Visualisere angiogenese av Multiphoton mikroskopi I Vivo i genmodifiserte 3D-PLGA/nHAp stillaset Calvarial kritisk bein defekt reparasjon

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en protokoll for å visualisere blodkar formasjonen i vivo og i sanntid i 3D stillaser av multiphoton mikroskopi. Angiogenese i genmodifiserte stillaser ble studert i murine calvarial kritisk bein feil modell. Flere nye blodkar ble oppdaget i behandling gruppen enn i kontroller.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Gjenoppbygging av kritisk størrelse bein mangler forblir en alvorlig klinisk problem på grunn av dårlig angiogenese i vev-konstruert stillaser under reparasjon, som gir opphav til en mangel på tilstrekkelig blodtilførsel og fører til nekrose av nye vev. Rask endometrial blodkar er en viktig forutsetning for nye vev overlevelse og integrasjon med eksisterende vert vev. De novo generering av blodkar i stillasene er en av de viktigste trinnene i å gjøre bein gjenfødelse mer effektivt, slik at reparasjon vev til å vokse til et stillas. For å håndtere dette problemet, brukes den genetisk modifisering av en biomateriale stillaset å akselerere angiogenese og osteogenesis. Imidlertid er visualisere og spore i vivo blodkar formasjonen i sanntid og tredimensjonale (3D) stillaser eller nye benvev fortsatt en hindring for bein vev engineering. Multiphoton mikroskopi (MPM) er en roman bio-imaging modalitet som kan skaffe volumetriske data fra biologiske strukturer på en høy oppløsning og minimal-invasiv måte. Målet med denne studien var å visualisere angiogenese med multiphoton mikroskopi i vivo i en genetisk modifisert 3D-PLGA/nHAp stillaset calvarial kritisk bein defekt reparasjon. PLGA/nHAp stillaser var functionalized for vedvarende levering av et vekstfaktor pdgf-b gen bærer lentiviral vektorer (LV -pdgfb) for å lette angiogenese og å styrke bein gjenfødelse. I et stillas-implantert calvarial kritisk bein defekt musemodell, blodkar områder (BVAs) i PHp stillaser var betydelig høyere enn i PH stillaser. I tillegg økt uttrykk for pdgf-b og angiogenese-relaterte gener, vWF og VEGFR2, tilsvarende. MicroCT analyse indikerte at nye bein dannelsen i gruppen PHp dramatisk forbedret i forhold til andre grupper. Vi vet er dette første gang multiphoton mikroskopi ble brukt i bein vev utvikling for å etterforske angiogenese i en 3D bio-nedbrytbar stillaset i vivo og i sanntid.

Introduction

Ben er en svært vascularized vev som fortsetter å remodel i løpet av en individuell1. Rask og effektiv benet fornyelse av store bein mangler fra traumer, nonunion, svulst resections eller craniofacial misdannelser er en kompleks fysiologisk prosess. Tradisjonelle behandlingsmetoder brukes for bein defekt reparasjon inkluderer autograft og allograft implantasjon, men bruken innebærer flere problemer og begrensninger som begrenset tilgjengelighet, betydelig donor området sykelighet, høy risiko for infeksjon, og vert uimottakelig avvisning2,3. Men tilbyr kunstig bein grafts et alternativ for å lindre disse begrensningene. De kan være laget av biologisk nedbrytbart materiale, er lett å være dikte med en egnet porestørrelse, og kan være genetisk modifisert4,5.

Foreløpig har ulike vev engineering stillaser vært ansatt i utviklingen av vev-konstruert Ben6,7. For å indusere bein reparasjon og regeneration mer effektivt, har konstruert biologisk materiale kombinert med vekstfaktorer dukket opp og oppnådd gode resultater8,9. Dessverre, kort halveringstid, lett å miste aktivitet og supraphysiological dosering av vekstfaktorer for terapeutiske effekten begrense deres klinisk anvendelse10. For å overvinne disse problemene, har levering av vekstfaktor gener i stedet for vekst faktorer vist som en effektiv tilnærming til å opprettholde bioactivity for behandling av osseous feil og sykdommer11,12. Viral vektorer er lovende levering verktøy for vev gjenfødelse på grunn av sin høye uttrykke effektivitet13.

Blant vekstfaktorer, ble blodplater-avledet vekst faktor (PDGF-BB) valgt i denne studien fordi det er ikke bare en mitogen og chemoattractant for mesenchymal og osteogenic celler, men også en stimulerende for angiogenese14,15 . Tidligere prekliniske og kliniske studier viste at PDGF-BB kan trygt og effektivt fremme bein reparasjon i periodontal osseous feil16,17. Nyere studier viser at PDGF-BB stimulerer angiogenese av motiverende endothelial celle migrasjon og spredning i vivo18,19. Videre kan PDGF-BB også gjengi stamceller (MSCs) i stand til å skille i endotelceller20, og denne flere høydepunkter MSCs potensielle rolle i neovascularization. Derfor er inducing de novo dannelsen av blodkar i stillaser med PDGF-BB et viktig skritt for reparasjon av vev vokst til stillaser i bein vev engineering.

Bein defekt healing er en dynamisk vev Morfogenetiske prosess som krever koordinert osteogenesis og angiogenese på reparere posisjoner21. Neoangiogenesis i implantert vev-konstruert stillasene er en viktig forutsetning for å forsyne celler med næringsstoffer og oksygen for vekst og overlevelse og fjerner metabolske avfall. Brukte imaging metoder, beregnet inkludert X-ray mikro-tomografi (microCT), magnetisk resonans imaging (MRI), skanning elektronmikroskop (SEM), optical coherence tomografi (OCT) og AC confocal laserskanning mikroskopi, brukes i stedet for histologiske undersøkelser for angiogenese informasjon22,23. Men møte metodene ulike hindringer i visualisere og måler neovasculature i 3D stillaser i bein vev engineering. Multiphoton mikroskopi (MPM) er en relativt ny bio-tenkelig teknikk som har klar fordel av å visualisere celler, ekstracellulær matrix, og rundt vaskulære nettverk samtidig i vivo. Det har en iboende tredimensjonale imaging evnen for dype vev penetrasjon og forårsaker lav photodamage. Derfor, i det siste tiåret, MPM har fått mye oppmerksomhet i biomedisinsk studier24, inkludert i nevrovitenskap, immunologi og stamcelleforskningen dynamics. Men er det knapt brukt i Ortopedisk forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

dyr omsorg var i samsvar med veiledningen og bruk av laboratoriet dyr av Guangdongprovinsen. Alle prosedyrer ble utført under veiledning og godkjenning av den etiske komiteen for dyr forskning, Shenzhen institutter for avansert teknologi, kinesiske Academy of Sciences.

1. lentiviral (LV) produksjon

  1. klone pdgf-b cDNA i en lentiviral uttrykk vektor (pLenti6/5-eGFP eller LV-eGFP) på en tilpasset flere-kloning området nedstrøms til cytomegalovirus promoter bruker Spe jeg og Sal Jeg begrensning nettsteder å konstruere pLenti6/5-PDGFB-eGFP plasmider (LV - pdgfb) 25.
  2. Produserer lentiviral partikler (LV - pdgfb) fra HEK - 293 FT celler ved co transfecting med virus emballasje plasmider (pLP1, pLP2 og pVSV-G) ved hjelp av standard kalsium fosfat metoden med chloroquine (siste konsentrasjon: 25 µM) 25.
  3. etter 48 timer med transfection, høste og filtrere 500 mL virus inneholder supernatant med et filter (0,45 µm). Deretter konsentrere de virus partiklene av ultracentrifugation 89.000 x g for 2 h. Resuspend i 200 µL fosfat-bufret saltoppløsning (PBS), aliquot, og lagre på-80 ° C.
  4. For å bestemme titer av lentivirus, ruge HEK293T celler med serielt utvannet lentiviral løsning for 24t og beregne den lentiviral titer, som beskrevet tidligere 25.

2. Fabrikasjon av 3D-trykt PLGA/nHAp stillaser og LV immobilisering

  1. oppløse 20 g av PLGA (Poly D, L-lactide-co-glycolide) materiale i 20 mL 1,4-dioxane å danne en homogen løsning. Legg 2 g nanosized HAp (nano-hydroxyapatide) pulver (nHAp) til løsningen; PLGA: nHAp forholdet skal være 10:1 (w/w).
  2. Rør blandet løsningen kraftig (omrøring hastigheten: 1500 rpm) ved romtemperatur for 16 h med en magnetisk rørestang for å danne en enhetlig lim. Dikte den i porøse PLGA/nHAp stillaser bruker en 3D lav temperatur skriver med datastyrt munnstykke som innskudd lim lag-på-lag, nederst til toppen, ifølge en forhåndsutformet modell 26; pore filstørrelser stillasene spenner fra 200 til 400 µm.
  3. Vakuum freeze-dry stillasene 48 h fjerne løsemiddel så fullstendig som mulig. Suge stillasene i 75% etanol løsning 1 h for sterilisering og lyophilize for å få nøytrale, aseptiske stillaser.
    Merk: Store parameterne for vakuum Frysetørring inkluderer kondens temperatur (° C) og vakuum grad (Pa). Under en vakuum grad av 45 Pa, PLGA/nHAp stillasene var vakuum frysetørket ved-78 ° C i 48 timer til å grundig fjerne løsemiddelet.
  4. Legge til 10 µL av LV partikler (4.5 x 10 5) til hver PLGA/nHAp stillas (4 mm x 4 x 2 mm) og Inkuber stillasene 2 h på 37 ° C i en fuktet inkubator å tillate adsorpsjon.
  5. Etter immobilisering, skyll stillasene to ganger med PBS fjerne ubundet LV partikler. Snapin-fryse LV partikkel-belagt stillasene i flytende nitrogen, lyophilize igjen og lagre-80 ° c for fremtidig bruk.

3. In Vitro Kinetics LV partikkel utgivelse fra stillaser og LV signaltransduksjon aktivitet analysen

  1. Incubate 3D stillaser (4 mm x 4 x 2 mm) med LV-grønne fluorescerende protein (LV-eGFP, 4,5 x 10 5 LV partikler) i 1 mL av fullstendig DMEM i 2.0 mL kryogene ampuller på 37 ° C med skjelvende i 5 dager.
  2. Ta en 1 mL prøve hver 12t fra 12t til 120 timer etter inkubasjon og erstatt medium. På hvert punkt, legger 1 mL av fersk medium i stedet for 1 mL av inkubasjon medium.
  3. Bruker samlet media til å transduce HEK293T celler av co rugende for 48 h. måle antall bioaktive LV partikler av bestemme antall GFP-positive HEK293T celler av flyt cytometri 27.
    1. Før transducing HEK293T cellene, fjerne kultur medium og skyll HEK293T cellene to ganger med PBS. Legg det samlet inn mediet som inneholder lentivirus løslatt fra stillasene til brønnen (1 mL/vel) og kultur med HEK293T celler for 48 h på 37 ° C i en fuktet inkubator.

4. In Vitro Vurdering av Ben margtransplantasjon-avledet MSC (BMSC) overføring

  1. før overføringen analysen, forberede BMSCs uttrykke tomat fluorescerende protein (BMSCs-T) og PDGF-BB protein (BMSCs-P) 28.
  2. Utføre BMSC overføring analysen med en Boyden kammer med en 24-vel plate og polykarbonat filtre med en porestørrelse på 8 µm.
    1. Plass 0,5 mL BMSCs (5 x 10 4) transfekterte med LV uttrykke tomat fluorescerende protein (BMSCs-T) i den øverste kammer. Plasser 0,5 mL av BMSCs (2 x 10 5) transfekterte med LV uttrykke PDGF-BB protein (BMSCs-P) i lavere kamre.
  3. Inkluderer seks grupper i dette eksperimentet og legge 500 µL lavere rommet hver brønn.
    A. tom kontroll, serum-free middels bare
    B. FBS kontroll, middels med 10% FBS
    C. PDGF-BB kontroll, 4 ng/mL PDGF-BB i serum-free medium
    D. PDGF-BB gripe gruppen PDGF-BB (4 ng/mL) og anti-PDGF-BB (4 ng/mL) polyklonale antistoff serum-free medium
    E. BMSC gruppe, 2 x 10 5 BMSCs i serum-free medium
    F. BMSCs-P group, 2 x 10 5 BMSCs-P i serum fri medium.
  4. Ruge for 48 h på 5% CO 2 og 37 ° C i en fuktet inkubator. Etterpå, fjerne de overførte cellene i nedre kammeret side og samle dem for kvantifisering av antall BMSCs-T av flowcytometri.
    1. Fjern overførte celler i nedre kammeret side bruker en celle skraper og resuspend overførte cellene med 2 mL PBS. Kvantifisere Antall overførte BMSCs-T av flyt cytometri 29.

5. Etablering av en Murine Calvarial kritisk bein feil modell og stillaset transplantasjon

Merk: mannlige BALB/c mus (7 uker gamle) ble kjøpt fra Guangdong medisinsk laboratorium dyr Senter (Guangdong, Kina).

  1. Registrer totalt 42 mannlige mus for calvarial bein feilen eksperimenter. Tilfeldig dele musene i tre grupper, med fjorten i hver gruppe motta følgende behandlinger: gruppe A, ingen implantater; Gruppe B, PH stillaser implantert (PLGA/nHAp); og gruppe C, PHp stillaser implantert (PLGA/nHAp/LV-pdgfb).
  2. Bedøve dyrene med intraperitoneal administrasjonen av natrium pentobarbital (50 mg/kg). Fjern pels med depilatory lim og rengjør hodet huden med 75% alkohol-løsning før den første snittet. Fastsette hodet av hver mus med et stereotactic instrument å holde den fortsatt under operasjonen.
  3. Gjør en første snitt med en skalpell og så forstørre det viddh saks til å opprette en 1 cm lineær huden snitt. Skrape periosteum fra benet i kraniet å avsløre bein overflaten av skallen med en bakteriefri bomullspinne.
  4. Bruker en trephine burr opprette en 4 mm-diameter kritisk størrelse defekt på venstre side av calvaria 30. Transplantasjon stillaset i bein defekt området.
    Merk: Kritisk størrelse defekter (verdipapirsentraler) ble opprinnelig definert som " minste barnefot for intraossøs sår i en bestemt bein og dyrearter som ikke vil helbrede spontant i løpet av det dyr. " i dette eksperimentet, 4 mm-diameter feilen er en kritisk størrelse bein defekt, ifølge den tidligere studere 31 , 32.
  5. Bruk ophthalmica tang for å flytte periosteum tilbake forsiktig å dekke det kirurgiske området. Sutur radert huden med tre masker pr. cm.
  6. Utføre post-operational omsorg. Administrere smertestillende buprenorfin (0,1 mg/kg) for å lindre smerter. Opprettholde kroppstemperatur med en varmeputen til dyret våkner. Deretter mate dyrene med mat og vann og registrere aktiviteten deres hver dag fram til slutten av testen. Merk: Analgesi kan administreres før prosedyren avhengig av din lokale dyr omsorg komiteen retningslinjer.

6. I Vivo Imaging av angiogenese i bein feil med MPM

Merk: FITC-konjugerte 250 kD dekstran (10 mg/mL) i saltvann var intravenøst injiseres i mus å få høy-SNR (signal-to-noise ratio) bilder av nye blodkar Ifølge en tidligere studie 33. Vær oppmerksom på at dette er en overlevelse prosedyre.

  1. montere multiphoton mikroskopi (MPM) systemet for to-fotonet spent fluorescens (TPEF) og andre harmonisk generasjon signal (SHG) bildebehandling.
  2. Anaesthetize dyr med en intraperitoneal injeksjon av pentobarbital natrium (50 mg/kg) og nakkens dyrene på en oppvarming plate å opprettholde deres kroppstemperatur på 37 ° C gjennom eksperimenter. Bruk 3.0% isoflurane gass i 100% oksygen til å opprettholde tilfredsstillende anestesi og analgesi under avbildingsprosessen. Intraperitoneally injisere saltvann (200 µL/dyr) for å hindre dehydrering før bildebehandling.
  3. Tune at femtosecond Ti-Safirglass laseren 860 nm. Opprette en 512 x 512 µm Prøvetakingsområdet ved å skanne et par galvo speil og bruke NA1.0 vann nedsenking linsen til focusthe eksitasjon bjelke i utvalget og samle backscattered TPEF/SHG signalet.
    Merk: Avbilding ble utført på en hjem-bygge multiphoton mikroskopiske tenkelig system (MPM). Under bildebehandling, var en femtosecond Ti-Safirglass laser innstilt 860 nm som optimal eksitasjon bølgelengde. Laserstrålen var raster skannet over et eksempel fly med en galvanometer speil. Etter å ha passert gjennom en dichroic speil av 685 nm, strålen ble fokusert på prøven av en 20 X NA1.0 målsetting. Indusert TPEF og SHG signalene ble samlet av samme mål. Signalene ble delt fra eksitasjon laser av det dichroic speilet nevnt ovenfor og renset av et 680-nm kort-pass filter. TPEF og SHG signalene ble samlet av en fiber bunt og gjennomført en spectrograph. Detektoren på spectrograph var en lineær rekke photomultiplier rør (PMTs). Kombinasjonen av spectrograph og lineær array PMTs tilbys muligheten til å ta opp signalet i 16 påfølgende spectral band, fra 400 nm 600 nm, på 12,5-nm intervaller. Derfor ble TPEF og SHG signalene oppdaget samtidig og skilt i spektral domener. Videre for 3D-bildebehandling, ble en aksial motor brukt til å kontrollere tenkelig dybden. Området av hvert bilde var satt til 512 x 512 µm og dybde intervallet satt til 2 µm (kontrollgruppen, 5 µm). Spesielt, 5 sider på hver feil ble fotografert for å samle statistisk signifikante data, og de valgte tenkelig områdene ble distribuert jevnt og tilfeldig langs feilen.
  4. Skanne 5 steder på hver feil å samle statistisk signifikante data for å måle fartøyet formasjonen.
    1. Bruk skanning plass jevnt og tilfeldig fordelt langs feilen. Kontrollgruppen, har feltet vise (FOV) dekker både det opprinnelige Ben området og kanten av feilen, men PH og PHp grupper, har FOV på implantert stillaset.
    2. Gjør en 1 cm lineær huden snitt ved hjelp av en skalpell og Sutur åpne huden å fiksering å avsløre webområdet transplantasjon. Bruk en sprøyte for å plassere en dråpe vann mellom dipping linsen og transplantasjoner å danne en vann glass.
  5. Anskaffe bildet stabler hver 12 s over en 2t imaging periode. Vise og analysere volumetriske data ved hjelp av et egendefinert MATLAB-program og kvantifisere blodkar områdene med ImageJ programvare 34 , 35.

7. Gene Expression analyse av pdgf-b og angiogenese-relaterte gener av RT-qPCR

Merk: PCR ble utført vanlige fremgangsmåten: 95 ° C for 30 s, 40 sykluser av 95 ° C for 5 s og 60 ° C for 30 s. innlegget PCR smelting kurver bekreftet spesifisiteten av single-target forsterkning, og kaste endring av genet av interesse i forhold til β-utgangen var bestemt. Reaksjonen for hver prøven ble testet tre ganger.

  1. Harvest implantert stillaser og vev fra experimental musene på 2, 4 og 8 uker etter operasjon 36; kontrollere gruppe prøver (n = 4), tatt på samme tidspunkt, bør være fra tilstøtende benvev.
    Merk: På hvert punkt (2, 4 og 8 uker), euthanized mus med CO 2 innånding. Dissekere calvaria og deretter fjerne og høste implantert stillasene fra calvaria.
  2. Bruker en kommersiell reagens å pakke ut den totale RNA fra hver prøve ifølge produsenten ' s-protokollen. Bruker omvendt transkripsjon Kit for å reversere-transkribere RNA i cDNA etter produsenten ' s protokollen.
  3. Utføre kvantitativ sanntid PCR bruker SYBR Green Detection System; primerne er oppført i tabell 1.
Primer(5'–3')
Gene fremover omvendt
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-utgangen GTATCCATGAAATAAGTGGTTAC AGG GCAGTACATAATTTACACAGAAG CAAT

tabell 1: Pimer sett.

8. MicroCT analyse av bein gjenfødelse

  1. Euthanize mus med CO 2 innånding for 8 uker etter operasjon. I et godt ventilert miljø, forsiktig plassere hver musen i en ren mus bur og pumpe CO 2 gass i byrået å anaesthetize mus før euthanasia.
  2. Dissekere skallen for microCT avbildning av bein defekt regionen. Bruker følgende skanning parametere i eksperimenter: 9 µm oppløsning, Al 0,5 mm filter, 50 kV spenning og 142 µA gjeldende.
  3. ReconStruct alle tenkelig data ved hjelp av kommersiell programvare levert av selskapet. Kalibrere skanner funksjonen kalibrering av en CTAn programvare.
    Merk: Sett en Hounsfield enhet (HU) under mus i hver skanning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Sylindrisk porøse PLGA/nHAp stillaser 0.6 mm inne høyde og 4 mm i diameter, ble laget med en 3D-skriver. Morphologies av stillasene ble analysert via skanning elektronmikroskop og microCT. Figur 1A viser fotografiet av implantert stillaset. MicroCT skanning viste at mer enn 85% av porene hadde størrelser fra 200 til 400 µm (figur 1B). SEM imaging vist at overflaten av stillaset hadde en grov microtopography, med micropores (diameter ca 5-10 µm) som sammen inne stillasene (figur 1 D-F). Ca 40% av den totale mengden belagt LV-eGFP partikler (4.5 x 105) fra PLGA/nHAp stillasene startet med en innledende burst effekt innen 24 timer. Bioactivity utgitte LV virus nådde toppen på 24 h og deretter redusert kontinuerlig, nærmer seg til 0 på 120 timer (figur 2). Disse data indikerer at bioactivity mest stillaset-immobilisert LV partikler kan opprettholdes for opptil 96 h. Overføring kapasitet MSCs-T ble observert med metoden FACS undersøke om LV bærer pdgf-b cDNA kunne uttrykke og føre til BMSC chemotaxis, som vist i Figur 3. Både positive kontrollen (C) og PDGF-BB-uttrykke gruppen (F) viste et betydelig høyere nivå av BMSC overføring enn andre 4 grupper. I tillegg var migrering av BMSCs i gruppe F betydelig høyere enn i gruppe C. Det var ingen betydelige forskjeller i BMSC migrasjon blant andre 4 grupper.

Angiogenese i bein feilen ble vurdert fra 2 til 8 uken etter implantation av MPM skanning. Figur 4A viser en skjematisk illustrasjon av en mus under MPM skanning. Åpenbare angiogenese ble oppdaget i PH og PHp grupper, men blodkar var knapt observerbare i kontrollgruppen, der bare et lag av fibrøst membraner over regionen defekt dannet (figur 4B). GIF grafene viser blod fartøy tomographs i hver gruppe (Utfyllende Data). Området av blodkar økt gradvis over tid i grupper PH og PHp, med lignende økende mønstre. På 8nde uke syntes fartøyene ligner i morfologi observert på et tidlig stadium; den eneste endringen var at et økende antall mindre fartøyer vokste i stillaser (figur 4B). BVA av gruppen PHp var betydelig høyere enn at andre to gruppene til enhver tid poeng (figur 4C). Videre var det mange kollagen deponering steder, som indikert av SHG signaler (grønn fargen i grafer og GIF grafer) i PH og PHp grupper, men ikke i kontrollgruppen (figur 4B).

For å avklare forholdet mellom PDGF-BB uttrykk og angiogenese, sammenlignet vi genet transkripsjon uttrykk nivåer av pdgf-b, vWFog VEGFR2 med metoden RT-qPCR på 2, 4 og 8 uker etter implantasjon ( Figur 5). Som forventet, var pdgf-b uttrykk betydelig økt i PHp-gruppen på alle tidspunkt, med en 5 til 13 ganger økning sammenlignet med kontroll og PH grupper (figur 5A). Det var ingen signifikant forskjell mellom kontrollen og PH-gruppen, og hvilket uttrykk PDGF-BB forble nesten konstant fra uke 2 uke 8, som vist i figur 5A. MRNA uttrykk nivåene av vWF og VEGFR2 i alle tre grupper økt gradvis, og var den høyeste i PHp-gruppen på alle tre gang poeng (figur 5B og 5 C). For gruppen PH, det var ingen statistisk signifikans sammenlignet med kontrollgruppen, til tross for åpenbare angiogenese (figur 4B).

For ytterligere å bekrefte at pdgf-b-inneholder stillaser fremme bein gjenfødelse i vivo med kritisk størrelse calvarial feil i mannlige BALB/c mus, microCT skanning gitt beskjed å vurdere bein gjenfødelse ved 8 uker etter implantasjon. Som vist i figur 6, var defekter i gruppen PHp fylt med en masse nye bein vev ingrowth i stillasene, mens det var mye mindre ny bein i kontroll og PH grupper.

Figure 1
Figur 1: strukturelle karakterisering av en 3D PLGA/nHAp-stillaset. (A) fotografi av en 3D trykt stillaset. (B) en microCT bilde av den samlede porøsitet av stillaset. (C) microtopography av stillaset overflaten observert av SEM på 60 X, 2000 X (D), 5000 X (E), og 10 000 X forstørrelse (F). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Forberedelse av Lentivirus og evaluering av Bioactivity til LV-GFP partikler. (A) skjematisk fremstilling av lentiviral vektor Konstruer. Etter 48 timer med transfection, ble HEK - 293FT celler observert under lys (B) og fluorescens feltundersøkelser (C). (D) In vitro vurdering av bioactivity i LV-GFP partikler kumulativt løslatt fra PLGA/nHAp stillaser. Alle data presenteres som gjennomsnittlig ± SEM (n = 4). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3. PDGF-BB Bioactivity som et Potent Chemotactic faktor svar BMSC migrasjon. BMSCs-T (5 x 104) var frø på transwell chambers, med ulike tilstand medier plassert i bunnen av kamrene. (A) tom kontroll, serum-free medium. (B) FBS kontroll, medium med 10% FBS; (C) PDGF-BB kontroll, 4 ng/mL PDGF-BB i serum-free medium; (D) PDGF-BB gripe gruppen PDGF-BB (4 ng/mL) og anti-PDGF-BB (4 ng/mL) polyklonale antistoffer i serum-free medium; (E) BMSCs gruppe, 2 x 105 BMSCs i serum-free medium; og (F) BMSCs-P group, 2 x 105 BMSCs-P i serum-free medium. Alle dataene vises som den gjennomsnittlig ± SEM (n = 4). #: sammenligning mellom gruppe C og alle andre grupper, bortsett fra gruppe F, # p < 0,0001. *: sammenligning mellom gruppe F og alle andre grupper, * p < 0,05, *** p < 0,0001. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Høyoppløselig Multiphoton mikroskopi (SHG/TPEF) bildebehandling og kvantifisering av angiogenese i regionen bein defekt i musen Calvaria.trong > (A) A skjematisk illustrasjon av en mus under MPM skanning. Oransje sirkelen representerer området defekt på rød tubuli representerer blodkar og grønne representerer kollagen. (B) Unoperated og opererte dyr ble skannet med MPM på 8 uker etter implantasjon. SHG, TPEF, SHG/TPEF flettes og 3D-bilder vises. Den stiplede linjen representerer grensen langs bein feilen i kontrollgruppen basert på SHG signaler. (C) blod fartøy området kvantifisering innen defekt kontroll, PH og PHp fra uke 2 til uke 8 etter implantasjon. Alle dataene vises som den gjennomsnittlig ± SEM (n = 5). : Statistisk analyse mellom grupper PH og PHp, p < 0,0001. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: RT-qPCR analyse av pdgf-b (A) og angiogenese-relaterte gener vWF (B) og VEGRF2 (C) uttrykk i tre grupper. Prøver fra 4 dyr ble analysert for hvert punkt. #: sammenligning mellom PHp og PH grupper, # p < 0,05, # p < 0.01, og #p < 0,0001. *: sammenligning mellom PHp og kontroll grupper, * p < 0,05, ** p < 0.01, og *** p < 0,0001. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: Evaluering i Vivo bein formasjonen MicroCT skanning. Kontrollgruppe uten implantert stillaser. PH gruppe i implantert PLGA/nHAp stillaset bare. PHp gruppe i implantert PLGA/nHAp stillaset endret av LV- pdgfb partikler. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ben er en svært vascularized vev med en unik evne til å helbrede og renovere av en individuell1kontinuerlig. Endometrial blodkar er viktig for osteogenesis og defekt reparasjon. Lav endometrial blodkar begrenser bredt klinisk anvendelse av vev-konstruert ben. Konstruere en svært vascularized vev-konstruert Ben ifølge teorien om biomimetics har blitt et verktøy for å reparere stort segment bein mangler. Ulike typer stillasene er vellykket brukt for å reparere forholdsvis lite osseous mangler. Men for kritiske bein mangler, anvendelse av stillaser reparere fortsatt ansikter hindringer, hovedsakelig på grunn av utilstrekkelig blod levere defekt reparasjon. Derfor er å forbedre blodtilførselen under prosessen med å reparere store bein feil en av de store problemene i vev engineering.

Folk bruker bioaktive materiale-belagt stillaser for å etablere de nødvendige Morfogenetiske feltene som kan stimulere, rekruttere og fremme chemotaxis, differensiering, og spredning av cellene trengs for neovasculature og beindannelse 37. Neovasculature i vev-konstruert stillasene er avgjørende for cellene å få oksygen og næringsstoffer, fjerning av avfall produkter, og til slutt for oppfyllelsen av den stillaser. Målene med denne studien var å undersøke angiogenese med i vivo multiphoton mikroskopi i en genetisk modifisert, 3D-trykt PLGA/nHAp stillaset calvarial kritisk bein defekt reparasjon og evaluere effekten av bein gjenfødelse bruker microCT.

Til tross for dramatiske prestasjoner i bein vev engineering, i vivo visualisering og kvantifisering av neovascularization i stillaser under bein er gjenfødelse fortsatt en utfordring. Mest mikroskopiske imaging-systemer ikke klarer å gi volumetriske informasjon om angiogenese. Tradisjonelle tenkelig metoder, som microCT, MRI og histologiske analyser, er destruktive, kompliserte og arbeidskrevende og lav romlig oppløsning og lang bildeopptak ganger38. MPM imaging er imidlertid en roman bio-imaging modalitet som kan ta blod fartøy signaler i vivo på en høy oppløsning og minimal invasiv måte. Det er kjøpedyktig merker nye fartøyer tynnere enn 10 µm (figur 4B). Foruten blodkar bilder observert vi også en masse nye avleiring av kollagen (grønn fargen i figur 4B) og GIF grafene i supplerende materiale, som indikert av SHG signaler som indikerer bein vev formasjonen fra en annen vinkel. Teoretisk kan blodkar bilder fås uten hjelp av kontrast agenter. Men studien, vi brukte en kontrast agent for å få bedre bilder og fjernet innenbys hud for å sikre riktig skanning dybden. Dette ville være unødvendig når kraftigere imaging-systemer er tilgjengelig i fremtiden for virkelig ikke-invasiv bildebehandling.

HAp er en biomedisinsk materiale bein vev gjenfødelse som er mye brukt på grunn av sine gode osteoconduction og osteoinduction egenskaper. HAp har god evne bindende DNA vektorer og beholde og stabilisere vektorer, inkludert viral vektorer39. Sammenlignet med microsized HAp, nanosized HAp partikler har høy bestemt flater og derfor vise bedre mobilnettet atferd og mekaniske egenskaper40. For disse grunner er nHAp partikler en av komponentene i stillasene. Overflate og cross-sectional SEM bilder av PLGA/nHAp stillaset vist i figur 1 angir at fabrikkerte stillasene ha et godt sammen pore strukturen og jevnt fordelt pore størrelser. Immobilisering av virus på biomateriale bærere kan påvirke virusaktivitet. Derfor testet vi bioactivity LV partikler løslatt fra stillasene ved å undersøke deres transfection aktivitet. Utgivelsen profiler LV partikler fra stillasene og deres bioactivities var vurdert i vitro, demonstrere kontrollert levering av bioaktive LV partikler i fem dager (figur 2). Videre våre i vitro studier fokuserte på potensialet til PDGF-BB å stimulere migrering av primære MSCs. Disse resultatene tyder på at LV partikler uttrykt bioaktive PDGF-BB og effektivt stimulert BMSC migrasjon.

For å bekrefte kapasiteten for angiogenese og bein gjenfødelse i vivo, ble PHp stillaser implantert i murine calvarial kritisk bein mangler. Fartøyet formasjon ble bekreftet med angiogenic markører, RT-qPCR analyse og blodkar tettheter observert med SHG/TPEF bildebehandling. Begge de to settene av eksperimenter har vist at angiogenese og blodkar dannelse ble betydelig forbedret med behandling av genmodifiserte stillaser. Disse resultatene indikerer at PDGF-BB ikke bare direkte stimulerer angiogenese, men også induserer andre angiogenese-relaterte gener. I mellomtiden microCT målinger viser at pdgf-b-inneholder stillaser betydelig forfremmet bein formasjon sammenlignet med uforandret stillasene, som korrelerer med neovasculature i stillaset. Disse resultatene indikerer at genmodifiserte, bioaktive stillaser forbedre angiogenese og vev gjenfødelse.

Resultatene presenteres her viser at den lentivirus-mediert genmodifisering av stillaser muliggjør store osseous defekt reparasjon i murine calvarial kritisk bein feil modell, sannsynligvis gjennom forbedret angiogenese. I tillegg gir i vivo MPM imaging et unikt verktøy å forstå angiogenese og osteogenesis i bein stillaser og muliggjør ytterligere forklaring om en bestemt stillaset er gunstig for neovascularization. Intravital multiphoton mikroskopi imaging gir en modalitet for å forstå fysiologi og patofysiologi av angiogenese i vev og stillaser. Det er imidlertid flere begrensninger når benytter denne teknikk. Først krever kirurgisk utarbeidelse spesialkompetanse. Betennelse forårsaket av ufaglærte operasjonen vil vesentlig redusere MPM imaging kvalitet. Andre på grunn av MPM imaging fart begrensning, er spesialdesignet mus hodet innehaver nødvendig å redusere gjenstander forårsaket av hjerteslag og åndedrett. Tredje for langsiktig bildebehandling, må dyr intraperitoneally eller intravenøst injiseres med saltvann å hindre dehydrering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at de har ingen konkurrerende økonomiske interesser.

Acknowledgements

Denne studien ble støttet av Shenzhen Peacock programmet, Kina (nr. 110811003586331), Shenzhen grunnleggende forskningsprogrammet (nr. JCYJ20150401150223631, nr. JCYJ20150401145529020 og nr. JCYJ20160331190714896), Guangdong offentlig forskning og kapasitetsbygging spesielle programmet (nr. 2015A020212030), National Natural Science Foundation i Kina (nr. 81501893), National Major Basic forskningsprogrammet Kina (2013CB945503), og Netthinnen innovasjon Program for utmerket unge forskere (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics