att förhindra uttorkning innan imaging.
  3. Tune femtosecondlaser Ti-Sapphire till 860 nm. Skapa en 512 x 512 µm provtagningsområdet genom att skanna ett par galvo speglar och använda NA1.0 nedsänkning i vatten objektiv att fokusen excitation balk i provet och att samla bakåtspritt TPEF/SHG signalen.
    Obs: Bildtagning utfördes på ett hem-Bygg multiphoton mikroskopiska imaging system (MPM). Under imaging, en femtosecondlaser Ti-Sapphire var trimmad till 860 nm som optimal excitation våglängden. Laserstrålen var raster skannade över ett prov plan med hjälp av ett par galvanometer speglar. Efter att ha passerat genom en dichroic spegel av 685 nm, balken var inriktad på exemplaret av en 20 X NA1.0 mål. Inducerad TPEF och SHG signalerna samlades vid samma mål. Signalerna var uppdelade från excitation laser av dichroic spegeln ovan och renas genom ett 680-nm kort-pass filter. TPEF och SHG signalerna samlades in av en fiber bunt och bedrivs till en spektrograf. Detektorn på spektrografen var en linjär array av Fotomultiplikatorrör (PMTs). Kombinationen av spektrografen och linjär array PMTs erbjöd möjligheten att spela in signalen i 16 på varandra följande spectral band, från 400 nm till 600 nm, 12,5-nm mellanrum. Därför TPEF och SHG signalerna upptäcktes samtidigt och separerade i spektrala domäner. Dessutom för 3D imaging användes en axiell motor för att styra imaging djupet. Området i varje bild var satt till 512 x 512 µm, och djup intervallet sattes till 2 µm (kontrollgruppen, 5 µm). Särskilt, 5 platser på varje defekt var avbildas för att samla in statistiskt signifikanta data, och de valda imaging platserna var fördelade jämnt och slumpmässigt längs defekten.
  4. Skanna 5 platser på varje defekt att samla in statistiskt signifikanta data för att mäta bildandet av blodkärl.
    1. Användning scanning webbplatser jämnt och slumpmässigt fördelade längs defekten. För kontrollgruppen, har området Visa (FOV) täcker både det ursprungliga ben-området och i utkanten av felet, men för PH och PHp har FOV på implanterade schavotten.
    2. Gör en 1 cm linjär huden snitt med en skalpell och sutur öppna huden att fixeringen att avslöja webbplatsen transplantation. Använd en spruta för att placera en droppe vatten mellan doppa linsen och transplantationer att bilda ett vatten glas.
  5. Förvärva bilden travar varje 12 s över en 2 h imaging period. Visa och analysera volymetriska data med hjälp av ett anpassat program för MATLAB och kvantifiera de blodkärl områdena med ImageJ programvara 34 , 35.

7. Gen uttryck analys av angiogenes-relaterade gener av RT-qPCR och pdgf-b

Obs: PCR utfördes efter de vanliga stegen: 95 ° C i 30 s, 40 cykler av 95 ° C för 5 s, och 60 ° C för 30 s. Post-PCR smältning kurvor bekräftade specificitet singel-target amplifiering, och vik förändringen av genen av intresse i förhållande till β-aktin bestämdes. Reaktionen för varje prov testades tre gånger.

  1. Skörd implanteras ställningar och vävnader från de experimentella möss vid 2, 4 och 8 veckor efter operationen 36; kontrollprover gruppen (n = 4), tas vid samma tidpunkter, bör vara från intilliggande benvävnad.
    Obs: Vid varje tidpunkt (2, 4 och 8 veckor), euthanized möss med CO 2 inandning. Dissekera calvaria och, därefter, tar bort och skörda de implanterade ställningar från calvaria.
  2. Använda en kommersiell reagens för att extrahera den total-RNA från varje prov enligt tillverkaren ' s-protokollet. Använd omvänd Transkription Kit för att vända-transkribera RNA till cDNA efter tillverkaren ' s protokollet.
  3. Utför kvantitativa Realtidspcr använder SYBR Green detektionssystemet; primers listas i tabell 1.
Primer(5'–3')
gen framåt Omvänd
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-aktin GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

tabell 1: Pimer uppsättningar.

8. MicroCT analys av ben

  1. Euthanize möss med CO 2 inhalation vid 8 veckor efter operationen. I en väl ventilerad miljö, försiktigt placera varje mus i en ren mus bur och pumpa CO 2 gas i buren för att bedöva mössen innan dödshjälpen.
  2. Dissekera skallen för microCT avbildning av regionen ben defekt. Användaren följande avsökningstäthet i experiment: 9 µm upplösning, Al 0,5 mm filter, 50 kV spänning och 142 µA nuvarande.
  3. Reconstruct alla tänkbar data med hjälp av kommersiell programvara som tillhandahålls av företaget. Kalibrera skanningar med kalibreringsfunktionen av en CTAn programvara.
    Obs: Placera en Hounsfield enhet (HU) under möss i varje skanning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cylindriska porösa PLGA/nHAp ställningar 0.6 mm i höjd och 4 mm i diameter var fabricerade med en 3D-skrivare. Morfologier av ställningar analyserades via scanning electron microscopy och microCT. Figur 1A visar ett fotografi av den implanterade byggnadsställningen. MicroCT skanning visade att mer än 85% av porerna hade storlekar från 200 till 400 µm (figur 1B). SEM imaging visat att ytan av ställningen hade en grov microtopography, med mikroporer (diametrar ca 5-10 µm) som sammankopplade inuti ställningar (figur 1 D-F). Cirka 40% av den totala mängden belagda LV-andra partiklar (4,5 x 105) frigörs från de PLGA/nHAp ställningar började med en inledande burst effekt inom 24 h. Bioaktiviteten av utgivna LV virus nådde toppmötet på 24 h och sedan minskat kontinuerligt, närmar sig 0 120 h (figur 2). Dessa data indikerar att bioaktiviteten av mest byggnadsställning-orörlig LV partiklar kunde upprätthållas för upp till 96 timmar. MSCs-T migration kapacitet observerades med FACS metod att undersöka huruvida LV transporterar pdgf-b cDNA kan uttrycka och leda till BMSC Kemotaxis, som visas i figur 3. Både den positiva kontrollen (C) och gruppen PDGF-BB-uttryckande (F) uppvisade en betydligt högre nivå av BMSC migration än andra 4 grupper. Migrering av BMSCs i grupp F var dessutom betydligt högre än i grupp C. Det fanns inga signifikanta skillnader i BMSC migration bland andra 4 grupper.

Angiogenes inom ben defekten bedömdes från 2 till den 8: e vecka efter implantationen av MPM skanning. Figur 4A visar en Schematisk illustration av en mus under MPM skanning. Uppenbara angiogenes upptäcktes i grupperna PH och PHp, men blodkärl var knappt observeras i kontrollgruppen, där endast ett lager av fibrösa membran över regionen defekt bildas (figur 4B). GIF Graferna visar de blodkärl tomographs av varje grupp (Kompletterande Data). Den nya blodkärl gradvis ökat över tid i grupper PH och PHp, med liknande ökande mönster. Den 8: e veckan fanns fartygen liknande morfologi som observerats i tidigt skede; den enda förändringen var att ett ökande antal mindre fartyg växte in ställningar (figur 4B). BVA i gruppen PHp var betydligt högre än att av de andra två grupperna vid alla tidpunkter (figur 4 c). Dessutom fanns det många deponering av kollagen, som indikeras av SHG signaler (den gröna färgen i grafer och GIF grafer) i grupperna PH och PHp, men inte i kontrollgruppen (figur 4B).

För att klargöra förhållandet mellan PDGF-BB uttryck och angiogenes, jämförde vi genen avskrift uttrycksnivåerna av pdgf-b, vWFoch VEGFR2 med RT-qPCR-metoden vid 2, 4 och 8 veckor efter implantationen ( Figur 5). Som förväntat, ökades betydligt pdgf-b uttryck i gruppen PHp vid alla tidpunkter, med en 5 - till 13-gånger ökning jämfört med kontroll och PH grupper (figur 5A). Det var ingen signifikant skillnad mellan kontroll och PH grupp och uttryck PDGF-BB förblev nästan konstant från vecka 2 till vecka 8, som visas i figur 5A. De mRNA-uttrycksnivåerna för vWF och VEGFR2 i alla tre grupperna ökade gradvis och var den högsta i gruppen PHp alls tre tidpunkter (figur 5B och 5 C). För gruppen PH fanns det ingen statistisk signifikans jämfört med kontrollgruppen, trots uppenbara angiogenes (figur 4B).

Att ytterligare bekräfta att pdgf-b-innehållande ställningar främja bone regeneration i vivo med kritiskt storlek calvarial defekter hos hanmöss BALB/c, microCT skanning lämnat uppgifter för att bedöma ben regenerering vid 8 veckor efter implantation. Som visas i figur 6, var defekter i gruppen PHp fyllda med en massa nya ben vävnad inväxt i ställningar, medan det var mycket mindre nytt ben i kontroll och PH grupper.

Figure 1
Figur 1: strukturell karaktärisering av en 3D PLGA/nHAp byggnadsställning. (A) fotografi av en 3D tryckta byggnadsställning. (B), en microCT bild av den totala porositeten av ställningen. (C) microtopography av byggnadsställning ytan observeras av SEM på 60 X, 2,000 X (D), 5,000 X (E), och 10 000 X förstoring (F). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: beredning av Lentivirus och utvärdering av bioaktiviteten av LV-GFP partiklarna. (A) Schematisk bild av den lentiviral vector konstruktion. Efter 48 h av transfection observerades HEK - 293FT celler under ljus (B) och fluorescens fältförhållanden (C). (D) In vitro bedömning av bioaktiviteten av LV-GFP partiklarna kumulativt släppt från PLGA/nHAp ställningar. Alla data presenteras som den medelvärde ± SEM (n = 4). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3. PDGF-BB bioaktivitet som ett Potent kemotaktisk faktor svar BMSC migration. BMSCs-T (5 x 104) var seedad ovanpå transwell chambers, med olika villkor media placeras i botten av kamrarna. (A) tom kontroll, serumfritt medium; (B) FBS kontroll, medium kompletteras med 10% FBS; (C) PDGF-BB kontroll, 4 ng/mL PDGF-BB i serumfritt medium; (D) PDGF-BB gripa PDGF-BB-gruppen (4 ng/mL) och anti-PDGF-BB (4 ng/mL) polyklonala antikroppar i serumfritt medium; (E) BMSCs grupp, 2 x 105 BMSCs i serumfritt medium; och (F) BMSCs-P group, 2 x 105 BMSCs-P i serumfritt medium. Alla data visas som den medelvärde ± SEM (n = 4). #: jämförelse mellan grupp C och alla andra grupper utom grupp F, # p < 0,0001. *: jämförelse mellan grupp F och alla andra grupper, * p < 0,05, *** p < 0,0001. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Högupplösta Multiphoton mikroskopi (SHG/TPEF) avbildning och kvantifiering av angiogenes i regionen ben defekt i mus Calvaria.Trong > (A) A Schematisk illustration av en mus under MPM skanning. Orange cirkeln representerar den defekta platsen, de röda tubuli representerar blodkärl och gröna representerar kollagen. (B) Unoperated och opererade djur skannades med MPM på 8 veckor efter implantationen. SHG, TPEF, SHG/TPEF samman, och 3D-bilder visas. Den streckade linjen representerar gränsen längs benet defekten i kontrollgruppen baserat på SHG signaler. (C) blodkärl området kvantifiering inom området defekt av kontroll, PH och PHp från vecka 2 till vecka 8 efter implantation. Alla data visas som den medelvärde ± SEM (n = 5). : Statistisk analys mellan grupper PH och PHp, p < 0,0001. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: RT-qPCR-analys av pdgf-b (A) och angiogenes-relaterade gener vWF (B) och VEGRF2 (C) uttryck i tre grupper. Prover från 4 djur analyserades för varje tidpunkt. #: jämförelse mellan PHp och PH, # p < 0,05, # p < 0,01, och #p < 0,0001. *: jämförelse mellan PHp och kontroll, * p < 0,05, ** p < 0,01, och *** p < 0,0001. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Utvärdering av In Vivo benbildning med MicroCT skanning. Kontrollgrupp utan implanterade ställningar. PH grupp inom implanteras PLGA/nHAp byggnadsställning endast. PHp-gruppen inom implanterade PLGA/nHAp byggnadsställning av LV- pdgfb partiklarna. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ben är en högt vaskulariserad vävnad med en unik förmåga att kontinuerligt läka och renovera under hela livstiden för en enskild1. Vaskularisering är viktigt för osteogenesis och defekt reparation. Låg vaskularisering begränsar bred klinisk tillämpning av vävnadstekniska ben. Att bygga ett högt vaskulariserad vävnad-engineered ben enligt teorin om Biomimetik har blivit ett verktyg för att reparera stora segment ben defekter. Olika typer av ställningar har tillämpats framgångsrikt för att reparera bendefekter som jämförelsevis små. Dock för kritiska ben defekter, tillämpningen av ställningar att reparera fortfarande ansikten hinder, främst på grund av otillräcklig blod leverera för defekt reparation. Därför är att förbättra blodtillförseln under processen för att reparera stora ben fel en av de stora frågorna i vävnadsteknik.

Människor använder bioaktiva material-belagd ställningar för att bidra till att upprätta de nödvändiga morfogenetiska fält som kan stimulera, rekrytera och främja den Kemotaxis, differentiering och spridningen av de celler som behövs för neovasculature och ben 37. Neovasculature i vävnadstekniska ställningar är nödvändigt för att cellerna får syre och näringsämnen, för avlägsnande av slaggprodukter, och i slutändan för uppfyllandet av funktionen av ställningar. Syftet med denna studie var att undersöka angiogenes med i vivo multiphoton mikroskopi i en genetiskt modifierade, 3D-tryckt PLGA/nHAp byggnadsställning för calvarial kritiska ben defekt reparation och att utvärdera effekterna av ben förnyelse med hjälp microCT.

Trots dramatiska resultat i ben vävnadsteknik, i vivo visualisering och kvantifiering av kärlnybildning i ställningar under ben är regenerering fortfarande en utmaning. Den mikroskopiska bildsystem är oförmögna att ge volymetriska information om angiogenes. Traditionella bildmedicinska metoder, såsom microCT, MRI och histologiska analyser, är destruktiva, komplicerat och arbetskrävande och har låga rumsliga upplösningar och lång bild förvärvandet gånger38. MPM imaging är dock en ny bio-imaging modalitet som kan fånga blodkärl signaler i vivo i ett högupplöst och minimalt invasivt sätt. Det ska kunna upptäcka nya fartyg tunnare än 10 µm (figur 4B). Förutom blodkärl bilder observerade vi också en massa nya kollagen nedfall (den gröna färgen i figur 4B) och GIF grafer i kompletterande material, som indikeras av SHG signaler, som visar benbildning vävnad från en annan vinkel. Teoretiskt, blodkärl bilder kunde erhållas utan den med hjälp av kontrastmedel. Men i den aktuella studien, vi brukade få bättre bilder av ett kontrastmedel och bort lokala hud för att säkerställa korrekt skanning djupet. Detta skulle vara onödigt när mer kraftfull bildsystem finns i framtiden för verkligt icke-invasiv imaging.

HAp är en biomedicinska material för ben vävnadsregeneration som används mycket på grund av dess bra osteoconduction och osteoinduction egenskaper. HAp har bra kapacitet av bindande DNA vektorer och behålla och stabilisera vektorer, inklusive virala vektorer39. Jämfört med microsized HAp, nanosized HAp partiklar besitter hög specifik yta och därför Visa bättre cellulära beteende och mekaniska egenskaper40. Av dessa skäl är nHAp partiklar en av komponenterna i ställningar. De yt- och tvärsnittsdata SEM-bilderna av PLGA/nHAp ställningen visas i figur 1 visar att de fabricerade ställningar uppvisar en väl sammankopplade pore struktur och fördelade porstorlek. Immobilisering av virus på biomaterial bärare kan påverka virusaktivitet. Därför testade vi bioaktiviteten av LV partiklar frigörs från ställningar genom att undersöka deras transfection aktivitet. De release profilerna av LV partiklar från ställningar och deras bioactivities var utvärderades in vitro-, visar den kontrollerade leveransen av bioaktiva LV partiklar i fem dagar (figur 2). Dessutom vår in vitro- studie fokuserade på PDGF-BB potential att stimulera migration av primära MSCs. Dessa resultat tyder på att LV partiklarna uttryckt bioaktiva PDGF-BB och effektivt stimulerad BMSC migration.

För att bekräfta kapacitet för angiogenes och bone regeneration i vivo, var PHp ställningar implanteras i murina calvarial kritiska ben defekter. Bildandet av blodkärl bekräftades med angiogena markörer, RT-qPCR-analys och blodkärl tätheter observerats med SHG/TPEF imaging. Båda av de två uppsättningarna av experiment visat att angiogenes och blodkärlsbildning förbättrades signifikant med behandling av genetiskt modifierade ställningar. Dessa resultat indikerar att PDGF-BB inte bara direkt stimulerar angiogenes, men också inducerar andra angiogenes-relaterade gener. Under tiden microCT mätningar visar att pdgf-b-innehållande ställningar avsevärt främjat benbildning jämfört med de omodifierade ställningar, vilket korrelerar väl med neovasculature i ställningen. Dessa resultat indikerar att genetiskt modifierade, bioaktiva ställningar avsevärt förbättra angiogenes och vävnad förnyelse.

De resultat som presenteras här visar att lentivirus-medierad genmodifiering av ställningar underlättar stora bendefekter defekt reparation i murina calvarial kritiska ben defekt modell, sannolikt genom förbättrad angiogenes. Dessutom ger i vivo MPM imaging ett unikt verktyg att förstå angiogenes och osteogenesis i ben ställningar och möjliggör ytterligare klargörande av huruvida en viss byggnadsställning är fördelaktigt att kärlnybildning. Intravital multiphoton mikroskopi imaging ger en modalitet för att förstå fysiologi och patofysiologi av angiogenes i vävnader och ställningar. Men finns det flera begränsningar när du använder denna teknik. Först, den kirurgisk beredningen kräver särskild sakkunskap. Inflammation som orsakas av outbildade drift kommer att avsevärt minska den MPM bildkvalitet. För det andra, på grund av den MPM imaging hastighetsbegränsning, en specialdesignad mus rakhuvudshållaren behövs för att minska de artefakter som orsakas av hjärtslag och andning. För det tredje för långsiktiga imaging, måste djur intraperitonealt eller intravenöst injiceras med saltlösning för att förhindra uttorkning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de har inga konkurrerande finansiella intressen.

Acknowledgements

Denna studie stöddes av Shenzhen Peacock programmet, Kina (nr. 110811003586331), Shenzhen grundläggande forskningsprogrammet (nr. JCYJ20150401150223631, Nr. JCYJ20150401145529020, och nej. JCYJ20160331190714896), Guangdong offentlig forskning och kapacitetsuppbyggnad särskilda programmet (nr 2015A020212030), National Natural Science stiftelsen Kina (nr. 81501893), National Major Basic forskningsprogrammet Kina (2013CB945503), och SIAT innovationsprogram för excellenta unga forskare (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics