Visualizando a angiogênese por Multiphoton microscopia In Vivo no andaime de 3D-PLGA/nhập geneticamente modificado para raspagem crítico reparo de defeito ósseo

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos um protocolo para visualizar vasos sanguíneos formação em vivo e em tempo real em 3D andaimes por microscopia do multiphoton. Angiogênese em andaimes geneticamente modificados foi estudado em modelo murino raspagem de osso crítico defeito. Mais novos vasos sanguíneos foram detectados no grupo de tratamento do que em controles.

Cite this Article

Copy Citation | Download Citations

Li, J., Jahr, H., Zheng, W., Ren, P. G. Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair. J. Vis. Exp. (127), e55381, doi:10.3791/55381 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A reconstrução de defeitos ósseos criticamente tamanho permanece um problema clínico sério por causa do pobre angiogênese dentro engenharia de tecido andaimes durante o reparo, que dá origem a uma falta de oferta suficiente de sangue e provoca necrose dos tecidos novos. Rápida vascularização é um pré-requisito vital para a sobrevivência de tecido novo e integração com o tecido do hospedeiro existente. A geração de novo da vasculatura em andaimes é um dos passos mais importantes na tomada de regeneração óssea mais eficiente, permitindo a reparação do tecido a crescer em um andaime. Para resolver este problema, a modificação genética de um andaime de biomaterial é usada para acelerar a angiogênese e osteogênese. No entanto, visualização e acompanhamento na vivo formação de vasos sanguíneos em tempo real e em três dimensões (3D) andaimes ou novo tecido ósseo ainda é um obstáculo para a engenharia de tecido ósseo. Microscopia do multiphoton (MPM) é uma modalidade de bio-imagem romance que pode adquirir dados volumétricos de estruturas biológicas de forma minimamente invasivos e de alta resolução. O objetivo deste estudo foi Visualizar angiogênese com microscopia do multiphoton na vivo em um andaime de 3D-PLGA/nhập geneticamente modificado para reparo de defeito de fragmento ósseo crítico. Andaimes PLGA/nhập foram acrescidas para a entrega sustentada de um gene de factor de crescimento pdgf-b carregando Lentivirus vetores (LV -pdgfb) para facilitar a angiogênese e aumentar a regeneração óssea. Em um andaime implantados raspagem osso crítico defeito modelo do rato, as áreas de vaso sanguíneo (BVAs) em PHp andaimes foram significativamente maiores do que em PH andaimes. Além disso, a expressão de pdgf-b e genes relacionados com angiogênese, vWF e VEGFR2, aumentado correspondentemente. MicroCT análises indicaram que a formação de osso novo no grupo PHp dramàtica melhorado em comparação com os outros grupos. A nosso conhecimento, esta é a primeira vez que microscopia do multiphoton foi usada em engenharia de tecidos ósseo para investigar a angiogênese em um andaime biodegradável 3D em vivo e em tempo real.

Introduction

Osso é um tecido altamente vascularizado que continua a remodelar-se durante o tempo de vida de um indivíduo1. A regeneração óssea rápida e eficaz de defeitos de osso grande resultantes de trauma, pseudartrose, ressecções tumor ou malformações craniofaciais é um processo fisiológico complexo. Abordagens terapêuticas tradicionais utilizadas para reparo de defeito ósseo incluem implantação autograft e aloenxerto, mas sua utilização envolve vários problemas e limitações, como disponibilidade limitada, morbidez do local doador significativo, um alto risco de infecção, e Hospede de2,de rejeição imune3. No entanto, enxertos ósseos artificiais oferecem uma alternativa eficiente para aliviar essas limitações. Eles podem ser feitos de materiais biodegradáveis, são fáceis de ser fabricar com um tamanho de poro adequado e podem ser geneticamente modificados4,5.

Atualmente, vários andaimes de engenharia de tecidos têm sido empregadas no desenvolvimento da engenharia de tecido ósseo6,7. Para induzir a regeneração e reparação óssea mais eficazmente, engenharia biomateriais combinados com fatores de crescimento têm emergiu e alcançado bons resultados8,9. Infelizmente, a meia-vida curta, fácil-à-perder atividade e suprafisiológicas dosagem de fatores de crescimento para eficácia terapêutica limitam sua aplicação clínica10. Para superar estes problemas, demonstrou-se a entrega de genes de fator de crescimento, em vez de fatores de crescimento como uma abordagem eficaz para sustentar a bioatividade para o tratamento de defeitos ósseos e doenças11,12. Vetores virais são promissor entrega ferramentas para regeneração tecidual devido a sua alta eficiência13de expressar.

Entre os fatores de crescimento, fator de crescimento derivado de plaquetas (PDGF-BB) foi selecionada neste estudo porque é não só um mitógeno e quimiotático para células mesenquimais e osteogênicas, mas também um estimulante para a angiogénese14,15 . Estudos pré-clínicos e clínicos anteriores mostraram que PDGF-BB poderia com segurança e eficazmente promover reparação óssea em defeitos ósseos periodontais16,17. Estudos recentes revelaram que o PDGF-BB estimula angiogênese por motivação endothelial da pilha da proliferação e migração na vivo18,19. Além disso, PDGF-BB também pode processar as células-tronco mesenquimais (MSCs) capazes de se diferenciar em células endoteliais20e este mais destaca o papel potencial do MSCs na neovascularização. Portanto, induzindo a formação de novo da vasculatura em andaimes com PDGF-BB é um passo importante para a reparação do tecido crescido em andaimes em engenharia de tecido ósseo.

Defeito de consolidação é um processo morfogenético tecido dinâmico que requer coordenada osteogênese e angiogênese na reparação posições21. Neoangiogênese em andaimes engenharia de tecido implantados é um pré-requisito essencial para o fornecimento de células com nutrientes e oxigênio para o crescimento e sobrevivência e para a remoção de resíduos metabólicos. Comumente usado métodos de imagem, incluindo raios x micro computado-tomografia computadorizada (microCT), ressonância magnética (MRI), microscopia eletrônica de varredura (MEV), a tomografia de coerência óptica (OCT) e laser confocal, microscopia, são aplicados em vez de exame histológico para obter informações de angiogênese22,23. No entanto, estes métodos de enfrentam vários obstáculos em Visualizar e medir a neovasculature em 3D andaimes em engenharia de tecido ósseo. Microscopia do multiphoton (MPM) é uma técnica de bio-imagem relativamente nova que tem a vantagem distinta de simultaneamente Visualizar células, matriz extracelular e em torno de redes vasculares in vivo. Possui uma capacidade inerente de imagem tridimensional para penetração profunda do tecido e provoca baixo Fotodano. Daí, na última década, MPM tem ganhado muita atenção em estudos biomédicos24, incluindo em neurociência, imunologia e dinâmica de células-tronco. No entanto, quase não é usado em investigação ortopédica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

o cuidado animal estava em conformidade com o guia para o cuidado e o uso do laboratório de animais da província de Guangdong. Todos os procedimentos foram realizados sob a supervisão e aprovação do Comitê de ética para pesquisa Animal, Shenzhen institutos de tecnologia avançada, Academia Chinesa de Ciências.

1. produção de Lentivirus (LV)

site
  1. Clone do cDNA de pdgf-b em um vetor de expressão Lentivirus (pLenti6/5-eGFP ou LV-eGFP) em um múltiplo-clonagem personalizada a jusante do promotor citomegalovírus utilizando Spe eu e Sal Sites de restrição para construir o plasmídeo pLenti6/5-PDGFB-eGFP (LV - pdgfb) 25.
  2. Produzir particulas de Lentivirus (LV - pdgfb) de células HEK - 293 FT por co transfecting com plasmídeos de empacotamento de vírus (pLP1, pLP2 e pVSV-G) usando o método padrão de fosfato de cálcio com cloroquina (concentração final: 25 µM) 25.
  3. após 48 h de transfeccao, colheita e filtrar 500 mL de vírus contendo sobrenadante com um filtro (0,45 µm). Posteriormente, concentrar as partículas virais por ultracentrifugação a 89.000 x g durante 2 h. Ressuspender em 200 µ l de tampão fosfato salino (PBS), alíquota e armazene-o a -80 ° C.
  4. Para determinar o título de lentivirus, incubar HEK293T células com solução de Lentivirus serialmente diluída por 24 h e calcular o título Lentivirus, como descrito anteriormente 25.

2. Fabricação de andaimes PLGA/nhập 3D-impresso e imobilização LV

material
  1. dissolver 20 g de PLGA (Poly D, L-lactidas-co-glicolido) em 20 mL de 1,4-dioxano, para formar uma solução homogênea. Adicionar 2 g de nanosized pó de HAp (nano-hydroxyapatide) (nhập) para a solução; o PLGA: nhập relação deve ser de 10:1 (w/w).
  2. Agite a solução mista vigorosamente (agitando a velocidade: 1.500 rpm) à temperatura de 16 h, utilizando um agitador magnético para formar uma pasta uniforme. Fabricá-las em andaimes PLGA/nhập porosos usando uma impressora 3D de baixa temperatura com um bocal computadorizado que os depósitos de fundo colar camada por camada, topo, de acordo com um modelo pré-concebidos 26; os tamanhos de poros dos andaimes variam de 200 a 400 µm.
  3. Vácuo congela os andaimes para 48 h remover o solvente tão completamente quanto possível. Mergulhe os andaimes em solução de etanol 75% por 1h para esterilização e lyophilize para obter andaimes neutros, assépticos.
    Nota: Os parâmetros principais para vácuo liofilização incluem a temperatura de condensação (° C) e o grau do vácuo (Pa). Sob um grau de vácuo de 45 Pa, os andaimes PLGA/nhập foram vácuo liofilizado-78 ° c durante 48 h remover completamente o solvente.
  4. Adicionar 10 µ l de partículas de LV (4,5 x 10 5) para cada PLGA/nhập andaime (4 x 4 x 2 mm) e incube-os andaimes para 2 h a 37 ° C numa incubadora umidificado para permitir adsorção.
  5. Após a imobilização, enxagúe os andaimes duas vezes com PBS para remover partículas de LV desacopladas. Os andaimes de partículas revestidas de LV snap-congelamento em nitrogênio líquido, lyophilize novamente e armazenar a-80 ° C para uso futuro.

3. In Vitro Cinética de liberação de partículas LV de andaimes e ensaio da atividade transdução LV

  1. incubar 3D andaimes (4 x 4 x 2 mm) transporte verde LV-proteína fluorescente (LV-eGFP, 4.5 x 10 5 LV partículas) em 1 mL de DMEM completa em 2,0 mL criogênico frascos de 37 ° C, com agitação por 5 dias.
  2. Tirar uma amostra de 1 mL cada 12 h de 12 h de pós-incubação 120 h e substituir o medium. Em cada ponto de tempo, adicione 1 mL de meio fresco, em vez de 1 mL de meio de incubação.
  3. Usar a mídia coletada para transduce HEK293T células por co incubar por 48 h. medida que o número de partículas de LV bioativos, determinando o número de GFP-positivo HEK293T células por citometria de fluxo 27.
    1. Antes transducing as células HEK293T, remover o meio de cultura e enxágue as células HEK293T duas vezes com PBS. Adicionar mídia coletadas contendo lentivirus libertado os andaimes para o poço (1 mL/poço) e a cultura com as células HEK293T por 48 h a 37 ° C numa incubadora umidificado.

4. In Vitro Avaliação da migração da medula óssea-derivado de MSC (BMSC)

  1. antes do ensaio de migração, prepare BMSCs expressando a proteína fluorescente de tomate (BMSCs-T) e de proteína (BMSCs-P) de PDGF-BB 28.
  2. Realizar o ensaio de migração BMSC com uma câmara de Boyden usando uma placa de 24 e filtros de policarbonato com um tamanho de poro de 8 µm.
    1. Lugar 0,5 mL de BMSCs (5 x 10 4) transfected com LV expressando a proteína fluorescente do tomate (BMSCs-T) nas câmaras superiores. 0,5 ml de BMSCs (2 x 10 5) transfected com LV expressando a proteína PDGF-BB (BMSCs-P) nas câmaras inferiores.
  3. Incluir seis grupos neste experimento e adicionar 500 µ l para o compartimento inferior de cada poço.
    R. em branco controle, livre de soro médio apenas
    controle de B. FBS, meio suplementado com 10% FBS
    controle C. PDGF-BB, 4 ng/mL PDGF-BB em meio livre de soro
    D. PDGF-BB aproveitar o grupo, PDGF-BB (4 ng/mL) e anticorpo policlonal anti-PDGF-BB (4 ng/mL) meio livre de soro
    grupo de E. BMSC, 2 x 10 5 BMSCs em meio livre de soro
    Grupo F. BMSCs-P, 2 x 10 5 BMSCs-P em meio livre de soro.
  4. Incuba durante 48 h a 5% de CO 2 e 37 ° C numa incubadora umidificado. Depois, retire as células migradas na parte inferior da câmara e coletá-los para a quantificação do número de BMSCs-T por citometria de fluxo.
    1. Remover células migradas na câmara baixa do lado com uma espátula de célula e ressuspender as células migradas com 2 mL de PBS. Quantificar o número de BMSCs-T migrado por citometria de fluxo 29.

5. Estabelecimento de uma transplantação de andaime e raspagem crítico osso defeito modelo murino

Nota: camundongos BALB/c masculino (7 semanas de idade) foram comprados de Guangdong Medical Laboratory Animal Center (Guangdong, China).

  1. Registrar um total de 42 ratos masculinos para o defeito ósseo raspagem experimentam. Aleatoriamente, divida os ratos em três grupos, com quatorze anos em cada grupo que receber os seguintes tratamentos: grupo A, sem implantes; Grupo B, PH andaimes implantaram (PLGA/nhập); e grupo C, PHp andaimes implantados (PLGA/nhập/LV-pdgfb).
  2. Anestesiar os animais com a administração intraperitoneal de pentobarbital de sódio (50 mg/kg). Remover peles com colar depilatório e limpar a cabeça pele com solução de álcool de 75% antes de fazer a primeira incisão. Fixe a cabeça de cada rato com um instrumento estereotáxico para mantê-lo ainda durante a cirurgia.
  3. Fazer uma incisão inicial com um bisturi e aumentá-la em seguida a sagacidadeh tesoura para criar uma incisão de 1 cm linear da pele. Raspe o periósteo do osso do crânio para revelar a superfície óssea do crânio usando um cotonete estéril.
  4. Usar um burr trépano para criar um defeito de tamanho crítico de 4 mm de diâmetro no lado esquerdo do calvaria 30. Transplantar o andaime em local do defeito ósseo.
    Nota: Defeitos de tamanho crítico (CSD) foram originalmente definidos como " o menor tamanho intra-ósseo ferida em um determinado osso e espécie de animal que não vai se curar espontaneamente durante o tempo de vida do animal. " neste experimento, o defeito de 4 mm de diâmetro é um defeito ósseo de tamanho crítico, de acordo com o estudo anteriormente 31 , 32.
  5. Usar fórceps oftálmico para mover o periósteo volta suavemente para cobrir o local cirúrgico. Suturar a incisão pele com três pontos por cm.
  6. Executar cuidados das. Administre a analgésica buprenorfina (0,1 mg/kg) para aliviar a dor. Manter a temperatura do corpo com uma almofada de aquecimento até o animal desperta. Posteriormente, alimentar os animais com comida e água e gravar sua atividade todos os dias até o final do teste. Nota: A Analgesia pode ser administrada antes do procedimento, dependendo de seu Comitê de cuidados animais locais orientações.

6. Na Vivo Imagem de angiogênese dentro o defeito ósseo com MPM

Nota: conjugado FITC 250 kD dextran (10 mg/mL) em solução salina foi injetado por via intravenosa em ratos para obter alta-SNR (relação sinal-ruído) imagens de novos vasos sanguíneos de acordo com um estudo anterior 33. Por favor, note que este é um procedimento de sobrevivência...

  1. montar o sistema de microscopia do multiphoton (MPM) para dois fotões animada fluorescência (TPEF) e imagem latente de sinal (SHG) segunda geração harmônica.
  2. Anestesiar os animais com uma injeção intraperitoneal de pentobarbital de sódio (50 mg/kg) e imobilizar os animais em uma placa de aquecimento para manter a temperatura corporal a 37 ° C durante os experimentos. Use gás de isoflurano 3,0% em 100% de oxigênio para manter satisfatória anestesia e analgesia durante o processo de geração de imagens. Intraperitonealmente injetar soro fisiológico (200 µ l/animal) para evitar a desidratação antes de imagem.
  3. Tune o laser de femtosecond Ti-safira para 860 nm. Criar uma área de 512 x 512 µm amostragem pela verificação de um par de espelhos galvo e usar NA1.0 lente objetiva de imersão de água para focusthe feixe de excitação para a amostra e para coletar o sinal TPEF/SHG retroespalhado.
    Nota: A imagem foi realizada em um casa-compilação do multiphoton microscópico sistema da imagem latente (MPM). Durante a imagem latente, um laser de femtosecond Ti-safira estava sintonizado para 860 nm como o comprimento de onda de excitação ideal. O feixe de laser foi raster digitalizado através de um avião de amostra usando um par de espelhos de galvanômetro. Depois de passar por um espelho dicroico de 685 nm, o feixe centrou-se na amostra por um objectivo de NA1.0 X 20. Sinais TPEF e SHG induzidos foram coletados pelo mesmo objectivo. Os sinais foram divididos do laser da excitação pelo espelho dicroico mencionado acima e purificado por um filtro de passa-curto de 680 nm. Os sinais TPEF e SHG foram coletados por um feixe de fibras e conduzidos para um espectrógrafo. O detector no espectrógrafo foi uma matriz linear de tubos fotomultiplicadores (PMTs). A combinação do espectrógrafo e matriz linear PMTs ofereceu a capacidade de gravar o sinal em 16 bandas espectrais consecutivas, de 400 nm a 600 nm, em intervalos de 12,5-nm. Portanto, os sinais TPEF e SHG foram detectados simultaneamente e separados em domínios espectrais. Além disso, para geração de imagens 3D, um motor axial era usado para controlar a profundidade da imagem latente. A área de cada imagem foi definida como 512 x 512 µm, e o intervalo de profundidade foi definido como 2 µm (grupo controle, 5 µm). Notavelmente, 5 sites em cada defeito foram fotografadas para coletar dados estatisticamente significativos, e os sites de imagens selecionados foram distribuídos aleatoriamente e uniformemente ao longo do defeito.
  4. Scan 5 sites em cada defeito para coletar dados estatisticamente significativos para medir a formação de vasos.
    1. Uso procurar sites aleatoriamente e uniformemente distribuídos ao longo do defeito. Para o grupo de controle, tem o campo de visualizar a capa (FOV) área de osso original e a borda do defeito, mas para os grupos de PH e PHp, tem o FOV no cadafalso implantado.
    2. Fazer uma incisão de 1 cm de pele linear usando um bisturi e sutura da pele aberta à fixação para revelar o site de transplante. Use uma seringa para colocar uma gota de água entre a lente de imersão e transplantes para formar um copo de água.
  5. Imagem de adquirir pilhas cada 12 s mais um h 2 período de imagem. Exibir e analisar dados volumétricos utilizando um programa personalizado de MATLAB e quantificar as áreas de vaso sanguíneo com ImageJ software 34 , 35.

7. Análise da expressão de gene de pdgf-b e angiogênese relacionados Genes por RT-qPCR

Nota: PCR foi realizado seguindo as etapas usuais: 95 ° C por 30 s, 40 ciclos de 95 ° C por 5 s e 60 ° C por 30 s. fusão de Post-PCR curvas confirmaram a especificidade do único alvo-amplificação, e determinou-se a mudança de dobra do gene de interesse em relação a β-actina. A reação para cada amostra foi testada três vezes.

  1. Colheita implantou andaimes e os tecidos de ratos experimentais em 2, 4 e 8 semanas pós operação 36; amostras do grupo de controlo (n = 4), tomado nos pontos de tempo mesmo, deve ser de tecido ósseo adjacente.
    Nota: Em cada ponto do tempo (2, 4 e 8 semanas), eutanásia os ratos com inalação de CO 2. Dissecar o calvaria e, posteriormente, remover e colher os andaimes implantados desde o calvaria.
  2. Usar um reagente comercial para extrair o RNA total de cada amostra de acordo com o fabricante ' protocolo s. Use o Kit de transcrição reversa para inverter-transcrever o RNA em cDNA seguindo o fabricante ' protocolo de s.
  3. Executar quantitativo PCR em tempo real usando o sistema de detecção de SYBR Green; os primers são listados na tabela 1.
Primer(5'–3')
Gene para a frente inverter
pdgfb CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
vWF CTCTTTGGGGACGACTTCATC TCCCGAGAATGGAGAAGGAAC
VEGFR2 GAAATGACACTGGAGCCTACA AG TCCATGCTGGTCACTAACAGAA G
β-actin AGG GTATCCATGAAATAAGTGGTTAC CAAT GCAGTACATAATTTACACAGAAG

tabela 1: moda Pimer.

8. MicroCT análise de regeneração óssea

  1. Euthanize ratos com inalação de CO 2 no pós operação de 8 semanas. Em um ambiente bem ventilado, coloque cada rato numa jaula de rato limpa delicadamente e bomba de gás de CO 2 para a jaula para anestesiar os ratos antes da eutanásia.
  2. Dissecar o crânio para a imagem latente de microCT na região do defeito ósseo. Usuário os seguintes parâmetros nos experimentos de digitalização: 9 resolução µm, Al filtro de 0,5 mm, 50 kV tensão e atual 142 µA.
  3. Recon
  4. struct todos os dados de imagens usando o software comercial fornecidos pela empresa. Calibrar os exames usando a função de calibração de um software CTAn.
    Nota: Coloque uma unidade de Hounsfield (HU) sob os ratos em cada verificação.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Porosa cilíndrica de PLGA/nhập moldes 0,6 mm de altura e 4 mm de diâmetro foram fabricados com uma impressora 3D. As morfologias dos andaimes foram analisadas através de microscopia de varredura de elétrons e microCT. A figura 1A mostra a foto do cadafalso implantado. MicroCT varredura revelou que mais de 85% dos poros tinham tamanhos que variam de 200 a 400 µm (figura 1B). Imagem SEM demonstrou que a superfície do andaime tinha um microtopography áspero, com microporos (diâmetros aproximadamente 5-10 µm) que interligados dentro os andaimes (Figura 1 D-F). Aproximadamente 40% do montante total das partículas revestidas de LV-eGFP (4,5 x 105) libertado os andaimes PLGA/nhập começados com um efeito de explosão inicial no prazo de 24 h. A bioatividade dos vírus de LV lançados chegou a Cimeira em 24 horas e então continuamente diminuída, aproximando-se de 0 a 120 h (Figura 2). Estes dados indicam que a bioatividade de andaime-imobilizado mais partículas de LV pode ser mantida para até 96 h. Observou-se a capacidade de migração do MSCs-T com o método de FACS para investigar se LV carregando do cDNA de pdgf-b poderia expressar e conduzir a quimiotaxia BMSC, como mostrado em Figura 3. O controle positivo (C) e o grupo PDGF-BB-expressando (F) exibiram um nível significativamente mais elevado de migração BMSC do que os outros 4 grupos. Além disso, a migração de BMSCs no Grupo F foi significativamente maior do que no grupo C. Não havia diferenças significativas na migração de BMSC entre os outros 4 grupos.

Angiogênese dentro o defeito ósseo foi avaliada de 2 para a 8ª semana após a implantação pela MPM digitalização. A figura 4A mostra uma ilustração esquemática de um rato sob MPM digitalização. Angiogênese óbvia foi detectado nos grupos de PH e PHp, mas os vasos sanguíneos foram mal observável no grupo de controle, onde apenas uma camada de membranas fibrosas em toda a região do defeito formado (Figura 4B). Os gráficos do GIF mostram os tomographs vaso sanguíneo de cada grupo (Dados complementares). A área de novos vasos sanguíneos aumentada gradualmente ao longo do tempo em grupos PH e PHp, com padrões semelhantes de crescentes. Na 8ª semana, os vasos apareceram similares na morfologia àqueles observados na fase precoce; a única mudança foi que um número crescente de navios mais pequenos foi se tornando andaimes (Figura 4B). O BVA do grupo PHp foi significativamente maior do que dos outros dois grupos tempo em todos os pontos (Figura 4). Além disso, havia muitos locais de deposição de colágeno, como indicado pelos sinais SHG (a cor verde nos gráficos e gráficos GIF) nos grupos de PH e PHp, mas não no grupo controle (Figura 4B).

A fim de clarificar a relação da expressão PDGF-BB e angiogênese, comparamos os níveis de expressão da transcrição de gene de pdgf-b, vWFe VEGFR2 com o método de RT-qPCR em 2, 4 e 8 semanas pós-implantação ( Figura 5). Como esperado, expressão de pdgf-b aumentou significativamente no grupo PHp em todos os pontos de tempo, com um aumento de 5 a 13 vezes em comparação com o controle e grupos de PH (Figura 5A). Não houve diferença significativa entre o controle e o grupo de PH, e o nível de expressão do PDGF-BB permaneceu quase constante da semana 2, semana 8, como mostrado na Figura 5A. Os níveis de expressão de RNAm de vWF e VEGFR2 em todos os três grupos aumentaram gradualmente e foram a mais elevada no grupo de PHp em todos os três vez pontos (Figura 5B e 5C). Para o grupo de PH, não havia nenhuma significância estatística em relação ao grupo controle, apesar do óbvio angiogênese (Figura 4B).

Para confirmar ainda mais essa pdgf-b-andaimes contendo promovem osso regeneração na vivo usando criticamente tamanhos defeitos raspagem em camundongos BALB/c machos, microCT digitalização fornecido informações para avaliar a regeneração óssea em 8 semanas após a implantação. Como mostrado na Figura 6, defeitos no grupo PHp foram preenchidos com uma massa de tecidular de novo osso nos andaimes, Considerando que havia muito menos novo osso no controle e grupos de PH.

Figure 1
Figura 1: caracterização estrutural de um andaime PLGA/nhập 3D. (A) fotografia de um andaime impresso 3D. (B) A microCT imagem da porosidade total do andaime. (C) o microtopography da superfície do andaime observada por SEM em 60 X, 2.000 X (D), 5.000 X (E) e ampliação de 10.000 X (F). Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: preparação do Lentivirus e avaliação da Bioatividade das partículas LV-GFP. (A) representação esquemática da construção de vetor de Lentivirus. Após 48 h de transfeccao, observaram-se em condições de campo (C) de fluorescência de luz (B) e células HEK - 293FT. (D) avaliação In vitro da Bioatividade das partículas LV-GFP cumulativamente lançado de PLGA/nhập andaimes. Todos os dados são apresentados como a média ± SEM (n = 4). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3. Bioatividade de PDGF-BB como uma resposta potente fator quimiotático de migração BMSC. BMSCs-T (5 x 104) foram semeadas em cima transwell câmaras, com vários meios de condição, colocados no fundo das câmaras. (A) controle em branco, meio livre de soro; (B) FBS controlar, suplementado com 10% FBS; Controle (C) PDGF-BB, 4 ng/mL PDGF-BB em meio livre de soro; (D) PDGF-BB aproveitar o grupo, PDGF-BB (4 ng/mL) e anticorpo policlonal de anti-PDGF-BB (4 ng/mL) em meio livre de soro; (E) BMSCs grupo, 2 x 105 BMSCs em meio livre de soro; e (F) BMSCs-P grupo, 2 x 105 BMSCs-P em meio livre de soro. Todos os dados são mostrados como a média ± SEM (n = 4). #: comparação entre o grupo C e todos os outros grupos, exceto o Grupo F, # p < 0,0001. *: comparação entre o Grupo F e todos os outros grupos, * p < 0.05, * * * p < 0,0001. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Imagem de microscopia do Multiphoton de alta resolução (SHG/TPEF) e quantificação da angiogênese na região de defeito ósseo de Calvaria de Mouse.Trong > (A) A ilustração esquemática de um rato sob MPM digitalização. O círculo laranja representa o local do defeito, os túbulos vermelhos representam os vasos sanguíneos e o verde representa o colágeno. (B) Unoperated e animais operados foram escaneados com MPM no pós-implantação de 8 semanas. SHG, TPEF, SHG/TPEF mescladas, e imagens em 3D são mostradas. A linha pontilhada representa o limite ao longo do defeito ósseo no grupo de controle com base em sinais SHG. (C) vaso sanguíneo área quantificação dentro da área do defeito do PHp, PH e controle da semana 2 para pós-implantação semana 8. Todos os dados são mostrados como a média ± SEM (n = 5). : Análise estatística entre grupos PH e PHp, p < 0,0001. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: Análise de RT-qPCR de pdgf-b (A) e de Genes relacionados com angiogênese vWF (B) e VEGRF2 (C) expressão em três grupos. Amostras de 4 animais foram analisadas para cada ponto de tempo. #: comparação entre os grupos PHp e PH, p # < 0,05, p # < 0,01 e p #< 0,0001. *: comparação entre os grupos controle e PHp, * p < 0.05, * * p < 0,01, e * * * p < 0,0001. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: Avaliação de In Vivo formação óssea com MicroCT digitalização. Grupo de controle sem andaimes implantados. Grupo de PH dentro de andaime PLGA/nhập implantado somente. Grupo de PHp dentro implantado andaime PLGA/nhập modificado pelas partículas LV- pdgfb . Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Osso é um tecido altamente vascularizado, com uma capacidade única de curar e remodelar durante toda a vida de um indivíduo1continuamente. O nível da vascularização é importante para o reparo de osteogênese e defeito. Baixa vascularização limita a aplicação clínica ampla da engenharia de tecido ósseo. Construir um osso altamente vascularizado engenharia de tecidos, de acordo com a teoria da biomimética, tornou-se uma ferramenta para a reparação de defeitos ósseos de segmento grande. Vários tipos de andaimes foram aplicados com sucesso para reparar defeitos ósseos comparativamente pequenos. No entanto, para defeitos de osso crítica, a aplicação de andaimes para reparar ainda enfrenta obstáculos, principalmente devido à insuficiente de sangue fornecer para o reparo de defeito. Portanto, melhorar o fornecimento de sangue durante o processo de reparação de defeitos ósseos grandes é um dos maiores problemas em engenharia de tecidos.

As pessoas usam andaimes bioativos revestida de material para ajudar a estabelecer os necessários campos morfogenéticas que podem estimular, recrutar e promover a quimiotaxia, diferenciação e proliferação das células necessárias para a formação de neovasculature e osso 37. Neovasculature em engenharia de tecidos andaimes é essencial para as células receber oxigênio e nutrientes, para a remoção de resíduos de produtos e, finalmente, para o cumprimento da função de andaimes. Os objetivos deste estudo foram investigar angiogênese na vivo do multiphoton microscopia em um andaime PLGA/nhập geneticamente modificado, 3D-impresso para reparo de defeito de fragmento ósseo crítica e avaliar os efeitos do uso de regeneração óssea microCT.

Apesar da dramáticas realizações na engenharia de tecido ósseo, na vivo a visualização e quantificação de neovascularização em andaimes durante osso regeneração ainda é um desafio. Sistemas de imagem mais microscópicos são incapazes de fornecer informação volumétrica na angiogênese. Métodos de imagem tradicionais, como microCT, MRI e análise histológica, são destrutivos, complicado e trabalhoso e têm baixas resoluções espaciais e aquisição de imagem longa vezes38. No entanto, a imagem de MPM é uma romance modalidade de bio-imagem que pode capturar o vaso sanguíneo sinaliza na vivo de forma minimamente invasiva e de alta resolução. É capaz de detectar novos vasos mais finos do que 10 µm (Figura 4B). Além de imagens dos vasos sanguíneos, observou-se também uma massa de deposição de colágeno novo (a cor verde na Figura 4B) e os gráficos GIF no material complementar, como indicado pelos sinais de SHG, que indicam a formação de tecido ósseo de outro ângulo. Teoricamente, imagens de vasos sanguíneos podem ser obtidas sem a utilização de agentes de contraste. No entanto, no presente estudo, temos usado um agente de contraste para obter melhores imagens e removido pele local para garantir a adequada profundidade de digitalização. Isto seria desnecessário quando mais poderosos sistemas de imagem estão disponíveis no futuro para a imagem latente verdadeiramente não-invasiva.

HAp é um material biomédico para regeneração de tecido ósseo que é amplamente utilizado devido à sua boa osteocondução e traços de osteoindução. HAp tem boa capacidade de vinculação vetores de DNA e reter e estabilizar a vetores, incluindo vetores virais39. Em comparação com microsized HAp, partículas de HAp nanosized possuem áreas de superfície específicas alta e, portanto, mostram melhor comportamento celular e propriedades mecânicas40. Por estas razões, nhập partículas são um dos componentes dos andaimes. As imagens SEM superfície e transversais de PLGA/nhập cadafalso mostrado na Figura 1 indica que os andaimes fabricados apresentam uma estrutura de poros bem interligados e tamanhos de poros distribuídos uniformemente. A imobilização de vírus para as transportadoras biomaterial pode influenciar a atividade do vírus. Portanto, nós testamos a bioatividade de partículas LV libertado os andaimes por investigar sua atividade do transfection. Os perfis de liberação de partículas de LV dos andaimes e seus bioactivities foram avaliados em vitro, demonstrando a entrega controlada das partículas de LV bioativas durante cinco dias (Figura 2). Além disso, nosso estudo em vitro focada no potencial de PDGF-BB para estimular a migração de MSCs primários. Estes resultados sugerem que as partículas de LV expressaram Bioativo PDGF-BB e migração de BMSC efetivamente estimulada.

Para confirmar a capacidade para angiogênese e osso regeneração na vivo, PHp andaimes foram implantados em defeitos ósseos críticos raspagem murino. Formação de navio foi confirmada com marcadores angiogênico, análise de RT-qPCR e densidades de vaso sanguíneo observadas com imagem latente SHG/TPEF. Ambos os dois conjuntos de experimentos demonstraram que angiogênese e formação de vasos sanguíneos foram melhorados significativamente com o tratamento de andaimes geneticamente modificados. Estes resultados indicam que PDGF-BB não só estimula a angiogênese diretamente, mas também induz outros genes relacionados com angiogênese. Enquanto isso, as medições microCT demonstram que pdgf-b-contendo andaimes significativamente promoveu a formação óssea em comparação com os andaimes não modificados, que se correlaciona bem com o neovasculature no cadafalso. Estes resultados indicam que geneticamente modificados, bioativos andaimes melhoram significativamente a angiogênese e tecido de regeneração.

Os resultados aqui apresentados demonstram que a modificação genética mediada por lentivirus de andaimes facilita a reparação do defeito ósseo grande em um modelo de defeito de murino raspagem de osso crítica, provavelmente através de angiogênese melhorada. Além disso, na vivo imagem MPM fornece uma única ferramenta para compreender a angiogênese e osteogênese no osso moldes e permite mais elucidação de se um certo andaime é benéfico para a neovascularização. Imagem de microscopia intravital do multiphoton fornece uma modalidade para a compreensão da fisiologia e fisiopatologia da angiogênese em tecidos e andaimes. No entanto, existem várias limitações ao usar esta técnica. Em primeiro lugar, a preparação cirúrgica requer perícia particular. Inflamação causada pela operação não qualificada diminuirá significativamente o MPM, qualidade de imagem. Em segundo lugar, devido o MPM, limitação de velocidade de imagem, um suporte de cabeça de rato personalizados é necessário para reduzir os artefatos causados por batimento cardíaco e a respiração. Em terceiro lugar, para a imagem latente a longo prazo, os animais devem ser intraperitonealmente ou por via intravenosa injetados com soro fisiológico para prevenir a desidratação.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que eles têm não tem interesses financeiro concorrente.

Acknowledgements

Este estudo foi suportado pelo programa pavão Shenzhen, China (n. º 110811003586331), programa de pesquisa básica Shenzhen (n. º JCYJ20150401150223631, n. º JCYJ20150401145529020 e não. JCYJ20160331190714896), a Guangdong público pesquisa e capacitação programa especial (n º 2015A020212030), a Fundação Nacional de ciências naturais da China (n. º 81501893), o programa de pesquisa de Basic Major nacional da China (2013CB945503) e o Programa de inovação SIAT para excelentes jovens investigadores (Y5G010).

Materials

Name Company Catalog Number Comments
Poly(D,L-lactide-co-glycolide) (PLGA) Sigma P1941 L/G ratio 75:25, MW 66000-107000
Hydroxyapatite nanoparticles Sigma 702153 Average diameter < 200 nm
Chloroquine diphosphate salt Sigma C6628
FITC-conjugated 250-kD dextran Sigma FD250S
1,4-dioxane lingfeng,Shanghai 0.45 micron
Stericup filters Merck Millipore Corporation SLHV033RB
PDGF-BB Cdna Sino Biological, Inc MZ50801-G
Anti-PDGF-BB mouse polyclonal antibody  BioVision, Inc 5489-30T
PDGF-BB recombinant protein 4489-50
Calcium-phosphate transfection solution Promega Corporation E1200
L-DMEM Hyclone SH30021.01
DPBS Hyclone SH30028.01
Penicillin-Streptomycin, Liquid Thermo Fisher Scientific 15140122
FBS Thermo Fisher Scientific 10099-141
Transwell  Corning 3422
Male BALB/c mice Guangdong Medical Laboratory Animal Center 
sodium pentobarbital  Merck 1063180500
multiphoton microscopy A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).
isoflurane Keyuan, Shandong 401750169
TRIzol reagent Invitrogen 15596018
PrimeScript RT Master Mix (Perfect Real Time) Takara RR420B
SYBR Premix Ex Taq (Tli RNaseH Plus) Takara RR036B
Hematoxylin and eosin Beyotime C0105
Paraffin Leica  RM2235
Ultracentrifuge OPtima L-100XP Beckman Coulter L-100XP
Low-temperature printer  Tsinghua university A homemade in Tsinghua university
LightCycler 480 instrument  Roche 5815916001
microCT Bruker 1176
commercial software Bruker
Buprenorphine

DOWNLOAD MATERIALS LIST

References

  1. Hu, X., et al. GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone. J Cell Biochem. 114, (12), 2729-2737 (2013).
  2. Schroeder, J. E., Mosheiff, R. Tissue engineering approaches for bone repair: concepts and evidence. Injury. 42, (6), 609-613 (2011).
  3. Chiarello, E., et al. allograft and bone substitutes in reconstructive orthopedic surgery. Aging Clin Exp Res. 25, S101-S103 (2013).
  4. Elangovan, S., et al. The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor. Biomaterials. 35, (2), 737-747 (2014).
  5. Bouyer, M., et al. Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration. Biomaterials. 104, 168-181 (2016).
  6. Rezwan, K., et al. Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering. Biomaterials. 27, (18), 3413-3431 (2006).
  7. Burg, K. J., Porter, S., Kellam, J. F. Biomaterial developments for bone tissue engineering. Biomaterials. 21, (23), 2347-2359 (2000).
  8. Xiao, Y., et al. Modifications of collagen-based biomaterials with immobilized growth factors or peptides. Methods. 84, 44-52 (2015).
  9. Chen, G., Lv, Y. Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering. Curr Pharm Des. 21, (15), 1967-1978 (2015).
  10. Kofron, M. D., Li, X., Laurencin, C. T. Protein- and gene-based tissue engineering in bone repair. Curr Opin Biotechnol. 15, (5), 399-405 (2004).
  11. Chen, F. M., et al. New insights into and novel applications of release technology for periodontal reconstructive therapies. J Control Release. 149, (2), 92-110 (2011).
  12. Winn, S. R., et al. Gene therapy approaches for modulating bone regeneration. Adv Drug Deliv Rev. 42, (1-2), 121-138 (2000).
  13. Chang, P. C., et al. Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use. Hum Gene Ther. 20, (5), 486-496 (2009).
  14. Phipps, M. C., Xu, Y. Y., Bellis, S. L. Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds. Plos One. 7, (7), (2012).
  15. Gehmert, S., et al. Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs). Clin Hemorheol and Microcirc. 48, (1-3), 5-13 (2011).
  16. Chang, P. C., et al. PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration. Gene Ther. 17, (1), 95-104 (2010).
  17. Javed, F., et al. Significance of the platelet-derived growth factor in periodontal tissue regeneration. Arch Oral Biol. 56, (12), 1476-1484 (2011).
  18. Murali, R., et al. Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering. J Biomed Mater Res A. 104, (2), 388-396 (2016).
  19. Andrae, J., Gallini, R., Betsholtz, C. Role of platelet-derived growth factors in physiology and medicine. Genes Dev. 22, (10), 1276-1312 (2008).
  20. Wosnitza, M., et al. Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation. Differentiation. 75, (1), 12-23 (2007).
  21. Hankenson, K. D., et al. Angiogenesis in bone regeneration. Injury. 42, (6), 556-561 (2011).
  22. Schmidt, C., et al. Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography. Biomaterials. 30, (30), 5959-5968 (2009).
  23. Perng, C. K., et al. In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides. J Surg Res. 168, (1), 9-15 (2011).
  24. Sun, Y., et al. Imaging tissue engineering scaffolds using multiphoton microscopy. Microsc Res Tech. 71, (2), 140-145 (2008).
  25. Fan, X., et al. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging. PLoS One. 6, (1), e16348 (2011).
  26. Yeo, M. G., Kim, G. H. Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/β-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration. Chem Mater. 24, (5), 903-913 (2012).
  27. Mao, Y., et al. Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells. Int J Med Sci. 12, (5), 407-415 (2015).
  28. Li, J., et al. Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect. Acta Biomater. 42, 389-399 (2016).
  29. Abbasi, H., et al. Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia. Anim Reprod Sci. 163, 10-17 (2015).
  30. Pigossi, S. C., et al. Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model. J Biomed Mater Res A. (2015).
  31. Bos, G. D., et al. The effect of histocompatibility matching on canine frozen bone allografts. J Bone Joint Surg Am. 65, (1), 89-96 (1983).
  32. Hollinger, J. O., Kleinschmidt, J. C. The critical size defect as an experimental model to test bone repair materials. J Craniofac Surg. 1, (1), 60-68 (1990).
  33. Hollanders, K., et al. Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies. Curr Eye Res. 40, (6), 611-621 (2015).
  34. Gao, L. QSIM: quantitative structured illumination microscopy image processing in ImageJ. Biomed Eng Online. 14, 4 (2015).
  35. Kobat, D., et al. Deep tissue multiphoton microscopy using longer wavelength excitation. Opt Express. 17, (16), 13354-13364 (2009).
  36. Lohmann, P., et al. Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect. Biomaterials. 113, 158-169 (2016).
  37. Lv, J., et al. Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue. Biomed Mater. 10, (3), (2015).
  38. Guldberg, R. E., et al. 3D imaging of tissue integration with porous biomaterials. Biomaterials. 29, (28), 3757-3761 (2008).
  39. Boehler, R. M., et al. A PLG/HAp composite scaffold for lentivirus delivery. Biomaterials. 34, (21), 5431-5438 (2013).
  40. Heo, S. J., et al. Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process. J Biomed Mater Res A. 89, (1), 108-116 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics